 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 18, 2013 |
| Title |
GRO-seq_y93.sdc2RNAi_Emb |
| Sample type |
SRA |
| |
|
| Source name |
sdc-2(y93) mutant embryos fed with sdc-2(RNAi) bacteria
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
developmental stage: Embryo
genetic background: N2
genotype: sdc-2 (y93)
sample type: sdc-2(y93) fed with sdc-2(RNAi)
treatment: sdc-2 RNAi
|
| Treatment protocol |
Animals were collected from whichever stage was desired. After washing twice with M9 buffer, animals were washed with cold Nuclear Isolation Buffer (250 mM Sucrose, 10 mM Tris-HCl (pH 7.9), 10 mM MgCl2, 1 mM EGTA, 0.25% NP-40, 1 mM DTT, protease inhibitors, 4 units/ml SUPERaseIn (Ambion, AM2696). Animals were resuspended in Nuclear Isolation Buffer (embryos and starved L1 in 3 vol, L3 in 1 vol), and dripped into liquid nitrogen to freeze.
|
| Growth protocol |
sdc-2 and the negative control L4440 RNAi feeding bacteria were prepared by growing HT115 bacteria bearing the RNAi plasmid overnight in TB and ampicillin, inducing for 2 hours with 1 mM IPTG, pelleting, and resuspending in 1 vol (w/v) of LB with 20% glycerol. For samples that were to be treated with RNAi, embryos were harvested from gravid hermaphrodites and allowed to hatch off for 24 hr. NG Agar plates supplemented with 1 mM IPTG and 100 mg/ml Carbenicillin were spotted with super-induced RNAi bacteria and allowed to induce further overnight at 25°C. Hatched off L1 larvae were spotted on the RNAi plates and grown at 20°C until gravid.
For wild type samples, embryos were harvested from gravid hermaphrodites grown at 20°C on concentrated HB101. Embryos were allowed to hatch off and starve for 24 hr at 20°C. Worms were fed and grown to L3 stage under liquid culture (1 worm/ml; 10 mg/ml HB101) for 34 hr at 20°C.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Starved L1 and L3 samples were ground under liquid nitrogen by mortar and pestle. Larval samples, post-grinding, and embryo samples were dounced with a Kontes 2 ml glass dounce to release nuclei. Douncing and collection of nuclei was performed for up to 6 rounds as follows: dounce with 10X pestle A, 10X pestle B, 5 min centrifugation at 100xg, removal of nuclei-containing supernatant, and addition of an equal volume of Nuclear Isolation Buffer to the pellet. Nuclear isolation was monitored each round to determine effectiveness and when it was complete. The pooled supernatant was centrifuged for 5 min at 1000xg to pellet nuclei. The nuclear pellet was washed with Nuclear Freezing Buffer (40% Glycerol, 50 mM Tris-HCl (pH 8.3), 0.1mM EDTA, 5 mM MgCl2, 1 mM DTT, protease inhibitors, 4 units/ml SUPERaseIn). Approximately 1x108 nuclei were resuspended in 100 ul Nuclear Freezing Buffer and stored at -80°C until GRO-seq reactions were performed.
NRO reaction. Nuclei (100 ml) were mixed with an equal volume of reaction buffer (10 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 1 mM DTT, 300 mM KCL, 20 units of SUPERaseIn, 1% sarkosyl, 500 mM each of ATP, GTP, and Br-UTP, 2 mM CTP and 0.33 mM a-32P-CTP (3000Ci/mmole)). The reaction was allowed to proceed for 5 min at 30°C. The reaction was stopped by the addition of 2 ml (10X volume) of Trizol (Invitrogen). The phases were separated by addition of 400 ml of chloroform as per manufacturers instruction. An additional acid-phenol and then chloroform extraction were carried out, followed by precipitation with 2.5 volumes of ethanol. The pellet was washed in 75% ethanol before resuspending in 20 ml of DEPC-treated water. Base hydrolysis was performed on ice by addition of 5 ml 1 M NaOH and incubated on ice for 30 min. The reaction was neutralized by addition of 25 ml 1 M Tris-HCl (pH 6.8). The reaction was then run through a p-30 RNAse-free spin column (BioRad), according to the manufacturer’s instructions. The column flowthrough was brought to 100 ml with DEPC water and EDTA was added to a final concentration of 1 mM.
Bead pre-wash. All buffers used in bead enrichment steps were kept on ice and were supplemented with 4 units/ml of SUPERaseIN. Anti-deoxyBrU beads (Santa Cruz Biotech, #sc-32323-ac) were first washed three times with a pre-wash buffer: 0.25X SSPE, 500 mM NaCl, 1 mM EDTA, 0.05% tween for 5 min; washed twice in binding buffer: 0.25X SSPE, 37.5 mM NaCl, 1 mM EDTA, 0.05% tween for 5 min; blocked in bead blocking buffer: 0.25X SSPE, 1 mM EDTA, 0.05% tween, 0.1% PVP, and 1 mg/ml ultrapure BSA (Ambion, AM2618) for 1 hr; followed by one wash in binding buffer for 5 min. The ratio of beads to volume did not exceed 1:8 for any wash or blocking step. The beads were resuspended in a 25% slurry (original concentration).
Bead enrichment. NRO RNA was heat denatured at 70°C for 3 min and placed on ice for 2 min. 350 ml of binding buffer and 50 ml of bead slurry were added to the RNA, and the samples were incubated for 30 min on a rotating stand (8 rpm). The beads were washed once in binding buffer; once in low salt wash buffer: 0.2X SSPE, 1 mM EDTA, 0.05% Tween; once in high salt wash buffer: 0.25% SSPE, 137.5 mM NaCl, 1 mM EDTA, 0.05% Tween; and twice in TET: 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, .05% Tween. The NRO RNA was eluted three times (2X 125 ml, 1X 250 ml) with elution buffer: 20 mM DTT, 150 mM NaCl, 5 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.1% SDS. The NRO RNA was then isolated by a standard extraction-precipitation method: One acid-phenol extraction, one chloroform extraction, addition of NaCl to 300 mM and 1 ml of glycoblue (Ambion, AM9515) to the aqueous phase, precipitation with 2.5 volumes of cold ethanol, and a wash of the resulting pellet with 75% ethanol. The pellet was resupended in DEPC water at volumes appropriate for the subsequent step.
3’- end repair. NRO RNA was heated 70°C for 3 min, followed by incubation on ice for 2 min. 3 ml 10X T4 PNK buffer, 1 ml SUPERaseIn, and 2 ml of T4 Polynucleotide Kinase (NEB), were added and the reaction incubated for 30 min at 37°C. The reaction was brought to 100 ml with DEPC water and EDTA to a final concentration of 10 mM to stop the reaction. RNA was heat denatured as above and subjected to two more rounds of bead binding / elution as described above.
Poly-A tailing, reverse transcription and amplification. NRO RNAs were then polyadenylated as decribed in (Ingolia, NT, 2010). Poly-A tailed RNA (20 ml) was then reverse transcribed as follows: 2 pmol of reverse transcription primer (TruSeq_circ_RTP_pT: 5’- /5Phos/GATCGTCGGACTGTAGAACTCTGAAC / iSP18 / CACTCA / iSP18 / GCCTTGGCACCCGAGAATTCCATTTTTTTTTTTTTTTTTTTTVN -3’), 1 ml 12.5 mM dNTPs and 3 ml of DEPC water were added the mixture incubated at 75°C for 3 min. The primer (note the low concentration) is allowed to anneal at 42° for 10 min. 1 ml, 0.1 mM DTT; 1 ml, 1M Tris-Cl, pH 8.3; 1 ml SUPERaseIN; and 1 ml SuperScript III reverse transcriptase (Invitrogen, 18080051) were added and the reverse transcription was carried out at 48°C for 5 min and 54°C for 30 min. The reaction was stopped by incubation at 70°C for 10 min. The reaction was extracted once with buffer saturated phenol-chloroform (pH 8.0), once with chloroform, supplemented with 2 ml glycoblue and 300 mM NaCl, and then precipitated with 2.5 volumes of ethanol.
The NRO-cDNA library was then PAGE purified away from excess RT primer on an 8% denaturing PAGE gel as described in Ingolia (Ingolia, NT). The purified library was then circularized in an intra-molecular ligation reaction as follows: cDNA was resuspended in 15 ml of 10 mM Tris-HCl (pH 8.0) and mixed with 2 ml of 10X circLigase buffer, 1 ml 1 mM ATP, 1 ml of 50mM MnCl2, 1ml of circLigase (Epicentre). The reaction was incubated at 60° C for 90 min, with a brief centrifugation every 15 min to bring down condensation. The reaction was heat inactivated at 80° C for 10 min, extracted once with buffer saturated phenol-chloroform (pH 8.0), once with chloroform, supplemented with 2 ml glycoblue and 300 mM NaCl, and then precipitated with 2.5 volumes of ethanol.
The circularized NRO-cDNA library was resuspended in 10 ml of water and amplified and PAGE purified as described (Core et al., 2008) and quantified before submission for sequencing. Amplification was achieved using the TruSeq miRNA cloning oligo set (RP1: 5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’, Illumina part # 15005505; and RPI-#: 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3’, where the ‘#’ represents one of the 48 Illumina 6-base barcodes in the middle of the oligo, shown above as “NNNNNN”).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Libraries were sequenced with Illumina’s HiSeq 2000 platform. Reads were required to have passed the CASAVA 1.8 quality filtering to be considered further.
To remove reads containing the RT-PCR adapter, we used cutadapt version 0.9.5 (http://code.google.com/p/cutadapt/) with the following command (cutadapt -a TGGAATTCTCGGGTGCCAAGG -a AAAAAAAAAAAAAAAAAAAA -z -O 15 -e .1 --minimum-length=30).
The remaining reads were trimmed to 30 bp in length and aligned uniquely to the C. elegans WS230 genome using bowtie’s default settings (version 0.12.7), which permit 2 mismatches in the first 28 bp.
Because the 5’ base in each read most closely identifies the location of transcriptionally engaged RNA Polymerase prior to the run-on, we created pile-ups using only the first base of each read. The pile-up of reads mapping to both strands was normalized by the number of millions of reads that mapped uniquely to the genome and was multiplied by 1000 to obtain RPKM (reads per kilobase per million).
GRO-seq data from two biological replicates was averaged at each base pair genome-wide.
Genome_build: WormBase WS230
Supplementary_files_format_and_content: wig files of the GRO-seq data split into the plus and minus strands, and at 1 bp resolution or averaged across 25 bp
|
| |
|
| Submission date |
Dec 20, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Barbara J. Meyer |
| E-mail(s) |
bjmeyer@berkeley.edu
|
| Phone |
510 643 5583
|
| Organization name |
HHMI/UCB
|
| Department |
MCB
|
| Lab |
Meyer
|
| Street address |
16 Barker Hall #3204
|
| City |
Berkeley |
| State/province |
CA |
| ZIP/Postal code |
94720 |
| Country |
USA |
| |
|
| Platform ID |
GPL13657 |
| Series (2) |
| GSE43084 |
Using GRO-seq experiments to determine the mechanism of C. elegans dosage compensation's control of transcription |
| GSE43087 |
Condensin Controls Recruitment of RNA Polymerase II to Achieve X-Chromosome Dosage Compensation |
|
| Relations |
| SRA |
SRX212224 |
| BioSample |
SAMN01832586 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1056281_GRO-seq_y93.sdc2_Emb_replicateAVG_WS230_RPKM_minus.wig.gz |
31.6 Mb |
(ftp)(http) |
WIG |
| GSM1056281_GRO-seq_y93.sdc2_Emb_replicateAVG_WS230_RPKM_minus_25bp_negative.wig.gz |
6.4 Mb |
(ftp)(http) |
WIG |
| GSM1056281_GRO-seq_y93.sdc2_Emb_replicateAVG_WS230_RPKM_plus.wig.gz |
32.1 Mb |
(ftp)(http) |
WIG |
| GSM1056281_GRO-seq_y93.sdc2_Emb_replicateAVG_WS230_RPKM_plus_25bp.wig.gz |
6.5 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
