 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 18, 2013 |
| Title |
GRO-cap_N2_Emb |
| Sample type |
SRA |
| |
|
| Source name |
Wild-type embryos
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
developmental stage: Embryo
genetic background: N2
genotype: wild type
sample type: Wild-Type (N2)
digestion: TAP+
|
| Treatment protocol |
Animals were collected from whichever stage was desired. After washing twice with M9 buffer, animals were washed with cold Nuclear Isolation Buffer (250 mM Sucrose, 10 mM Tris-HCl (pH 7.9), 10 mM MgCl2, 1 mM EGTA, 0.25% NP-40, 1 mM DTT, protease inhibitors, 4 units/ml SUPERaseIn (Ambion, AM2696). Animals were resuspended in Nuclear Isolation Buffer (embryos and starved L1 in 3 vol, L3 in 1 vol), and dripped into liquid nitrogen to freeze.
|
| Growth protocol |
sdc-2 and the negative control L4440 RNAi feeding bacteria were prepared by growing HT115 bacteria bearing the RNAi plasmid overnight in TB and ampicillin, inducing for 2 hours with 1 mM IPTG, pelleting, and resuspending in 1 vol (w/v) of LB with 20% glycerol. For samples that were to be treated with RNAi, embryos were harvested from gravid hermaphrodites and allowed to hatch off for 24 hr. NG Agar plates supplemented with 1 mM IPTG and 100 mg/ml Carbenicillin were spotted with super-induced RNAi bacteria and allowed to induce further overnight at 25°C. Hatched off L1 larvae were spotted on the RNAi plates and grown at 20°C until gravid.
For wild type samples, embryos were harvested from gravid hermaphrodites grown at 20°C on concentrated HB101. Embryos were allowed to hatch off and starve for 24 hr at 20°C. Worms were fed and grown to L3 stage under liquid culture (1 worm/ml; 10 mg/ml HB101) for 34 hr at 20°C.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Starved L1 and L3 samples were ground under liquid nitrogen by mortar and pestle. Larval samples, post-grinding, and embryo samples were dounced with a Kontes 2 ml glass dounce to release nuclei. Douncing and collection of nuclei was performed for up to 6 rounds as follows: dounce with 10X pestle A, 10X pestle B, 5 min centrifugation at 100xg, removal of nuclei-containing supernatant, and addition of an equal volume of Nuclear Isolation Buffer to the pellet. Nuclear isolation was monitored each round to determine effectiveness and when it was complete. The pooled supernatant was centrifuged for 5 min at 1000xg to pellet nuclei. The nuclear pellet was washed with Nuclear Freezing Buffer (40% Glycerol, 50 mM Tris-HCl (pH 8.3), 0.1mM EDTA, 5 mM MgCl2, 1 mM DTT, protease inhibitors, 4 units/ml SUPERaseIn). Approximately 1x108 nuclei were resuspended in 100 ul Nuclear Freezing Buffer and stored at -80°C until GRO-seq reactions were performed.
All NRO-reactions and bead enrichment steps for GRO-cap were carried out as described above, with the exception that the RNA for GRO-cap was not base hydrolyzed. After the first bead binding, the TruSeq RNA 3’ Adapter (RA3), (Illumina part # 15013207) was ligated to the 3’-end of the NRO RNA. First, 50 pmoles of the 3’-adapter were mixed with NRO RNA, and 2 ml 50% PEG 8000, brought to 14 ml with DEPC water, incubated at 70°C for 3 min and put on ice for 2 min. Then, 2 ml of 10X T4 RNA Ligase I buffer, 2 ml 10 mM ATP, 1 ml SUPERaseIN, and 1.5 ml T4 RNA Ligase I (NEB, M0204) were added and reaction incubated at 22°C for 4-6 hr. The reaction was then brought to 100 ml with binding buffer and subjected to a second round of bead enrichment.
After the second bead enrichment, 5’ mono-phosphate RNAs were selected against in two successive steps. First, to selectively degrade RNAs with a 5’-mono-phosphate, NRO RNA was resuspended in 16.5 ml DEPC water, mixed with 0.5 ml SUPERaseIN, 2 ml 10X Terminator reaction buffer A, and 1 ml of Terminator 5’-phosphate-dependent exonuclease (Epicentre, TER51020), and incubated at 30°C for 1 hr. The reaction was extracted and precipitated using the standard method (above), and resupended in 10 ml DEPC water. Second, 5’-mono-phospate RNAs were deposphorylated to prevent their participation in subsequent ligation reactions. For this, the RNA was then mixed with 1 ml SUPERaseIN, 14.5 ml DEPC water, 10X Antarctic Phosphatase buffer, 1.5 ml of Antarctic Phosphatase (NEB, M0289S), and incubated at 37°C for 30 min. The reaction was brought to 200 ml with 10 mM Tris-HCl (pH 7.5), 5 mM EDTA, and heat inactivated at 65°C for 5 min. The reaction was then extracted and precipitated using the standard extraction method and resuspended in 10 ml DEPC water.
The 5’-capped RNAs then were prepared for ligation and the final library preparation steps. The NRO RNAs were then split in half and the experimental sample was treated with Tobacco Acid Pyrophosphatase (TAP): 1 ml SUPERaseIN, 15 ml DEPC water, 3 ml 10X TAP buffer, and 1 ml TAP (Epicentre, T19500), incubation at 37°C for 1 hr. The control reaction was treated identically except for the addition of TAP. The reaction was brought to 200 ml and then extracted and precipitated using the standard method. The TruSeq RNA 5’ Adapter (RA5), (Illumina part # 15013205) was ligated to the 5’-end of the NRO RNA. First, 50 pmoles of the 5’-adapter were mixed with NRO RNA, and 2 ml 50% PEG 8000, brought to 14 ml with DEPC water, incubated at 70°C for 3 min and put on ice for 2 min. Then, 2 ml of 10X T4 RNA Ligase I buffer, 2 ml 10 mM ATP, 1 ml SUPERaseIN, and 1.5 ml T4 RNA Ligase I (NEB, M0204) were added and reaction incubated at 22°C for 4-6 hr. The reaction was then brought to 100 ml with binding buffer and subjected to a third round of bead enrichment. After the third enrichment, samples were reverse transcribed, amplified and PAGE purified as described in (Core, Waterfall, and Lis, 2008), and quantified before submission for sequencing.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Libraries were sequenced with Illumina’s HiSeq 2000 platform. Reads were required to have passed the CASAVA 1.8 quality filtering to be considered further.
To remove reads containing the RT-PCR adapter, we used cutadapt version 0.9.5 (http://code.google.com/p/cutadapt/) with the following command (cutadapt -a TGGAATTCTCGGGTGCCAAGG -a AAAAAAAAAAAAAAAAAAAA -z -O 15 -e .1 --minimum-length=30).
The remaining reads were trimmed to 30 bp in length and aligned uniquely to the C. elegans WS230 genome using bowtie’s default settings (version 0.12.7), which permit 2 mismatches in the first 28 bp.
Because the 5’ base in each read identifies the 5'-cap, we created pile-ups using only the first base of each read. The pile-up of reads mapping to both strands was normalized by the number of millions of reads that mapped uniquely to the genome (reads per million).
GRO-cap data from the TAP+ libraries, TAP- control libraries, and TAP+ with TAP- subtracted are included
Genome_build: WormBase WS230
Supplementary_files_format_and_content: wig files of the GRO-seq data split into the plus and minus strands
|
| |
|
| Submission date |
Dec 20, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Barbara J. Meyer |
| E-mail(s) |
bjmeyer@berkeley.edu
|
| Phone |
510 643 5583
|
| Organization name |
HHMI/UCB
|
| Department |
MCB
|
| Lab |
Meyer
|
| Street address |
16 Barker Hall #3204
|
| City |
Berkeley |
| State/province |
CA |
| ZIP/Postal code |
94720 |
| Country |
USA |
| |
|
| Platform ID |
GPL13657 |
| Series (2) |
| GSE43085 |
Development of GRO-cap (GRO-seq followed by 5'-cap enrichment) to map transcription start sites in C. elegans |
| GSE43087 |
Condensin Controls Recruitment of RNA Polymerase II to Achieve X-Chromosome Dosage Compensation |
|
| Relations |
| SRA |
SRX212227 |
| BioSample |
SAMN01832589 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1056284_GRO-cap_N2_Emb_TAP+.minus.TAP-_1bp_RPM_minus.wig.gz |
9.8 Mb |
(ftp)(http) |
WIG |
| GSM1056284_GRO-cap_N2_Emb_TAP+.minus.TAP-_1bp_RPM_plus.wig.gz |
10.0 Mb |
(ftp)(http) |
WIG |
| GSM1056284_GRO-cap_N2_Emb_TAP+_1bp_RPM_minus.wig.gz |
5.8 Mb |
(ftp)(http) |
WIG |
| GSM1056284_GRO-cap_N2_Emb_TAP+_1bp_RPM_plus.wig.gz |
5.9 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
