|
| Status |
Public on Sep 16, 2013 |
| Title |
uninfected miR-146 knockdown_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
zebrafish embryo_uninfected miR-146 knockdown
|
| Organism |
Danio rerio |
| Characteristics |
tag: zebrafish embryo
injected with: miR-146a and miR-146b morpholino at 1-cell stage
genotype/variation: miR-146 knockdown
infected with: PBS (mock) at 28 hpf
time point: 8 hpi
|
| Treatment protocol |
Morpholino oligonucleotides (GeneTools) were diluted to the desired concentration in 1× Danieau buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO3)2, 5.0 mM HEPES; pH 7.6) containing 1% phenol red (Sigma-Aldrich) and approximately 1 nl was injected at the 1-2 cell stage using a Femtojet injector (Eppendorf). Morpholinos for miR-146a (5’ACCATCTATGGAATTCAGTTCTCAG3’) and miR-146b (5’GACACCCTTGGAATTCAGTTCTCAA3’) target the miRNA guide strand and were used in combination, at a concentration of 0.75 mM for each morpholino. As a control the standard control morpholino from GeneTools was used as previously described (Kanwal et al., 2013, J. Immunol. 190:1631-45. At 28 h postfertilization (hpf), embryos were injected with S. typhimurium SL1027 or mock-injected with PBS (phosphate buffered saline) into the caudal vein close to the urogenital opening and pools of 20–40 embryos were collected at 8 hours post infection (hpi). Two independent experiments were performed for RNAseq analysis of biological duplicates.
|
| Growth protocol |
Zebrafish were handled in compliance with the local animal welfare regulations and maintained according to standard protocols (http://ZFIN.org). Embryos were grown at 28,5°C in egg water (60µg/ml Instant Ocean sea salts).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Embryos were snap frozen in liquid nitrogen and kept at -80°C. Total RNA was isolated using the miRNeasy Mini kit (Qiagen) with an on-column DNA purification with RNase Free DNase set (Qiagen). RNA quality of samples for RNAseq analysis was checked with an Agilent Bioanalyzer 2100 using the RNA 6000 Nano series Kit (Agilent, Santa Clara, CA, USA). All samples had a RNA integrity value (RIN) of 10.
A total of 3 μg of RNA was used to make RNAseq libraries using the Illumina TruSeq RNA Sample Preparation Kit v2 (Illumina Inc., San Diego, USA). In the manufacturer’s instructions two modifications were made. In the adapter ligation step 1 µl instead of 2.5 µl adapter was used. In the library size selection step the library fragments were isolated with a double Ampure XP purification with a 0.7x beads to library ratio. The resulting mRNA-Seq library was sequenced using an Illumina HiSeq2000 instrument according to the manufacturer’s description with a read length of 2 x 50 nucleotides.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Sample 6
|
| Data processing |
Image analysis and base calling was done by the Illumina HCS version 1.15.1
Sequence reads were quality trimmed using the quality_trim module in the CLCbio Assembly Cell v4.0.6. Filtered reads were mapped to Ensembl transcripts (Zv9_63) using the ref_assemle_short module in the CLCbio Assembly Cell v4.0.6.
Accumulation of transcripts to Ensembl genes was done by first converting the mapping files to a table with the assembly_table module in the CLCbio Assembly Cell v4.0.6. Secondly, a custom script was used that sums all reads belonging to the same gene. Non-uniquely mapped reads were divided between genes according to their ratio of uniquely mapped reads. Finally, read counts of transcripts belonging to the same gene were summed to obtain count data at Ensembl gene level.
Fold-change and differential expression significance values were calculated from gene level read counts using the DESeq package (version 1.8.3) available in Bioconductor (version 2.10).
Genome_build: Danio_rerio.Zv9.63.dna.toplevel downloaded from http://www.ensembl.org/info/data/ftp/index.html
Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample
|
| |
|
| Submission date |
Mar 15, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Annemarie H. Meijer |
| E-mail(s) |
a.h.meijer@biology.leidenuniv.nl
|
| Organization name |
Institute of Biology, Leiden University
|
| Department |
Animal Sciences and Health
|
| Street address |
Einsteinweg 55
|
| City |
Leiden |
| ZIP/Postal code |
2333 CC |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL14875 |
| Series (2) |
| GSE45209 |
MicroRNA-146 function in the innate immune response of zebrafish embryos to Salmonella typhimurium infection [RNA-seq] |
| GSE45410 |
MicroRNA-146 function in the innate immune response of zebrafish embryos to Salmonella typhimurium infection |
|
| Relations |
| SRA |
SRX250115 |
| BioSample |
SAMN01978946 |
