NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1128671 Query DataSets for GSM1128671
Status Public on May 10, 2013
Title ETV1sh2 Replicate 1
Sample type RNA
 
Source name LNCaP Cells
Organism Homo sapiens
Characteristics cell line: LNCaP
transfected: ETV1sh2
Treatment protocol LNCaP cells infected in triplicate with three different shRNA lentiviruses, Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 39 UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. Three days after infection, RNA was harvested for expression profiling.
Growth protocol LNCaP cells are growing logarithmically in RPMI with 10% fetal bovine serum.
Extracted molecule total RNA
Extraction protocol RNA is extracted using Rneasy per protocol. RNA quality was assessed using the Agilent 2100 Bioanalyzer and the RNA 6000 Nano kit (Agilent Technologies Inc., Palo Alto, CA).
Label biotin
Label protocol ~500 ng of total RNA was used to prepare biotin-labeled RNA using Ambion Illumina TotalPrep RNA Amplification Kit (Cat# AMIL1791, Applied Biosystems, Foster City, CA). Briefly, 500 ng of total RNA was used to synthesize the first strand of cDNA using ArrayScript reverse transcriptase and an oligo(dT) primer bearing a T7 promoter. The single-stranded cDNA was then converted into a double-stranded DNA (dsDNA) by DNA polymerase^ I in the presence of /E. coli/ RNase H and DNA ligase. After column purification, the dsDNA was served as a template for in vitro transcription in a reaction containing biotin-labeled UTP, unlabeled NTPs and T7 RNA Polymerase.
 
Hybridization protocol The amplified, biotin-labeled antisense RNA (aRNA) was purified and quality was assessed using the Agilent 2100 Bioanalyzer and the RNA 6000 Nano kit. 750 ng of aRNA in 5 ul was mixed with 10 ul of hybridization reagents and heated at 65C for 10min. After cooled to room temperature, total 15 ul of the hyb solution was applied to Illumina MouseRef-8 v2 chip. The chip was incubated for about 18 hours at 58C.
Scan protocol After washing and staining with streptavidin-Cy3, the chip was scanned using Illumina BeadArray Reader. The scanning was done using standard DirectHyb Gene Expression protocol with the following settings: Factor=1, PMT=587, Filter=100%.
Data processing The raw data was extracted using Illumina BeadStudio software without normalization. Raw data was imported into Partek genomic suite.
 
Submission date Apr 23, 2013
Last update date May 10, 2013
Contact name Yu Chen
E-mail(s) cheny1@mskcc.org
Phone 646-888-2163
Organization name Memorial Sloan Kettering Cancer Center
Department Human Oncology and Pathogenesis Program
Lab Chen
Street address 1275 York Ave, Box 20
City New York
State/province NY
ZIP/Postal code 10065
Country USA
 
Platform ID GPL6947
Series (2)
GSE46329 Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells
GSE47220 ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss

Data table header descriptions
ID_REF
VALUE Partek Genomic Suite was used to Log2 transform raw data followed by Quartile normalization
Detection Pval

Data table
ID_REF VALUE Detection Pval
ILMN_1343291 14.391926 0
ILMN_1343295 12.766729 0
ILMN_1651199 5.1469216 0.6192358
ILMN_1651209 5.5707035 0.2094862
ILMN_1651210 5.4294643 0.3135705
ILMN_1651221 5.6277328 0.1818182
ILMN_1651228 13.040588 0
ILMN_1651229 8.4284 0
ILMN_1651230 5.513925 0.2450593
ILMN_1651232 6.1987233 0.02898551
ILMN_1651235 5.3316317 0.4295125
ILMN_1651236 5.743877 0.1185771
ILMN_1651237 8.31689 0
ILMN_1651238 4.4325876 0.9907773
ILMN_1651249 5.778405 0.1080369
ILMN_1651253 5.3316317 0.4321476
ILMN_1651254 10.258652 0
ILMN_1651259 5.6458797 0.173913
ILMN_1651260 4.9864726 0.7760211
ILMN_1651262 12.17385 0

Total number of rows: 48803

Table truncated, full table size 1487 Kbytes.




Supplementary data files not provided
Raw data are available on Series record
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap