|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Feb 06, 2014 |
Title |
Rep1 2h |
Sample type |
SRA |
|
|
Source name |
L1-stage N2 worms, 2h
|
Organism |
Caenorhabditis elegans |
Characteristics |
strain: Bristol N2 Stage: L1 tissue: whole body treatment: alpha-amanitin time after treatment: 2h
|
Extracted molecule |
total RNA |
Extraction protocol |
Worms were harvested at each sampling time point during the next 8 hours, washed three times with M9 medium, resuspended in TRIzol reagent (Life Technologies) and frozen in liquid nitrogen. The worms were broken open by five repeats of freeze and thaw using liquid nitrogen and a 42 C heating block, before RNA was extracted and purified according to the supplier's protocol with the modification that RNA was incubated with 50% 2-propanol at -80 C overnight for efficient precipitation of small RNA. Small RNA libraries were prepared from extracted total RNA using TruSeq Small RNA Sample Prep Kit (Illumina) according to the supplier's protocol.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
2h_A
|
Data processing |
Base calling and demultiplexing were done with RAT 1.13.48 and Casava v1.8.0. For each read, the 3' adaptor TGGAATTCTCGGGTGCCAAGG was removed by aligning it to the read allowing one or two mismatches in prefix alignments of at least seven or ten bases, respectively. Reads with Low-complexity were filtered out based on their dinucleotide entropy (removing <1% of the reads). Only reads with a minimum length of 14nt were retained. Alignments to the miRNA database miRBase release 18 (http://www.mirbase.org/) were performed by the software bowtie (version 0.9.9.1) with parameters -v 2 -a -m 100, tracking up to 100 best alignment positions per query and allowing at most two mismatches. The expression of each miRNA was determined by counting the number of associated reads. To compensate for differences in the read depths of the individual libraries, each sample was divided by its total number of counts and multiplied by the average sample size. The resulting values were log2 transformed using a pseudocount of 1 (y=log2(x+1)). Genome_build: miRBase release 18 Supplementary_files_format_and_content: 'GSMxxx_BSSE-QGF*.tab' files are tab-delimited text files containing the sequences and non-normalized, raw counts after the removal of the 3' adaptor and before the alignments. Supplementary_files_format_and_content: 'GSE46753_normalized_miRNA_expression.ama.tab' is a tab-delimited text file that includes the normalized miRNA expression levels.
|
|
|
Submission date |
May 08, 2013 |
Last update date |
May 15, 2019 |
Contact name |
Dimos Gaidatzis |
E-mail(s) |
d.gaidatzis@fmi.ch
|
Organization name |
Friedrich Miescher Institute
|
Street address |
Maulbeerstrasse 66
|
City |
Basel |
ZIP/Postal code |
4058 |
Country |
Switzerland |
|
|
Platform ID |
GPL13657 |
Series (1) |
GSE46753 |
microRNA decay analysis in the first larval stage Caenorhabditis elegans |
|
Relations |
BioSample |
SAMN02141535 |
SRA |
SRX276191 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1138168_BSSE-QGF-4639_D10RGACXX_GCCAAT_L004_R1_001.tab.gz |
17.2 Mb |
(ftp)(http) |
TAB |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
Processed data are available on Series record |
|
|
|
|
|