GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1145575

Query DataSets for GSM1145575

Status

Public on Jul 05, 2013

Title

wildtype, 2nd replicate

Sample type

SRA

Source name

wt_B

Organism

Caenorhabditis elegans

Characteristics

tissue: whole animal
Stage: L3
age: wildtype: Bristol N2

Growth protocol

Per sample, around 300,000 worms were grown on a large plate and harvested at L3 stage (36 hours after hatching at 20°C).

Extracted molecule

total RNA

Extraction protocol

Worms were washed off the plate with cold M9 and washed 3-4 times. The worm pellet was resuspended in 2ml of cold Nuclear Run-On (NRO) lysis buffer (10mM Tris pH 7.5, 2mM MgCl2, 3mM CaCl2, 0.5% IGEPAL and 10% glycerol), transferred to a steel dounce (on ice) and stroked 20 times. The worm lysate was centrifuged for 2min at 40g and the supernatant was centrifuged again for 5min at 1000g to pellet the nuclei. Next, the supernatant was discarded and the nuclei pellet was washed two times with 1ml of cold NRO lysis buffer and one time with 1ml of cold Freezing Buffer (50mM Tris-CL pH 8.3, 40% glycerol, 5mM MgCl2, 0.1 mM EDTA). Nuclei were then resuspended in 100µl of Freezing Buffer and used for the NRO reaction. // NRO reaction and DNase digestion: 100µl of nuclei were mixed with an equal volume of reaction buffer (10mM Tris-Cl pH 8.0, 5mM MgCl2, 1mM DTT, 300mM KCL, 20 units of SUPERase In, 1% sarkosyl, 500µM ATP, GTP, and Br-UTP, 2μM CTP) and incubated for 5 minutes at 32°C. The reaction was stopped with 750μl of TRIzol reagent (Invitrogen) and the RNA was extracted following the manufacturer's instructions. The RNA pellet was resuspended in 85µl water and treated with 5µl of turbo DNase (Ambion) in a total volume of 100µl and incubated at 37°C for 30 minutes. The RNA was then extracted by phenol:chloroform and precipitated with one volume of isopropanol with 1/10 volume of Sodium Acetate 3M and 10µg of Glycoblue (Ambion). // Base Hydrolysis of RNA: The hydrolysis of RNA was performed using fragmentation reagent (Ambion) for 15min at 70°C and the product was purified by p-30 RNase free spin column (BioRad), following the manufacturer’s instruction. // Immunopurification of Br-U RNA and RNA-end repair: The purification of the Br-U RNA and the end repair of the purified Br-U RNA was performed as described in (Core et al., 2008).
Adapter ligation and library preparation: For the ligation of 5' and 3' adapters to Br-U RNA we used reagents contained in the ScriptMiner™ Small RNA-sequencing kit (Epicentre) and we immunopurified the ligated Br-U RNA product after each ligation with anti-deoxy-BrU beads (Santa Cruz Biotech (sc-32323-AC). The ligated Br-U RNA was then reverse-transcribed and PCR-amplified with properly-indexed primers for 18 cycles, following the ScriptMiner™ Small RNA-sequencing kit (Epicentre) manufacturer's instructions. The NRO-cDNA libraries were purified by phenol:chloroform, the DNA was precipitated as above and then ran on a non-denaturing 1XTBE, 8% acrylamide gel and stained with SYBR gold (Invitrogen). DNA fragments ranging in size from 120bp to 300bp was excised from the gel and eluted by incubating in TE + 300mM NaCl overnight with rotation. The DNA libraries were then extracted, precipitated, and sent for sequencing.

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

Illumina HiSeq 2000

Description

RNA (via transcriptionally engaged polymerase II)

Data processing

Library strategy: GRO-Seq
Two independent biological replicates were generated for each strain (N2 (WT) and zfp-1 (ok554)). Sequencing was performed to a length of 50 nucleotides. Since cloned RNA ranged from 16 to 180 nucleotides in length, the sequencing reads were post-processed to eliminate the 3' linker sequence [AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC], if present, so that resulting reads ranged from 16 to 50 nucleotides in length. The reads were then aligned using bwa 0.6.1 to the C. elegans genome (ce6 assembly), and rRNA reads were removed based on genomic location.
After filtering, we obtained 8,484,939 reads from WT (5.039.164 reads from the first replicate and 3,445,775 reads from the second replicate) and 7,539,039 reads from zfp-1 (ok554) (4,765,744 reads from the first replicate and 2,773,315 reads from the second replicate). After ascertaining concordant results with the individual replicate pairs (WT vs. mutant) (data not shown), replicate reads for each WT and mutant were pooled, using downsampling on the replicate with higher read count to ensure equal representation of either replicate, and the pooled reads were processed together to increase statistical power.
For each annotated C. elegans transcript, the aligned reads were binned based on the annotated transcriptional start site (TSS) and transcriptional termination site (TTS) into 3 regions as follows: 'promoter' (from 600bp upstream of the annotated TSS to 200bp downstream), 'gene body' (from 200bp downstream of the annotated TSS to 200bp upstream of the annotated TTS), and 'gene end' (from 200bp upstream of the annotated TTS to 400bp downstream).
We then calculated region-specific RPKM values (#total reads / (region length (KB) X # mapped reads (M)) for these regions and considered for further analysis only transcripts with RPKM values of > 1 for the 'gene body' (= transcribed genes).
The stalled index was calculated as the log2 ratio of 'promoter' RPKM over 'gene body' RPKM for each gene. Genes with a stalled index more than 1 (i.e. at least twice as many promoter reads as gene body reads) were considered stalled. The average profile in Figure S6B was calculated using Cistrome/Galaxy (Liu et al., 2011) using the CEAS tool (enrichment on chromosome and annotation).
Genome_build: ce6
Supplementary_files_format_and_content: .wig: alignment wiggle files of paired replicates, rescaled to a target of 1 Mio

Submission date

May 21, 2013

Last update date

May 15, 2019

Contact name

Sebastian Hoersch

Organization name

Massachusetts Institute of Technology

Department

David H. Koch Institute for Integrative Cancer Research at MIT

Lab

Bioinformatics and Computing Core