NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM127012 Query DataSets for GSM127012
Status Public on Aug 18, 2006
Title RL-SAGE_MGGW_Vegetative mycelium_Gowda et al., 2004
Sample type SAGE
Anchor NlaIII
Tag Count 237054
Tag Length 21
 
Source name The Ohio State University
Organism Pyricularia grisea
Characteristics A total of 7,292 sequence reads from the RL-SAGE library were sequenced at Arizona Genomics Institute. The ditags and unique tags were extracted from these sequences using SAGEspy program developed at the Ohio Supercomputer Center (http://bioinformatics.osc.edu/sagespy). All RL-SAGE tags from mycelium library are available from the MGOS database (http://www.mgosdb.org/cgibin/sage/advTagSearchResult.cgi?lib_include=MG_SGa).
Biomaterial provider The Ohio State University
Growth protocol Rice blast fungus (Magnaporthe grisea) strain 70-15 (Mitchell et al., 2003) was grown on a minimum medium (0.2% [w/v] yeast extract and 1% [w/v] Suc) for 3 d (28°C at 200 rpm) and mycelium was harvested for RNA isolation.
Extracted molecule polyA RNA
Extraction protocol About 50 ng of mRNA isolated from mycelium tissue was used for RL-SAGE library construction as described by Gowda et al [2004].
 
Description An RL-SAGE library was constructed using the same RNA sample that was used for the construction of the mycelium MPSS library (Table 1). The average insert size of the concatemer in the RL-SAGE clones was approximately 1.1 kb. A total of 245,873 individual tags and 51,925 unique tags were obtained from 7,292 sequence reads.
Data processing The ditags and unique tags were extracted from these sequences using SAGEspy program developed at the Ohio Supercomputer Center (http://bioinformatics.osc.edu/sagespy).
 
Submission date Aug 11, 2006
Last update date Nov 19, 2008
Contact name Mohan B Raghupathy
E-mail(s) mohanbabu_r@yahoo.com, wang.620@osu.edu
Phone 614 292 9280
Fax 614 292 4455
URL http://plantpath.osu.edu/~wang/index.php
Organization name The Ohio State University
Department Department of Plant Pathology
Lab Plant disease resistance and fucntional genomics
Street address 201 Kottman Hall, 2021 Coffey Rd
City Columbus
State/province OH
ZIP/Postal code 43210
Country USA
 
Platform ID GPL4085
Series (1)
GSE5518 Differential gene expression of Appresorium vs Vegetative mycelium of Magnaporthe using oligoarray

Data table header descriptions
TAG Vegetative mycelium
COUNT number of copies
TPM tags per million

Data table
TAG COUNT TPM
CATGGCAGTTGAGGCCAAATT 1 4.22
CATGCTTATCCTGACGGCTTT 1 4.22
CATGACTTTTTTCCAGGGCGT 1 4.22
CATGAAGTTGAGGTATTCTAC 1 4.22
CATGAGTTGTTGAGTTCGATG 1 4.22
CATGAGGAGGCATAGAAAAAA 1 4.22
CATGGCACATTGTAGACTAGG 1 4.22
CATGATGTCCCTGCCTCTAAA 1 4.22
CATGTATGCTCAATCATTTTC 1 4.22
CATGTGCATCCCTCTGTCTAT 1 4.22
CATGGTTTTTTTTTTAGTGTT 1 4.22
CATGCACCATTCGGGGAAACC 1 4.22
CATGACTTTAAACGAAATTTC 1 4.22
CATGAATTTTACAATGGAAAT 1 4.22
CATGAACTTTGGAAATATGCT 1 4.22
CATGGGGTCCGCTCCGGGGGT 1 4.22
CATGACGATGGAAAAAAAAAA 1 4.22
CATGAGGGAGGTCCACCTAAG 1 4.22
CATGCAGCAGTCGGAGAGGCT 1 4.22
CATGTCGAGGTTCGAGTTTGC 1 4.22

Total number of rows: 51925

Table truncated, full table size 1484 Kbytes.




Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap