|
Status |
Public on Feb 17, 2016 |
Title |
HITS-CLIP_IMR-32_noUV_2 |
Sample type |
SRA |
|
|
Source name |
HITS-CLIP_IMR-32_noUV
|
Organism |
Homo sapiens |
Characteristics |
cell line: IMR-32 cell type: neuroblastoma cells treatment: non-stressed degenerate linker: 7nt: begins with GA, ends with G
|
Treatment protocol |
Cells were washed in PBS and for UV treatment exposed to either 0.2 or 0.5 mJ/cm2 UVC; cells were allowed to recover for 24h before being harvested
|
Growth protocol |
Nonstressed and UV-stressed IMR-32 neuroblastoma cells were grown under standard conditions.
|
Extracted molecule |
total RNA |
Extraction protocol |
Nonstressed and stressed cells were UV irradiated and subjected to nELAVL HITS-CLIP (detailed description in accompanying paper) partial RNAse digestion, RNA linker ligation and PCR amplificiation nELAVL bound fragments were ligated to a degenerate 5'linker and a 3'linker
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina MiSeq |
|
|
Description |
noUV_2
|
Data processing |
library strategy: HITS-CLIP filtering: 25nt degenerate linker: min:0-24:20,mean:25-70:20; 7nt degenerate linker: 0-6:20,mean:7-40:20 collapsing of exact sequences stripping of degenerate linker (7 or 25nt; ends with a G) removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG) alignment with novoalign (unambigous mapping) collapsing of PCR duplicates Genome_build: hg18 Supplementary_files_format_and_content: bed file containing genomic coordinates of unique unambigously mapped reads
|
|
|
Submission date |
Dec 29, 2013 |
Last update date |
May 15, 2019 |
Contact name |
Claudia Scheckel |
E-mail(s) |
claudia.scheckel@gmail.com
|
Organization name |
University Hospital Zurich
|
Department |
Institute of Neuropathology
|
Street address |
Schmelzbergstrasse 12
|
City |
Zurich |
State/province |
NY |
ZIP/Postal code |
8091 |
Country |
Switzerland |
|
|
Platform ID |
GPL15520 |
Series (2) |
GSE53696 |
nELAVL HITS-CLIP in IMR-32 neuroblastoma cells |
GSE53699 |
nELAVL HITS-CLIP and RNA-seq in Alzheimer's Disease patients and IMR-32 neuroblastoma cells |
|
Relations |
BioSample |
SAMN02486967 |
SRA |
SRX400206 |