NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1299123 Query DataSets for GSM1299123
Status Public on Feb 17, 2016
Title HITS-CLIP_IMR-32_noUV_3
Sample type SRA
 
Source name HITS-CLIP_IMR-32_noUV
Organism Homo sapiens
Characteristics cell line: IMR-32
cell type: neuroblastoma cells
treatment: non-stressed
degenerate linker: 7nt: begins with AC, ends with G
Treatment protocol Cells were washed in PBS and for UV treatment exposed to either 0.2 or 0.5 mJ/cm2 UVC; cells were allowed to recover for 24h before being harvested
Growth protocol Nonstressed and UV-stressed IMR-32 neuroblastoma cells were grown under standard conditions.
Extracted molecule total RNA
Extraction protocol Nonstressed and stressed cells were UV irradiated and subjected to nELAVL HITS-CLIP (detailed description in accompanying paper)
partial RNAse digestion, RNA linker ligation and PCR amplificiation
nELAVL bound fragments were ligated to a degenerate 5'linker and a 3'linker
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina MiSeq
 
Description noUV_3
Data processing library strategy: HITS-CLIP
filtering: 25nt degenerate linker: min:0-24:20,mean:25-70:20; 7nt degenerate linker: 0-6:20,mean:7-40:20
collapsing of exact sequences
stripping of degenerate linker (7 or 25nt; ends with a G)
removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG)
alignment with novoalign (unambigous mapping)
collapsing of PCR duplicates
Genome_build: hg18
Supplementary_files_format_and_content: bed file containing genomic coordinates of unique unambigously mapped reads
 
Submission date Dec 29, 2013
Last update date May 15, 2019
Contact name Claudia Scheckel
E-mail(s) claudia.scheckel@gmail.com
Organization name University Hospital Zurich
Department Institute of Neuropathology
Street address Schmelzbergstrasse 12
City Zurich
State/province NY
ZIP/Postal code 8091
Country Switzerland
 
Platform ID GPL15520
Series (2)
GSE53696 nELAVL HITS-CLIP in IMR-32 neuroblastoma cells
GSE53699 nELAVL HITS-CLIP and RNA-seq in Alzheimer's Disease patients and IMR-32 neuroblastoma cells
Relations
BioSample SAMN02486975
SRA SRX400207

Supplementary file Size Download File type/resource
GSM1299123_noUV_3_CLIP_bed.txt.gz 3.7 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap