NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1334287 Query DataSets for GSM1334287
Status Public on Nov 20, 2014
Title PAR-CLIP with T1, replicate 1
Sample type SRA
 
Source name cell culture
Organism Homo sapiens
Characteristics strain: FLAG:DICER Flp-In HEK293 T-Rex
cell line: HEK293
Extracted molecule total RNA
Extraction protocol PAR-CLIP (Hafner et al. 2010)
Illumina small RNA
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 2000
 
Description Dicer bound RNA fragments, custom 3'adapter TCTCACGTCGTATGCCGTCTTCTGCTTG
dicer1_4su_1_BC5.qseq.txt.gz 3' adapter TCTCACGTCGTATGCCGTCTTCTGCTTG
dicer1_4su_1_reseq_BC5.qseq.txt.gz 3' adapter TCTCACGTCGTATGCCGTCTTCTGCTTG
dicer1_4su_2_BC6.qseq.txt.gz 3' adapter TCTCCATTCGTATGCCGTCTTCTGCTTG
dicer1_4su_2_reseq_BC6.qseq.txt.gz 3' adapter TCTCCATTCGTATGCCGTCTTCTGCTTG
dicer1_4su_3_BC2.qseq.txt.gz 3' adapter TCTCCCATCGTATGCCGTCTTCTGCTTG
dicer1_4su_3_reseq_BC2.qseq.txt.gz 3' adapter TCTCCCATCGTATGCCGTCTTCTGCTTG
Data processing removal of default Illumina 3'adapter sequence with FLEXBAR (see supplementary methods)
collapsing distinct read-sequences with custom script
alignment with BOWTIE2 2.1.0 to hg19
cluster building and quality filtering to limit false-discovery rate with custom scripts
Genome_build: hg19
Supplementary_files_format_and_content: GFF with genomic regions covered by filtered clusters (binding sites)
 
Submission date Feb 25, 2014
Last update date May 15, 2019
Contact name Marvin Jens
E-mail(s) marvin.jens@mdc-berlin.de
Phone +493094062989
Organization name Max Delbrueck Center for Molecular Medicine
Department Systems Biology of Gene Regulatory Elements
Lab Rajewsky lab
Street address Robert Rössle Str. 10 (H. 87)
City Berlin
ZIP/Postal code 13092
Country Germany
 
Platform ID GPL11154
Series (2)
GSE55324 Transcriptome wide identification of Dicer binding in human and C. elegans reveals a variety of substrates (HEK PAR-CLIP)
GSE55333 Transcriptome wide identification of Dicer binding in human and C. elegans reveals a variety of substrates
Relations
BioSample SAMN02664656
SRA SRX475870

Supplementary file Size Download File type/resource
GSM1334287_dicer1_4su_1.gff.gz 1.2 Mb (ftp)(http) GFF
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap