|
Status |
Public on Nov 20, 2014 |
Title |
PAR-CLIP with T1, replicate 1 |
Sample type |
SRA |
|
|
Source name |
cell culture
|
Organism |
Homo sapiens |
Characteristics |
strain: FLAG:DICER Flp-In HEK293 T-Rex cell line: HEK293
|
Extracted molecule |
total RNA |
Extraction protocol |
PAR-CLIP (Hafner et al. 2010) Illumina small RNA
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
Dicer bound RNA fragments, custom 3'adapter TCTCACGTCGTATGCCGTCTTCTGCTTG dicer1_4su_1_BC5.qseq.txt.gz 3' adapter TCTCACGTCGTATGCCGTCTTCTGCTTG dicer1_4su_1_reseq_BC5.qseq.txt.gz 3' adapter TCTCACGTCGTATGCCGTCTTCTGCTTG dicer1_4su_2_BC6.qseq.txt.gz 3' adapter TCTCCATTCGTATGCCGTCTTCTGCTTG dicer1_4su_2_reseq_BC6.qseq.txt.gz 3' adapter TCTCCATTCGTATGCCGTCTTCTGCTTG dicer1_4su_3_BC2.qseq.txt.gz 3' adapter TCTCCCATCGTATGCCGTCTTCTGCTTG dicer1_4su_3_reseq_BC2.qseq.txt.gz 3' adapter TCTCCCATCGTATGCCGTCTTCTGCTTG
|
Data processing |
removal of default Illumina 3'adapter sequence with FLEXBAR (see supplementary methods) collapsing distinct read-sequences with custom script alignment with BOWTIE2 2.1.0 to hg19 cluster building and quality filtering to limit false-discovery rate with custom scripts Genome_build: hg19 Supplementary_files_format_and_content: GFF with genomic regions covered by filtered clusters (binding sites)
|
|
|
Submission date |
Feb 25, 2014 |
Last update date |
May 15, 2019 |
Contact name |
Marvin Jens |
E-mail(s) |
marvin.jens@mdc-berlin.de
|
Phone |
+493094062989
|
Organization name |
Max Delbrueck Center for Molecular Medicine
|
Department |
Systems Biology of Gene Regulatory Elements
|
Lab |
Rajewsky lab
|
Street address |
Robert Rössle Str. 10 (H. 87)
|
City |
Berlin |
ZIP/Postal code |
13092 |
Country |
Germany |
|
|
Platform ID |
GPL11154 |
Series (2) |
GSE55324 |
Transcriptome wide identification of Dicer binding in human and C. elegans reveals a variety of substrates (HEK PAR-CLIP) |
GSE55333 |
Transcriptome wide identification of Dicer binding in human and C. elegans reveals a variety of substrates |
|
Relations |
BioSample |
SAMN02664656 |
SRA |
SRX475870 |