|
| Status |
Public on Nov 20, 2014 |
| Title |
PAR-CLIP with T1, replicate 3 |
| Sample type |
SRA |
| |
|
| Source name |
cell culture
|
| Organism |
Homo sapiens |
| Characteristics |
strain: FLAG:DICER Flp-In HEK293 T-Rex
cell line: HEK293
|
| Extracted molecule |
total RNA |
| Extraction protocol |
PAR-CLIP (Hafner et al. 2010)
Illumina small RNA
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Dicer bound RNA fragments, custom 3' adapter TCTCCCATCGTATGCCGTCTTCTGCTTG
dicer1_4su_1_BC5.qseq.txt.gz 3' adapter TCTCACGTCGTATGCCGTCTTCTGCTTG
dicer1_4su_1_reseq_BC5.qseq.txt.gz 3' adapter TCTCACGTCGTATGCCGTCTTCTGCTTG
dicer1_4su_2_BC6.qseq.txt.gz 3' adapter TCTCCATTCGTATGCCGTCTTCTGCTTG
dicer1_4su_2_reseq_BC6.qseq.txt.gz 3' adapter TCTCCATTCGTATGCCGTCTTCTGCTTG
dicer1_4su_3_BC2.qseq.txt.gz 3' adapter TCTCCCATCGTATGCCGTCTTCTGCTTG
dicer1_4su_3_reseq_BC2.qseq.txt.gz 3' adapter TCTCCCATCGTATGCCGTCTTCTGCTTG
|
| Data processing |
removal of default Illumina 3'adapter sequence with FLEXBAR (see supplementary methods)
collapsing distinct read-sequences with custom script
alignment with BOWTIE2 2.1.0 to hg19
cluster building and quality filtering to limit false-discovery rate with custom scripts
Genome_build: hg19
Supplementary_files_format_and_content: GFF with genomic regions covered by filtered clusters (binding sites)
|
| |
|
| Submission date |
Feb 25, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Marvin Jens |
| E-mail(s) |
marvin.jens@mdc-berlin.de
|
| Phone |
+493094062989
|
| Organization name |
Max Delbrueck Center for Molecular Medicine
|
| Department |
Systems Biology of Gene Regulatory Elements
|
| Lab |
Rajewsky lab
|
| Street address |
Robert Rössle Str. 10 (H. 87)
|
| City |
Berlin |
| ZIP/Postal code |
13092 |
| Country |
Germany |
| |
|
| Platform ID |
GPL11154 |
| Series (2) |
| GSE55324 |
Transcriptome wide identification of Dicer binding in human and C. elegans reveals a variety of substrates (HEK PAR-CLIP) |
| GSE55333 |
Transcriptome wide identification of Dicer binding in human and C. elegans reveals a variety of substrates |
|
| Relations |
| BioSample |
SAMN02664654 |
| SRA |
SRX475872 |
