GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1412842

Query DataSets for GSM1412842

Status

Public on Apr 20, 2015

Title

WT-1_D4(RA)

Sample type

SRA

Source name

46C mES cells (RA, Day4)

Organism

Mus musculus

Characteristics

cell line: 46C
cell type: embryonic stem cells
genotype/variation: WT
treatment: LIF withdrawal, 2uM RA-induced differentiation
time: day4
strain: 129/Ola

Growth protocol

ESCs were cultured in N2B27 complete "2i" medium including: 100 ml DMEM/F12 basal medium (Life Technologies), 100 ml Neurobasal medium (Life Technologies), 1 ml N2 supplement (Life Technologies), 2 ml B27 supplement (Life Technologies), 1 ml 100 × Glutamax (Life Technologies) and 0.1 mM 2-mercaptoethanol, 1000U/ml recombinant leukemia inhibitory factor (LIF, millipore) and "2i" (1 uM PD03259010, 3 uM CHIR99021) for one day. The cells were then passaged with N2B27 medium without LIF or "2i", and supplemented with 2 uM retinoic acid (RA), change medium everyday. Cells were harvested at day 4 of RA-induced differentiation

Extracted molecule

total RNA

Extraction protocol

Cells were harvested at day 4 of RA-induced differentiation. TRIzol reagent was added directly into the plate after cold 1 × PBS wash once. The total RNA was extracted according to manufacturer's instructions. mRNA was further isolated by Dynabeads mRNA purification kit (Life Technologies) according to manufacturer's instructions.
The library was constructed by library preparation modules (New England Biolabs) according to manufacturer's instructions. Briefly, mRNA was fragmentated by NEBNext Magnesium RNA Fragmentation Module at 94 ℃ for 5 min. The fragementated RNA was reverse transcribed by SuperScript III First-Strand Synthesis System for RT-PCR kit (Life Technology), 2'nd strand was then synthesized by NEBNext mRNA Second Strand Synthesis Module , the end repair, dA-tailing and adaptor ligation were also following the instruments by respect module. the adaptor for the libary was sythersized from IDT with the first 7nt is "AGCTCAT" as a barcode. After liagation, the DNA was amplified by primer 1.0 (AATGATACGGCGACCACCGAGATCTACAC, synthersized from IDT) and 2.0 (CAAGCAGAAGACGGCATACGAGAT, synthersized from IDT) for 15 cycles. After this, the product was further purified and size selected by Ampure XP beads (Beckman Coulter). The library was sequenced on the Illumina instrument following the manufacturer's protocols.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 1500

Description

Sample 17
messenger RNA
processed data file: mRNA profiling_Haunt 58 kb KO_RA differentiation.txt
barcode: AGCTCAT
Sample 17

Data processing

The sequencing company provided "clean reads" (i.e., low quality reads removed).
Basecalls performed using CASAVA version
ChIRP retrived DNA-Seq reads were aligned to the mm9 genome assembly using Bowtie version 1.0.0 with the default parameters
RNA-seq reads were aligned to the mm9 genome assembly using Tophat v2.0.11,allowing for uniquely mapped reads and mapping both spliced and unspliced reads.
FPKM was calculated by Cufflink 2.1.1
Peaks of each sample were called using MACS v. 1.4.2
Genome_build: mm9
Supplementary_files_format_and_content: RNA-seq: tab-delimited text files include FPKM values for wild-type or Haunt KO Samples; ChIRP-seq: bedgraph files were generated using MACS v. 1.4.2, including peaks called by default parameters.

Submission date

Jun 16, 2014

Last update date

May 15, 2019

Contact name

jinlong lu

E-mail(s)

bioyuyang@hotmail.com

Phone

5853098469

Organization name

University of Rochester