|
| Status |
Public on Nov 20, 2014 |
| Title |
DROSHA KD siRNA1 |
| Sample type |
SRA |
| |
|
| Source name |
cell culture
|
| Organism |
Homo sapiens |
| Characteristics |
strain: Flp-In HEK293 T-Rex
cell line: HEK293
knockdown: DROSHA siRNA
|
| Extracted molecule |
total RNA |
| Extraction protocol |
NP40 lysis buffer, FLAG magnetic beads, proteinase K, phenol chloroform
Illumina small RNA (truseq)
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
adapter=TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTA
|
| Data processing |
demultiplexing by CASAVA, and removal of custom 3'adapter sequence with FLEXBAR
collapsing distinct read-sequences with custom script
alignment with BOWTIE2 2.1.0 to hg19
coverage track building and read counting with custom scripts
Genome_build: hg19
Supplementary_files_format_and_content: coverage wig files
|
| |
|
| Submission date |
Nov 19, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Marvin Jens |
| E-mail(s) |
marvin.jens@mdc-berlin.de
|
| Phone |
+493094062989
|
| Organization name |
Max Delbrueck Center for Molecular Medicine
|
| Department |
Systems Biology of Gene Regulatory Elements
|
| Lab |
Rajewsky lab
|
| Street address |
Robert Rössle Str. 10 (H. 87)
|
| City |
Berlin |
| ZIP/Postal code |
13092 |
| Country |
Germany |
| |
|
| Platform ID |
GPL11154 |
| Series (2) |
| GSE55333 |
Transcriptome wide identification of Dicer binding in human and C. elegans reveals a variety of substrates |
| GSE63458 |
A variety of Dicer substrates in human and C. elegans (HEK small RNA) |
|
| Relations |
| BioSample |
SAMN03201298 |
| SRA |
SRX763664 |
