|
| Status |
Public on May 20, 2015 |
| Title |
mouse ES cells, sample 2, tech Rep 1 (2.5k cells) |
| Sample type |
SRA |
| |
|
| Source name |
mouse 129/Ola strain called IB10 (subcloned from E14)
|
| Organism |
Mus musculus |
| Characteristics |
cell type: embryonic stem cell (ES)
days post-lif: 0
number cells in sample: 2509
|
| Treatment protocol |
In the undifferentiated state the ESC base media was supplemented with Leukemia Inhibitory Factor (LIF) at final concentration 1000 U/mL and for unguided mES differentiation the media was without LIF. Within 2 days of LIF withdrawal the culture experienced significant morphological changes indicating the differentiation of mES cells.
|
| Growth protocol |
The ES cells were maintained in ESC base media inside culture flasks pre-coated with gelatin at 37°C in 5% CO2 and 60-80% humidity at density ~3 × 10^5 cells ml–1. The ESC media contained phenol red free DMEM (Gibco), supplemented with 15% (v/v) fetal bovine serum (Gibco), 2 mM L-glutamine, 1x MEM non-essential amino acids (Gibco), 1% (v/v) penicillin-streptomycin antibiotics, 110 µM b-mercaptoethanol, 100 µM sodium pyruvate.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Cells were encapsulated into droplets on ice and lysed in the 4nL microfluidic droplets using a final concentration of 0.4% NP-40. Single cell lysates were subject to reverse transcription at 50°C without purification of RNA.
Cells were barcoded using the db-Seq platform, which makes use of the CEL-Seq protocol for library construction (Hashimshony et al., Cell Reports 2011).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
mouse ES cells biological replicate (different passage) - technical replicate 1
|
| Data processing |
Reads were first filtered based on presence in read 1 of two sample barcode components separated by the W1 adaptor sequence (GAGTGATTGCTTGTGACGCCTT)
Read 2 was then trimmed using Trimomatic (5) (version 0.30; parameters: LEADING:28 SLIDINGWINDOW:4:20 MINLEN:19).
Barcodes for each read were matched against a list of the 3842 pre-determined barcodes, and errors of up to two nucleotides mismatch were corrected. Reads with a barcode separated by more than two nucleotides from the reference list were discarded. The reads were then split into barcode-specific files for mapping and UMI filtering.
The trimmed reads were aligned using Bowtie (version 0.12.0, parameters: -n 1 -l 15 -e 300 -m 200 -best -strata -a) to the mouse transcriptome. The reference transcriptome was built using all annotated transcripts (extended with a 125bp poly-A tail) from the UCSC mm10 genome assembly.
We used a custom Python and PySAM script to process mapped reads into counts of UMI-filtered transcripts per gene.
Genome_build: mm10 for ES cells; hg19 for K562 cells.
Supplementary_files_format_and_content: Columns = cells; rows = genes. Column 1 contains gene symbols. Values show unique molecular identifier (UMI)-filtered counts per cell detected in the raw data. No normalization is performed.
|
| |
|
| Submission date |
Feb 02, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Allon M Klein |
| Organization name |
Harvard Medical School
|
| Department |
Systems Biology
|
| Street address |
200 Longwood Avenue
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE65525 |
Droplet barcoding for single cell transcriptomics applied to embryonic stem cells |
|
| Relations |
| BioSample |
SAMN03324855 |
| SRA |
SRX863252 |
