GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1909752

Query DataSets for GSM1909752

Status

Public on Dec 02, 2015

Title

Control_2

Sample type

SRA

Source name

primordial germ cells

Organism

Mus musculus

Characteristics

strain: C57BL/6
developmental stages: E11.5
tissue: primordial germ cells
genotype: Prdm1(flox/flox); Rosa26(neo-EYFP/+)

Treatment protocol

To induce Cre-loxP recombination , pregnant female mice with floxed Prdm1 allele were injected intraperitoneally with 3 mg 4-OHT per 25g body weight at 10.5 dpc.
sample collection protocol: The pregnant females were sacrificed at designated stages, the embryos were isolated, and the gonads were isolated. The gonads were dissociated into single cells by incubating with 0.05% Trypsin-EDTA in PBS at 37℃ for 10 min and to remove the cell clamps and tissue debris, the cell suspensions were filtered through a cell strainer (Falcon; 08-771-23). The EYFP-positive cells were sorted and collected by fluorescence activated cell sorting (FACS) (Becton Dickinson; FACS ARIA III). The cells were labeled with Alexa Fluor 647-conjugated anti-SSEA-1 antibody (eBioscience; 51-8813), washed with PBS, suspended in 0.1% BSA-PBS, and sorted by FACS.

Growth protocol

The Prdm1(flox/flox); Rosa26(neo-EYFP/neo-EYFP) females were mated with the Dppa3-MCMP(TG/0); Prdm1(flox/flox) males to obtain Prdm1 CKO PGCs and control of them.
The wild type female mice were mated with the Dppa3-EGFP mice to obtain wild type PGCs.

Extracted molecule

total RNA

Extraction protocol

Total RNAs from collected primordial germ cell were extracted with RNeasy Micro Kit (QIAGEN, 74004) according to the manufacture's instruction.
cDNA synthesis and amplification from isolated RNAs/single cells were perfomed essentially as reported in [Kurimoto, K.et.al., Nucleic Acids Research, 34(5), e42.] The numbers of PCR cycles were employed for 11 cycles. 5 ng of amplified and quality-checked cDNAs were added to the pre-amplification buffer [1 × ExTaq buffer [Takara Bio (RR006), Shiga, Japan], 0.2 μM of each dNTP [Takara Bio (RR006)], 0.01 μg/μl of the N-V3 (dT)24 primer (HPLC-purified, attachment of amine at the 5-prime end), 0.01 μg/μl of the V1(dT)24 primer (HPLC-purified), and 0.025 U/μl of ExTaqHS [Takara Bio (RR006)]], and were amplified by four cycles of PCR. The surplus primers and PCR byproducts such as primer dimers were removed by size selection through three rounds of purification using a 0.6 × volume of AMPureXP beads for each round [Beckman Coulter (A63881), Tokyo, Japan] according to the manufacturer’s instructions. The purified cDNAs were diluted to 130 μl by double-distilled water (DDW) and fragmented by shearing with Covaris S2 or E210 (duty cycle: 10%; intensity: 5; cycles per burst: 200; duration: 50 seconds; an intensifier was installed in the case of E210) [Covaris, Woburn, MA], and then end-polished in the End-polish buffer [1 × NEBnext End Repair Reaction buffer [NEB (B6052S), Ipswich, MA], 0.01 U/μl of T4 DNA polymerase [NEB (M0203)], and 0.033 U/μl of T4 polynucleotide kinase [NEB (M0201)]] for 30 min at 20oC. After incubation, a 0.8 × volume of the AMPureXP was immediately added, the solution was mixed for more than 20 min, and then the supernatant was transferred to a 1.2 × volume of the AMPureXP reagent and the cDNAs were purified. Next, to provide the purified cDNAs with an Int-adaptor sequence, the cDNAs were incubated in 30 μl of the Internal adaptor extension buffer [1 × ExTaq Buffer, 0.23 mM of each dNTP, 0.67 μM of the IntV1 (dT)24 primer (HPLC-purified), 0.033 U/μl of ExTaqHS] using the following thermal cycler program: 95℃ for 3 min, 67℃ for 2 min, and 72℃ for 2 min. The reactions were terminated by chilling in an ice-block, and after the addition of 20 μl of the P1-adaptor ligation buffer [a mixture of 10 μl of 5 × NEBNext Quick Ligation Reaction Buffer [NEB (B6058S)], 0.6 μl of 5 μM of the P1-T adaptor [Life Technologies (4464411)], and 1 μl of T4 ligase [NEB (M0202M)]], the solution was incubated for 15 min at 20℃ and for 20 min at 72℃. After two rounds of cDNA purification by adding a 1.2 × volume of AMPure XP, the cDNAs were added into the Final amplification buffer [1 × ExTaq buffer, 0.2 mM of each dNTP, 1 μM of the P1 primer, 1 μM of the BarT0XX_IntV1 primer (HPLC-purified), 0.025 U/μl of ExTaqHS] and amplified by PCR using the following thermal cycler program: 95oC for 3 min; followed by 9 cycles of 95℃ for 30 sec, 67℃ for 1 min and 72℃ for 1 min; with a final extension of 72℃ for 3 min. Finally, the cDNA libraries were purified two times by using a 1.2 × volume of AMPureXP and dissolved in 20 μl of TE buffer. The quality and quantity of the constructed libraries were evaluated by LabChip GX or Bioanalyzer 2100, a Qubit dsDNA HS assay kit [Life Technologies (Q32851)], and a SOLiD Library TaqMan Quantitation kit [Life Technologies (4449639)]. The cDNA libraries were sequenced with an ABI SOLiD 5500XL system (Applied Biosystems) for 50-bp single-end reads according to the instructions of the manufacturer.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

AB 5500xl Genetic Analyzer

Description

3'-RNAseq amplified from bulk RNA
expression_Blimp1Tg.txt

Data processing

All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options "-c -m 30 -a CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -g CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -a AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA". The trimmed reads with less than 30 bp were discarded.
Untrimmed and trimmed reads of 30 bp or longer were mapped onto the mouse genome mm10 and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the “—no-coverage-search” option.
Mapped reads on the genome were converted into the expression levels by cufflinks-2.2.0 using the “—compatible-hits-norm”, “—no-length-correction” and “—library-type fr-secondstrand” options and mm10 reference gene annotations with extended TTSs. We also set the cufflinks option “—max-mle-iterations” to 50,000, because default iterations (5,000) resulted in “FAILED” when estimating the expression levels of some genes. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.
Genome_build: mm10

Submission date

Oct 16, 2015

Last update date

May 15, 2019

Contact name

Yukihiro Yabuta

E-mail(s)

yabyab@anat2.med.kyoto-u.ac.jp

Organization name

Kyoto University, Graduate school of medicine

Department

Anatomy and Cell Biology