|
| Status |
Public on Jun 10, 2008 |
| Title |
MDCK LIB 1st Inf Sel |
| Sample type |
RNA |
| |
|
| Source name |
MDCK cells transduced with mouse testis retroviral library (1st Infection) and selected by growth on polyhema
|
| Organism |
Canis lupus familiaris |
| Characteristics |
Madin-Darby Canine Kidney (MDCK) cells
oligo pFB retrotranscription
|
| Growth protocol |
Standard culture conditions
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA extraction was performed using Trizol plus RNA purification kit (Invitrogen). RNA qualitative and quantitative assessment was performed using the Bioanalyzer 2100 (Agilent Tecnologies).
|
| Label |
biotin
|
| Label protocol |
RNA was extracted using the TRIzol reagent (Invitrogen), according to the manufacturer’s protocoll, and then further purified using the RNeasy Mini kit from Qiagen.. The quantification and quality analysis of RNA was performed on a Bioanalyzer 2100 (Agilent). Synthesis of cDNA and biotinylated cRNA was performed using the Illumina TotalPrep RNA Amplification Kit (Ambion Cat. n. IL1791), according to the manufacturer’s protocol, with the following variations to optimize xenoarray analysis: (i) standard cDNA synthesis with the T7-dT(24) primer: 1 µg of total RNA was used, with the doubling of the reaction volume and of all reagents; (ii) library-specific cDNA synthesis: 20 µg of total RNA were used with 4 pm of a pFB-specific primer (T7-pFB, sequence: GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCGAACCCCAGAGTCCCGCTCA, HPLC-purified from Sigma) with standard reaction conditions. The T7-pFB primer contains the T7 promoter (for cRNA synthesis) followed by a vector-specific sequence, which is present in the 3’ region of all transcripts derived from the library. Quality assessment and quantification of cRNAs were performed on Bioanalyzer 2100.
|
| |
|
| Hybridization protocol |
Hybridization of MDCK-derived cRNAs was carried out on Illumina Mouse-6_V1 arrays (Cat. N. BD-26-101), using 1.5 µg of T7-pFB-derived cRNA. These arrays contain all the RefSeq probes present in the Mouse_Ref_8_V1 arrays, plus additional 24k probes exploring less characterized transcripts, additional Unigene clusters and singletones, to allow a more complete coverage of the transcriptome. Array washing was performed using Illumina High-stringency wash buffer for 30 min at 55°C, and followed by staining and scanning with Illumina Bead Array Reader.
|
| Scan protocol |
The hybridized BeadChips were scanned by Illumina BeadScan confocal scanner and analyzed by Illumina's BeadStudio version 1.5.1.3
|
| Description |
MDCK cells transduced with mouse testis retroviral library (1st Infection) and selected by growth on polyhema
|
| Data processing |
Illumina Bead Studio 1.5.1.3 was used to summarize BeadChip Signals; data were not normalized. Further analysis were performed on custom XAS, Xenoarray Analysis Studio (www.sourceforge.net/projects/xas)
|
| |
|
| Submission date |
Jun 09, 2008 |
| Last update date |
Jun 09, 2008 |
| Contact name |
Enzo Medico |
| E-mail(s) |
enzo.medico@ircc.it
|
| Phone |
+39-011-9933234
|
| Organization name |
Candiolo Cancer Institute, University of Torino
|
| Department |
Oncology
|
| Lab |
Laboratory of Oncogenomics
|
| Street address |
Strada Prov. 142, km 3,95
|
| City |
Candiolo |
| State/province |
TO |
| ZIP/Postal code |
10060 |
| Country |
Italy |
| |
|
| Platform ID |
GPL6333 |
| Series (1) |
| GSE11721 |
Exploiting orthologue diversity for systematic detection of gain-of-function phenotypes |
|
