|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jul 01, 2018 |
Title |
RealSeq_Universal miRNA Reference Kit_1 ug |
Sample type |
SRA |
|
|
Source name |
Agilent (750700)
|
Organism |
Homo sapiens |
Characteristics |
amount: 1 ug
|
Extracted molecule |
total RNA |
Extraction protocol |
Libraries were prepared for 1 ug of Universal miRNA Reference Kit (Agilent) with the following protocols: TruSeq Small RNA, NEXTFlex Small RNA, QIASeq miRNA, and RealSeq-AC
|
|
|
Library strategy |
miRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
NextSeq 550 |
|
|
Description |
Processed data file: Raw_counts_Universal_miRNA.csv
|
Data processing |
Basecalling performed by Illumina RTA 1.18.54 Reads demultiplexed by NextSeq instrument Reads trimmed of adapter with cutadapt with the following specifications: For TruSeq and RealSeq libraries: cutadapt -a TGGAATTCTCGGGTGCCAAGG -m 15; For NEXTFlex libraries: cutadapt -u 4 -a NNNNTGGAATTCTCGGGTGCCAAGG -m 15; For QIASeq libraries: cutadapt -a AACTGTAGGCACCATCAAT -m 15 Trimmed reads were subsampled at random to 13 million reads per library Subsampled reads were mapped to index with the complete YM500v3 database (PMID:27899625); by using bowtie2 with the following parameters: bowtie2 -L8 --local Raw counts of reads were obtained from sam files, by using samtools and picard-tools Supplementary_files_format_and_content: raw counts for all small RNAs on YM500v3 database
|
|
|
Submission date |
May 15, 2018 |
Last update date |
Jul 01, 2018 |
Contact name |
Sergio Barberan-Soler |
E-mail(s) |
sbarberan@somagenics.com
|
Phone |
8314267700
|
Organization name |
Somagenics Inc
|
Street address |
2161 Delaware Avenue
|
City |
Santa Cruz |
State/province |
CA |
ZIP/Postal code |
95060 |
Country |
USA |
|
|
Platform ID |
GPL21697 |
Series (1) |
GSE107304 |
Increasing miRNA sequencing accuracy using an RNA circularization approach |
|
Relations |
BioSample |
SAMN09211360 |
SRA |
SRX4085781 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|