|
| Status |
Public on Oct 01, 2008 |
| Title |
RKO_HSF1siRNA_6hHNE_REP1 |
| Sample type |
RNA |
| |
|
| Source name |
RKO cells transfected with HSF1 Stealth siRNA treated 6 h with 50 uM HNE in DMSO 0.5% final
|
| Organism |
Homo sapiens |
| Characteristics |
RKO colon carcinoma cells (ATCC #CRL-2577), cultured in DMEM (Invitrogen Catalog#10569) containing 10% FBS (Atlas Biologicals)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells from 10 cm plates were scraped and pelleted by centrifugation, followed by resuspension in 1 ml Trizol, incubation for 5 in at room temp, and addition of 200 ul CHCl3 with vigorous shaking by hand. After centrifugation 10 min 14,000 rpm, aqueous phase combined with equal volume of 70% EtOH, and subsequent cleanup on Qiagen RNeasy kit (Catalog# 74104)
|
| Label |
Biotin
|
| Label protocol |
First Strand and Second Strand synthesis, followed by 2 rounds of SPIA amplification to generate cDNA was performed using WT-Ovation™ FFPE System V2 (Nugen Catalog#3400-60, Lot#801142-A). Fragmentaion and Biotinylation were completed using FL-Ovation™ cDNA Biotin Module V2 (Nugen Catalog# 4200, lot#709151-F)
|
| |
|
| Hybridization protocol |
Hybridization performed according to standard Affymetrix protocols
|
| Scan protocol |
Scanned on Affymetrix GeneChip Scanner 3000 7G
|
| Description |
Cells transfected with Stealth HSF1 siRNA (5'CGGAUUCAGGGAAGCAGCUGGUGCA) and subsequently treated for 6 hours with 50 uM HNE in vehicle 0.5% DMSO, in DMEM Media containing 10% FBS
|
| Data processing |
Data processed using Affymetrix Expression Console software using default RMA parameters, log2 scale
|
| |
|
| Submission date |
Sep 12, 2008 |
| Last update date |
Sep 12, 2008 |
| Contact name |
Aaron Thomas Jacobs |
| Organization name |
Vanderbilt University
|
| Department |
Biochemistry
|
| Lab |
Lawrence J. Marnett
|
| Street address |
23rd Ave. @ Pierce Ave.
|
| City |
Nashville |
| State/province |
TN |
| ZIP/Postal code |
37232 |
| Country |
USA |
| |
|
| Platform ID |
GPL6244 |
| Series (1) |
| GSE12762 |
Effect of 4-Hydroxynonenal on gene expression. Comparison of HSF1-siRNA silenced vs control cells |
|
