NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4009034 Query DataSets for GSM4009034
Status Public on Aug 07, 2019
Title wildtype - degradome
Sample type SRA
 
Source name whole animal
Organism Hydra vulgaris
Characteristics tissue: whole animal
strain: AEP
genotype/variation: wild type
Treatment protocol RNA was extracted from 20 WT Hydra vulgaris AEP
Growth protocol Hydra were cultured according to standard protocol (Lenhoff, 1983) at 18˚C.
Extracted molecule polyA RNA
Extraction protocol Trizol (Invitrogen)
NEXTflex Small RNA-Seq Kit v3 (PerkinElmer Cat# NOVA-5132-05).Starting with 2 ν ΅νΌ‡g of total RNA, poly(A) enrichment was performed to capture mRNAs, which was followed by 5’ adapter ligation. Ligation of the 5’ adaptor was done without first removing the 5’ m7G cap so that only cleaved mRNAs were available for ligation. The RNA was then chemically fragmented and 3’ adapters were ligated. For ligations, 25% of the standard adapter mass was used.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 4000
 
Data processing 2 rounds of trimming were performed using cutadapt: 1) cutadapt -a TGGAATTCTCGGGTGCCAAGG --minimum-length 28 2) cutadapt -u 4 -u -4 . Reads were mapped the Hydra vulgaris AEP transcriptome using rsem/1.2.31. piRNAs mapping in an antisense orientation were allowed up to three mismatches using the following parameters: "--forward-prob 0 --bowtie-n 3”. Degradome reads were mapped without any allowed mismatches using the following parameters: β€œ--forward-prob 1 --bowtie-n 0”.
tab-delimited text file of isoform level raw expression estimates - Degradome_Counts_Matrix.txt
Genome_build: Hydra vulgaris AEP transcriptome (aepLRv2) (Transcriptome Shotgun Assembly project: GHHG01000000)
 
Submission date Aug 06, 2019
Last update date Aug 07, 2019
Contact name Celina E Juliano
E-mail(s) cejuliano@ucdavis.edu
Organization name University of California Davis
Department MCB
Lab Julianolab
Street address 149 Briggs Hall
City Davis
State/province California
ZIP/Postal code 95616
Country USA
 
Platform ID GPL25712
Series (1)
GSE135440 PIWI-piRNA pathway mediated transposon repression in Hydra somatic stem cells
Relations
BioSample SAMN12501496
SRA SRX6658759

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap