|
| Status |
Public on Aug 07, 2019 |
| Title |
wildtype - Hywi IP |
| Sample type |
SRA |
| |
|
| Source name |
whole animal
|
| Organism |
Hydra vulgaris |
| Characteristics |
tissue: whole animal
strain: AEP
genotype/variation: wild type
|
| Treatment protocol |
Immunoprecipitation (IP) of piRNAs from whole animals was performed using 225 Hydra vulgaris AEP.
|
| Growth protocol |
Hydra were cultured according to standard protocol (Lenhoff, 1983) at 18˚C.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Trizol (Invitrogen)
NEXTflex Small RNA-Seq Kit v3 (PerkinElmer Cat# NOVA-5132-05),The manufacturer’s protocol was followed, with modifications to 3’ and 5’ adapter ligations: 3’ adapter ligation was performed at 16°C overnight and 5’ adapter ligation was performed at 20°C for two hours. Following adapter ligation, libraries were amplified for 18 cycles and were selected for a size of 108-180 base pairs using BluePippin (Sage Science).
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
piRNA
|
| Data processing |
2 rounds of trimming were performed using cutadapt: 1) cutadapt -a TGGAATTCTCGGGTGCCAAGG --minimum-length 28 2) cutadapt -u 4 -u -4 . Reads were mapped the Hydra vulgaris AEP transcriptome using rsem/1.2.31. piRNAs mapping in an antisense orientation were allowed up to three mismatches using the following parameters: "--forward-prob 0 --bowtie-n 3”. piRNAs mapping in a sense orientation were not allowed any mismatches using the following parameters: “--forward-prob 1 --bowtie-n 0”.
tab-delimited text file of isoform level raw expression estimates - piRNA_Counts_Matrix.txt
Genome_build: Hydra vulgaris AEP transcriptome (aepLRv2) (Transcriptome Shotgun Assembly project: GHHG01000000)
|
| |
|
| Submission date |
Aug 06, 2019 |
| Last update date |
Aug 07, 2019 |
| Contact name |
Celina E Juliano |
| E-mail(s) |
cejuliano@ucdavis.edu
|
| Organization name |
University of California Davis
|
| Department |
MCB
|
| Lab |
Julianolab
|
| Street address |
149 Briggs Hall
|
| City |
Davis |
| State/province |
California |
| ZIP/Postal code |
95616 |
| Country |
USA |
| |
|
| Platform ID |
GPL25712 |
| Series (1) |
| GSE135440 |
PIWI-piRNA pathway mediated transposon repression in Hydra somatic stem cells |
|
| Relations |
| BioSample |
SAMN12501494 |
| SRA |
SRX6658761 |
