GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Sample GSM4009038 Query DataSets for GSM4009038
Status Public on Aug 07, 2019
Title colchicine - Hyli IP
Sample type SRA
Source name whole animal - interstitial cell depleted
Organism Hydra vulgaris
Characteristics tissue: whole animal - interstitial cell depleted
strain: AEP
genotype/variation: cnnos1::GFP transgenic line (Hermmrich et al. 2012)
Treatment protocol Immunoprecipitation (IP) of piRNAs from whole animals was performed using 225 epithelialized Hydra that were treated with colchicine.
Growth protocol Hydra were cultured according to standard protocol (Lenhoff, 1983) at 18˚C.
Extracted molecule polyA RNA
Extraction protocol Trizol (Invitrogen)
NEXTflex Small RNA-Seq Kit v3 (PerkinElmer Cat# NOVA-5132-05),The manufacturer’s protocol was followed, with modifications to 3’ and 5’ adapter ligations: 3’ adapter ligation was performed at 16°C overnight and 5’ adapter ligation was performed at 20°C for two hours. Following adapter ligation, libraries were amplified for 18 cycles and were selected for a size of 108-180 base pairs using BluePippin (Sage Science).
Library strategy ncRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 4000
Description piRNA
Data processing 2 rounds of trimming were performed using cutadapt: 1) cutadapt -a TGGAATTCTCGGGTGCCAAGG --minimum-length 28 2) cutadapt -u 4 -u -4 . Reads were mapped the Hydra vulgaris AEP transcriptome using rsem/1.2.31. piRNAs mapping in an antisense orientation were allowed up to three mismatches using the following parameters: "--forward-prob 0 --bowtie-n 3”. piRNAs mapping in a sense orientation were not allowed any mismatches using the following parameters: “--forward-prob 1 --bowtie-n 0”.
tab-delimited text file of isoform level raw expression estimates - piRNA_Counts_Matrix.txt
Genome_build: Hydra vulgaris AEP transcriptome (aepLRv2) (Transcriptome Shotgun Assembly project: GHHG01000000)
Submission date Aug 06, 2019
Last update date Aug 07, 2019
Contact name Celina E Juliano
Organization name University of California Davis
Department MCB
Lab Julianolab
Street address 149 Briggs Hall
City Davis
State/province California
ZIP/Postal code 95616
Country USA
Platform ID GPL25712
Series (1)
GSE135440 PIWI-piRNA pathway mediated transposon repression in Hydra somatic stem cells
BioSample SAMN12501492
SRA SRX6658763

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap