Cells were cultured in RPMI-1640 supplemented with 10% FBS, 10 µg/ml insulin, 1x non-essential amino acids and 1 mM sodium pyruvate.
Extracted molecule
total RNA
Extraction protocol
Total RNA was extracted using TRIzol and fractionated on a 15% acrylamide, 8M urea gel. Small RNAs 18-35 nt were isolated and ligated sequentially to 5' and 3' adapters as supplied in the sample preparation kit (Illumina). Reverse transcription and PCR amplification were performed according to the manufacturer's instructions.
Library strategy
RNA-Seq
Library source
transcriptomic
Library selection
size fractionation
Instrument model
Illumina Genome Analyzer
Description
MCF7_smallRNAseq
Data processing
Reads were filtered using Illumina Pipeline 1.0 default purity filter (chastity >= 0.6). The 3' adaptor, TCGTATGCCGTCTTCTGCTTG, was removed from the raw reads using ungapped alignment taking base quality into account. The number of reads was then counted for each unique sequence.
