|
| Status |
Public on Dec 15, 2009 |
| Title |
sRNA_activation_deep_sequencing |
| Sample type |
SRA |
| |
|
| Source name |
activation
|
| Organism |
Mus musculus |
| Characteristics |
tissue: uterus
|
| Treatment protocol |
Female mice were mated with fertile males of the same strain to induce pregnancy (day 1 is the day of vaginal plug). To induce delayed implantation, pregnant mice were ovariectomized under ether anesthesia at 08:30-09:00 h on day 4 of pregnancy. Delayed implantation was maintained from days 5-7 by injecting progesterone (1 mg/mouse, Sigma). Estradiol-17 (25 ng/mouse, Sigma) was given to progesterone-primed delayed implantation mice to initiate implantation on day 7 of pregnancy. The mice were sacrificed to collect uteri 24 h after estrogen treatment for activation group. Delayed implantation was confirmed by flushing the blastocysts from one horn of the uterus. The implantation sites of activated uterus were identified through intravenous injection of 0.1 ml of 1% Chicago blue.
|
| Growth protocol |
Mature mice (Kunming White outbred strain) were maintained in a controlled environment with a 14-h light/10-h dark cycle. All animal procedures were approved by the Institutional Animal Care and Use Committee of Xiamen University.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNAs of delayed and activated uterus were extracted by TRIzol (Invitrogen), followed by a 15% Tris-borate-EDTA (TBE) urea gel electrophoresis. Small RNAs were separated by the size of 18-30 bases from the gel. After purification, small RNAs were ligated to a 5’ RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’). Followed by another TBE gel purification and ligated to a 3’ RNA adapter (5’- pUCGUAUGCCGUCUUCUGCUUGidT -3’), the purified small RNAs were reverse transcribed using Illumina’s small RNA RT-Primer (5’-CAAGCAGAAGACGGCATACGA-3’) and amplified by a 15 cycle PCR using Illumina’s small RNA primer set (5’-CAAGCAGAAGACGGCATACGA-3’ and 5’-AATGATACGGCGACCACCGA-3’). PCR products were purified and quantified for Illumina sequencing in Shenzhen Huada Gene Sci-Tech Company (Shenzhen, China).
18-30nt small RNA by gel
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
small RNA deep sequencing of activation
small RNA(18-36nt)
|
| Data processing |
processed data build: mm9, the 3’ end of the read was determined by the 3’ most perfect match to the first 8 nt of the 3’ adaptor.
|
| |
|
| Submission date |
Dec 15, 2009 |
| Last update date |
May 15, 2019 |
| Contact name |
Zeng-Ming Yang |
| E-mail(s) |
zmyang@stu.edu.cn
|
| Phone |
0754-82902011
|
| Organization name |
Shantou University
|
| Department |
Biology
|
| Lab |
Reproductive Biology
|
| Street address |
263 Daxue Road
|
| City |
Shantou |
| ZIP/Postal code |
515063 |
| Country |
China |
| |
|
| Platform ID |
GPL9250 |
| Series (1) |
| GSE19473 |
The integrative analysis of microRNA and mRNA expression in mouse uterus under delayed implantation and activation |
|
| Relations |
| SRA |
SRX015122 |
| BioSample |
SAMN00007206 |
