|
| Status |
Public on May 06, 2010 |
| Title |
E18.5 wild type LIVER small RNA |
| Sample type |
SRA |
| |
|
| Source name |
fetal liver
|
| Organism |
Mus musculus |
| Characteristics |
tissue: liver
developmental stage: E18.5
genotype/variation: wild type
strain: B6/129
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated from fetal livers with Trizol, then separated PAGE to obtain a small RNA fraction ranging from 19 to 30 nt. Adapters for Solexa sequencing were ligated, then the ligated product amplified by RT-PCR. The PCR product is gel-purified for sequencing
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
19-30nt
|
| Data processing |
The 3' linker (CTGTAGGCACCATCAATCGTATGCCGTCTTCTGCTTG) was clipped from the sequences, which are then collapsed and mapped perfectly to the mouse genome. Annotation tracks (RefSeq genes, miRBase miRNAs and RepeatMasker) were used to assign annotations to mapped sequences.
All of the processed data for both Samples are available in a single 'combined_annotations.txt' file on the Series record.
|
| |
|
| Submission date |
Apr 16, 2010 |
| Last update date |
May 15, 2019 |
| Contact name |
sihem cheloufi |
| E-mail(s) |
cheloufi@cshl.edu
|
| Organization name |
Cold spring harbor laboratory
|
| Street address |
1 bungtown road
|
| City |
cold spring harbor |
| ZIP/Postal code |
11724 |
| Country |
USA |
| |
|
| Platform ID |
GPL9250 |
| Series (1) |
| GSE21370 |
Small RNA profile in E18.5 fetal liver from wild type and Ago2 catalytically inactive mutant mice |
|
| Relations |
| SRA |
SRX019620 |
| BioSample |
SAMN00011952 |
