|
Status |
Public on Jun 13, 2010 |
Title |
18-32 nt total small RNAs (Mov10l-/-) |
Sample type |
SRA |
|
|
Source name |
Testes
|
Organism |
Mus musculus |
Characteristics |
strain: C57BL/6 genotype: Mov10l-/- mutant age: 10 dpp antibody: Total small RNAs
|
Treatment protocol |
Testes were extracted from euthanized animals of indicated ages
|
Growth protocol |
Mice were maintained and genotyped as per standard procedures
|
Extracted molecule |
total RNA |
Extraction protocol |
Mov10L1 was immunoprecipitated from mouse testes extracts, small RNAs recovered by phenol-choloroform extraction, 5'-end labelled with gamma-ATP and gel extracted. Total RNA was separated by 15% Urea-PAGE and RNAs in the range of 18-32 nt were gel extracted. RNA libraries were prepared with Digital Gene Expression for Small RNA kit from Illumina.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer |
|
|
Description |
Mov10l-associated small RNAs and total 18-32 nt small RNAs extracted after PAGE separation. This sample represents total small RNAs
|
Data processing |
In-house programs developed by Alexander Stark and Ravi Sachidanandam. Barcoded dataset (5' GUUCAGAGUUCUACAGUCCGACGAUCCGAC; barcode CGAC is at 3' end) was first sorted into respective libraries and then mapped to the genome (July 2007, mm9 assembly).
|
|
|
Submission date |
May 20, 2010 |
Last update date |
May 15, 2019 |
Contact name |
Ramesh Pillai |
E-mail(s) |
ramesh.pillai@unige.ch
|
Organization name |
University of Geneva
|
Department |
Department of Molecular Biology
|
Street address |
30, Quai Ernest-Ansermet
|
City |
Gneveva |
ZIP/Postal code |
CH-1211 |
Country |
Switzerland |
|
|
Platform ID |
GPL9185 |
Series (1) |
GSE21763 |
Mouse MOV10L1 associates with Piwi proteins and is an essential component of the piRNA pathway |
|
Relations |
SRA |
SRX021366 |
BioSample |
SAMN00014098 |