 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 15, 2021 |
| Title |
293T_ORL_rep2_treated |
| Sample type |
SRA |
| |
|
| Source name |
HEK-293T cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK-293T
treatment: Fragmented RNA was stepwise incubated with NO/O2, TDO, probe BA. The biotinylated RNA was enriched by streptavidin-coated beads and then eluted by DTT to get m6A-ORL IP sample.
sample type: IP
|
| Treatment protocol |
Total RNA was isolated from HEK-293T with TRIzol (Invitrogen) according to the manufacture’s protocol. The poly A+ RNA was isolated by subjecting total RNA to oligo(dT) enrichment using Dynabeads Oligo(dT)25 (NEB) and gDNA was removed by TURBO DNase (Invitrogen). Purified poly A+ RNA was fragmented using RNA fragmentation reagents (Ambion) at 70 °C for 8-15 min. For MeRIP samples, fragmented RNA was reserved as MeRIP input sample, fragmented RNA was incubated with anti-m6A antibody and then eluted to get the MeRIP IP sample. For m6A-ORL samples, fragmented RNA was stepwise incubated with NO/O2, TDO, probe BA. A portion of biotinylated RNA (or untreated fragmented RNA) was reserved as m6A-ORL input sample, the left RNA was enriched by streptavidin-coated beads and then eluted by DTT to get m6A-ORL IP sample. All the input and IP samples were subjected to RNA-Seq.
|
| Growth protocol |
HEK-293T cells were cultured in DMEM medium without sodium pyruvate (Dulbecco’s Modified Eagle Medium, HyClone) supplemented with 10% FBS (Cegrogen) and 1% penicillin/streptomycin (Genview). The cells were maintained at 37 °C under a humidified atmosphere containing 5% CO2.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Chemical treated RNA was first subjected to end repair by T4 PNK, 3′-adapter ligation (3′ adapter, /5rApp/NNNNNNTGGAATTCTCGGGTGCCAAGG/3ddC/) followed by the 3′ adapter removing by 5′-deadenylase and RecJf digestion. After purification, SuperScript III was used to perform RT (RT primer, /ACACGACGCTCTTCCGATCT). After cDNA synthesis, 5′ adapter (5′ adapter, /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3ddC/) ligation were performed. After purification, qPCR was performed to evaluate the cycle numbers of each samples to avoid over-amplification. Library PCR amplification was performed using the NEB primers. The products were purified by NEBNext Sample Purification Beads or low melting point agarose gel and used for sequencing.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
HiSeq X Ten |
| |
|
| Data processing |
Library strategy: m6A-ORL-Seq
Adapter seqeucnes were trimmed by using trim galore.
fastuniq is used to remove PCR duplication. Then use seqtk trimfq '-e 10' and '-b 10' remove random sequences added in library construction.
Clean reads were mapped to genome by using STAR; with parameter "--outFilterMultimapNmax 20 --outFilterMismatchNmax 10". Only the proper pair and uniquely mapped alignments was persisted for the downstream pipelines.
Aligned reads were used for peak calling and enriched regions comparing by exomePeak.
HOMER was used for peak annotation and detection of the sequence motif.
Genome_build: hg38
Supplementary_files_format_and_content: m6A peaks resulting from MeRIP-Seq (IP1/2) and m6A-ORL-Seq (total/mRNA1).
|
| |
|
| Submission date |
Oct 12, 2021 |
| Last update date |
Jan 05, 2022 |
| Contact name |
Yalun Xie |
| E-mail(s) |
ylxie@whu.edu.cn
|
| Organization name |
Wuhan University
|
| Street address |
Ba Yi Road
|
| City |
Wuhan |
| State/province |
Hubei |
| ZIP/Postal code |
430072 |
| Country |
China |
| |
|
| Platform ID |
GPL20795 |
| Series (1) |
| GSE185753 |
Transcriptome-wide Profiling of N6‑Methyladenosine via a Selective Chemical Labeling Method |
|
| Relations |
| BioSample |
SAMN22228476 |
| SRA |
SRX12580374 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5623229_mRNA1_peak.bed.gz |
163.6 Kb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
