|
| Status |
Public on Apr 01, 2011 |
| Title |
LH+7 |
| Sample type |
SRA |
| |
|
| Source name |
LH+7_natural_cycles
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: endometrium
|
| Treatment protocol |
Endometrial biopsies were obtained from two groups of patients using different experimental designs. In the first group, we aimed to study endometrial receptivity during natural cycles. In the second group, ovarian stimulation was performed using the long protocol. Endometrial biopsies were obtained on days hCG+4 (n=5) and hCG+7 (n=5) from women who did not have embryo transfer after IVF treatment because of fertilization failure.
|
| Growth protocol |
A total of 10 women patients (age range, 27-38 years; body mass index or BMI range, 17.4-22.3 kg/m2) undergoing IVF treatment
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNAs were extracted with TRIzol reagent. The small RNA fragments of 18~30 bases long were isolated and purified from 10 μg total RNA using 15% TBE-Urea PAGE gel. The 5’ adaptors (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) and 3’ adaptors (5’- pUCGUAUGCCGUCUUCUGCUUGidT-3’) were added to the ends of fragments. Reverse transcription PCR (RT-PCR) was performed using a RT-PCR kit (Invitrogen). The fragments were purified using 6% TBE PAGE gel and used for high-throughput sequencing with an Illumina Genome Analyzer IIx sequencer at Huada Genomics Institute Co. Ltd, China. Each small RNA sample was sequenced in a single lane.
18-35nt small RNA by gel
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
small RNA(18-35nt)
small RNA deep sequencing of LH+7
|
| Data processing |
the 3’ end of the read was determined by the 3’ most perfect match to the first 8 nt of the 3’ adaptor (build: hg19).
|
| |
|
| Submission date |
Jan 10, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Zeng-Ming Yang |
| E-mail(s) |
zmyang@stu.edu.cn
|
| Phone |
0754-82902011
|
| Organization name |
Shantou University
|
| Department |
Biology
|
| Lab |
Reproductive Biology
|
| Street address |
263 Daxue Road
|
| City |
Shantou |
| ZIP/Postal code |
515063 |
| Country |
China |
| |
|
| Platform ID |
GPL10999 |
| Series (1) |
| GSE26516 |
Genome-wide identification of micro-ribonucleic acids associated with human endometrial receptivity in natural and stimulated cycles by deep sequencing |
|
| Relations |
| SRA |
SRX038449 |
| BioSample |
SAMN00190989 |
