|
| Status |
Public on Apr 02, 2013 |
| Title |
fat bodies_control, rep2 |
| Sample type |
RNA |
| |
|
| Source name |
Adult females injected with elution buffer
|
| Organism |
Anopheles gambiae |
| Characteristics |
strain: Yaounde
gender: female
developmental stage: adult
tissue: fat bodies (abdomen without midgut, ovaries and malpighian tubule)
treatment: control
|
| Treatment protocol |
Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5’ TCCATGACGTTCCTGATGCT 3’) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h.
|
| Growth protocol |
Anopheles gambiae s.s. mosquitoes were reared at 25 ºC and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS). Trizol reagent (Invitrogen Life Technologies) was used to extract total RNA.
|
| Label |
biotin
|
| Label protocol |
RNA was processed for use on Affymetrix (Santa Clara, CA, USA) GeneChip Plasmodium/Anopheles Genome Arrays, according to the manufacturer’s One-Cycle Target Labeling Assay. Briefly, 3.7 µg of total RNA containing spiked-in Poly-A RNA controls (GeneChip Expression GeneChip Eukaryotic Poly-A RNA Control Kit; Affymetrix) was used in a reverse transcription reaction (One-Cycle DNA synthesis kit; Affymetrix) to generate first-strand cDNA. After second-strand synthesis, double-stranded cDNA was used in an in vitro transcription (IVT) reaction to generate biotinylated cRNA (GeneChip Expression 3’-Amplification Reagents for IVT-Labeling; Affymetrix). Size distribution of the cRNA and fragmented cRNA, respectively, was assessed using an Agilent 2100 Bioanalyzer with a RNA 6000 Nano Assay.
|
| |
|
| Hybridization protocol |
15 µg of fragmented cRNA was used in a 300-µl hybridization containing added hybridization controls. 200 µl of mixture was hybridized on arrays for 16 h at 45°C. Standard post-hybridization wash and double-stain protocols (EukGE-WS2v4) were used on an Affymetrix GeneChip Fluidics Station 450.
|
| Scan protocol |
Arrays were scanned on an Affymetrix GeneChip scanner 3000.
|
| Description |
C-3
Gene expresion data from fat bodies (abdomen without midgut, ovaries and malpighian tubule) of mosquitoes injected with ODN elution buffer.
|
| Data processing |
Scanned arrays were analyzed first with Affymetrix MAS 5.0 software to obtain Absent/Present calls and for subsequent analysis with dChip 2006 (http://www.dchip.org, Wong Lab, Harvard). Using a probe set mask file that excluded all probes sets interrogating human and Plasmodium falciparum transcripts, the arrays were normalized to a baseline array with median CEL intensity by applying an Invariant Set Normalization Method (Li and Wong, 2001). Normalized CEL intensities of the four arrays were used to obtain model-based gene expression indices based on a PM (Perfect Match)-only model (Li and Hung Wong, 2001).
|
| |
|
| Submission date |
Jan 28, 2011 |
| Last update date |
Apr 02, 2013 |
| Contact name |
Henrique Silveira |
| E-mail(s) |
hsilveira@ihmt.unl.pt
|
| Phone |
351213652657
|
| Organization name |
Instituto de Higiene e Medicina Tropical, IHMT, UNL
|
| Department |
Global Health and Tropical Medicine
|
| Street address |
Rua da Junqueira, 100
|
| City |
Lisbon |
| ZIP/Postal code |
1349-008 |
| Country |
Portugal |
| |
|
| Platform ID |
GPL1321 |
| Series (1) |
| GSE26941 |
CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes |
|
