 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 26, 2012 |
| Title |
Cel mixed N2 dsRNA Hiseq |
| Sample type |
SRA |
| |
|
| Source name |
mixed stage N2 worms, dsRNA
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
target molecules: double-stranded RNA (dsRNA)
strain: N2
cell line: whole organism
rnase treatment: ssRNase (RNase One)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was subjected to two rounds of rRNA depletion (Ribominus, Invitrogen (Carlsbad, CA)), and then treated with a single-strand specific ribonuclease (RNase One, Promega (Madison, WI)) for dsRNA-seq or with a double-strand specific ribonuclease (RNase V1, ABI (Foster City, CA)) for ssRNA-seq, all per manufacturer's instructions. The RNA samples are then used as the substrate for sequencing library construction using the Small RNA Sample Prep v1.5 kit (Illumina, San Diego, CA) as per manufacturer's instructions.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
3' adapter sequence: ATCTCGTATGCCGTCTTCTGCTTG
|
| Data processing |
Abundance info of NR-seqs (*info.txt file): All reads are reduced to non-redundant (NR) sequences at first to minimize the computational requirement for subsequent analysis steps. Only NR-seqs that can map to the D. melanogaster (UCSC, dm3) or C. elegans (UCSC, ce6) genomes are shown (either trimmed or untrimmed).
NR-seq after trimming of 3'-adapters (*seq.fasta file): In order to detect 3'-adapter sequences, all NR-sequences are aligned to the Illumina 3'-adapter version 1.5 sequence using the "cross-match" program. The alignment parameters for cross-match are carefully tuned to maintain all alignments with less than 6% mis-matches. The cross-match alignment results are parsed using in-house Perl scripts. All NR-sequences that align to ⥠6 bp of the 3'-adapter sequence at their 3' end are defined as short and are subsequently trimmed at the adapter-sequence boundary. The remaining NR-sequences (without detectable 3'-adapters) remain "untrimmed". Only NR-seqs that can map to the D. melanogaster (UCSC, dm3) or C. elegans (UCSC, ce6) genomes are shown (either trimmed or untrimmed).
Alignment (*loc.txt file): All trimmed and untrimmed NR-sequences are aligned to the D. melanogaster (UCSC, dm3) or C. elegans (UCSC, ce6) genomes using cross-match, with the program parameters set to guarantee all sequences that align with 6% mis-matches to the respective genome. Alignment results for trimmed or untrimmed inputs are then parsed independently using in-house Perl scripts. More specifically, alignments for trimmed sequences are required to extend to the ends of the query sequences, whereas alignments for untrimmed sequences are only required to extend to the imaginary positions of undetectable 3'-adapters (< 6 bp from the 3' end of the sequence). The true lengths of the untrimmed sequences are also determined in this step by the most-frequent aligned length of all possible alignments to the respective genome. At last, trimmed and untrimmed NR-sequences, as well as their genome loci information, are combined to form the final dataset using in-house Perl scripts. The smRNA libraries are pre-processed by this balanced pipeline as well.
|
| |
|
| Submission date |
May 26, 2011 |
| Last update date |
Jun 11, 2013 |
| Contact name |
Fan Li |
| Organization name |
University of California Los Angeles
|
| Department |
Pediatrics
|
| Street address |
675 Charles E Young Drive South
|
| City |
Los Angeles |
| State/province |
CA |
| ZIP/Postal code |
90024 |
| Country |
USA |
| |
|
| Platform ID |
GPL13657 |
| Series (1) |
| GSE29571 |
Global analysis of RNA secondary structure conservation between two metazoans |
|
| Relations |
| BioSample |
SAMN02198291 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM732109_cel_dsrna_hiseq_NR_ce6_loc.txt.gz |
144.7 Mb |
(ftp)(http) |
TXT |
| GSM732109_cel_dsrna_hiseq_mapped_NR_info.txt.gz |
18.9 Mb |
(ftp)(http) |
TXT |
| GSM732109_cel_dsrna_hiseq_mapped_NR_seq.fa.gz |
39.4 Mb |
(ftp)(http) |
FA |
| Processed data provided as supplementary file |
|
|
|
|
 |
