#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCTCTGTGCAGTTCAAAA	37	1	yes
GATCCTCTCGTGGCTTCCTA	15	1	yes
GATCTGACACATCTGGAGTG	2	2	yes
GATCTCTGGTGTCATGGTGG	15	4	yes
GATCAGAGGTGTACACTAAC	20	2	yes
GATCATAGTGGACGTTGTTA	15	3	yes
GATCAAGCAGCAAAAAAAAA	31	4	yes
GATCTCTGAGCCTGAAGGCC	66	4	yes
GATCAGTTTGTGAAACTTGG	1	1	yes
GATCACCGCACACCACCCCT	5	1	yes
GATCAGTGTGTGCCAAGGAG	312	8	yes
GATCAGTCAGTGACAACCAA	9	8	yes
GATCAAGAGGAAGCACAATA	194	13	yes
GATCACCCCAAAGCTCGTTA	3	1	yes
GATCAGTAGAGCTTGGACCC	176	5	yes
GATCAGTACACGGTGTATGT	40	10	yes
GATCAAGACGCAGGTCGAGG	76	1	yes
GATCAGGCTCTTTGTTTGTG	85	7	yes
GATCAGGCGTGAGCTTCAGA	2	2	yes
GATCAGGCCGGCCTTAAACT	6	0	yes
GATCTGGCCACTTTGTGTTT	7	1	yes
GATCTGGCCAACGGCAACAT	112	9	yes
GATCTGGCAGTCATAGCTTG	191	38	yes
GATCTGGCAGTATATTTTAG	15	2	yes
GATCTGGCACCCTCTCCTGG	2	2	yes
GATCTGGCACCCCCTTCTGG	18	2	yes
GATCTGGCAACTGTGCGGGG	3	1	yes
GATCTGGCAAAAACTACGGG	111	11	yes
GATCTGGATTTGGTTGAGAT	56	7	yes
GATCTGGATGTGTGATAATC	20	19	yes
GATCTGGATGGAGTGCCTTT	18	3	yes
GATCTGGAGTTGGCTTGTGC	47	2	yes
GATCTGGAGTGGGTGGGATA	16	1	yes
GATCTGGAGTCTGGTGTGGC	559	1	yes
GATCTGGAGTCTCTTAAAGC	101	13	yes
GATCTGGAGTCCGCTTACAA	113	0	yes
GATCTGGAGGGAGGGGCGGG	205	17	yes
GATCTGGAGGATTCCAGCGA	13	7	yes
GATCTGGAGGACCTCGTACC	46	43	yes
GATCTGGAGCTCGCCCCCAG	34	6	yes
GATCTGGAGCGTATGGGTCT	8	3	yes
GATCTGGAGCCCTGGAATCC	160	21	yes
GATCTGGAGCATGTCCATGA	229	28	yes
GATCTGGAGAGTTTGTTCAG	4	3	yes
GATCTGGAGAAGAATGGTCG	17	6	yes
GATCTGGACTTTGCTCAACC	98	31	yes
GATCTGGACTGGTGTTTCTT	104	0	yes
GATCTGGACTCTCACCTAGG	80	25	yes
GATCTGGACTCACCTGGGAG	380	42	yes
GATCTGGACTCAAGGGGCAT	133	20	yes
GATCTGGACGGAAGTGGAGT	3	1	yes
GATCTGGACGATTCTGAGCC	137	19	yes
GATCCTCCTTGGCTACAGTG	2	2	yes
GATCCTCCTGTTCTCTGGTA	1	1	yes
GATCTGAAGCCCAACGGGTC	3	3	yes
GATCCTCCCTATCGACCAGA	1	1	yes
GATCAGCCTACGCTCACATT	120	5	yes
GATCAAGAATGGACCAAGAT	220	7	yes
GATCACCAAGTGGTACCTGG	13	12	yes
GATCAGCAGGTATTATCAGA	2	2	yes
GATCAGACTGTTGCTTTCGC	232	0	yes
GATCAGCACCAAGTGACTTG	26	10	yes
GATCAGAGTACTCAAGAGAG	4	2	yes
GATCAGAGCTGGAGGGAGCA	19	1	yes
GATCAGAGAGGAGAGAAACC	10	9	yes
GATCAGACAGATTTTGTTCC	43	4	yes
GATCAACTCCCGTACTAGAA	135	58	yes
GATCTGGACCAGGCTTGGAA	24	7	yes
GATCTGGACAACCAGTGAAG	6	1	yes
GATCTGGAAGAACAAAGCTT	43	40	yes
GATCTGCTTTTTGAAATGAA	11	1	yes
GATCTGCTTTGTGCTTGGCT	106	28	yes
GATCTGCTTTCTCAGGACTC	99	28	yes
GATCTGCTTTCCCTTTGTAA	116	18	yes
GATCTGCTTGTGTTGTGTTG	87	11	yes
GATCTGCTTGGCTGCCATTA	108	6	yes
GATCTGCTTGCCCCAAACAA	568	38	yes
GATCTGCTTCTACCTCCCTA	18	2	yes
GATCTCTACCACCCAGGTAC	4	4	yes
GATCTCGGACGCTCAGTGGG	312	30	yes
GATCTCGCTGGTTCGCACCT	132	4	yes
GATCTCGCTGCATTTACATA	57	2	yes
GATCTCGATTCTACAGTGGT	46	1	yes
GATCTCGAGCACTCTCGTCC	78	13	yes
GATCAGAACCTTGCCGAAAC	6	5	yes
GATCTCCTGGTTTTCTAAAA	1	1	yes
GATCTCCTGGCCACTGTGGT	95	16	yes
GATCACTGTTTGTGCCTCTG	139	23	yes
GATCACTGTGTCCCAGGCTG	58	3	yes
GATCACTGACATCTATACCC	22	0	yes
GATCAGAATGGCGGAGGCGG	155	0	yes
GATCACAAGTGGAAAGCAAT	28	3	yes
GATCACTCTTCCCGCTGCTG	26	11	yes
GATCACTAAGAGGGAAAATG	8	8	yes
GATCAACCGCACACAGGCGG	1	1	yes
GATCACGCTGCTCCGACAGG	34	4	yes
GATCACGCTCAGCCCTTGGT	10	3	yes
GATCACGAAGAAGGCAGCCT	22	20	yes
GATCTCATTGGATTGCCTCC	10	11	yes
GATCACCTGTGGAGTTGTCA	37	17	yes
GATCACCTGACTCCTAACCG	61	3	yes
GATCTGTGCCAAATGTAACA	6	7	yes
GATCTCCTCTCTTCCCACGG	18	2	yes
GATCTCCTCTCCAGGGAGCT	28	3	yes
GATCTCCCTTCCCCGGGGAA	48	5	yes
GATCTCCCTGTGCCGGTGCC	296	36	yes
GATCACCCATGTAAAGCGGT	6	5	yes
GATCACCAGAAAGTTTGTTA	1	1	yes
GATCTCCATTGCATTGATAT	7	6	yes
GATCACATGGGTCGAGGGTT	115	18	yes
GATCAACAGCTCGCTAGTGG	39	36	yes
GATCAATGTCCTCAAGGAGA	12	11	yes
GATCACAGGGGAACTAATTC	52	20	yes
GATCACAGCCGAACCTGGGT	4	2	yes
GATCACAGAGTGGGAATCTC	54	27	yes
GATCACACTGTCTGAGGCGT	59	7	yes
GATCACACTCTGGCCCCCAA	27	1	yes
GATCACACGCAGAATGAAGT	3	3	yes
GATCACACCAGAGTCCAGGT	9	4	yes
GATCAACACCGTGCTCAGTG	6	5	yes
GATCAACACCGCAACCATTC	14	15	yes
GATCACACAGGAGAGAGAAA	27	1	yes
GATCAATGTGGGCAGAGGGT	13	2	yes
GATCAATCACCTCAGAGGTT	1	1	yes
GATCTCCAGCAGTAGAAAAA	5	5	yes
GATCTCCACATGTGCACATG	33	7	yes
GATCAAGTTCAACGGTTTTT	2	2	yes
GATCAAGTGCTCAATCGAAG	5	1	yes
GATCTCAGTGGGTCACATAA	8	7	yes
GATCTCAGTCGGATGCACCC	103	5	yes
GATCAAGGCCGTTCAGATGT	29	0	yes
GATCAAGGCCCCCAAGAGAG	31	0	yes
GATCAAGGCAGTGGGCTGAT	2	0	yes
GATCAAGGACATCCATGTGC	72	13	yes
GATCAAATCCGACGACGAGG	61	13	yes
GATCAAGAGCAGTGCTGCTC	31	28	yes
GATCAACTTGGCTATGATAA	20	18	yes
GATCAAATATGTGCCCTATG	32	15	yes
GATCTCAGCCCTACGATACA	10	1	yes
GATCAAAGTGGAGAATGAGG	13	12	yes
GATCTCAGGGCAGAAATGAT	458	40	yes
GATCTCAGATGAGAGATGGT	2	2	yes
GATCTCAGAGGCTCGGTATC	33	3	yes
GATCAAAGCCAAAAAAAAAA	17	18	yes
GATCTCACTGAGTGAACAGA	4	4	yes
GATCAAACCGCAAAAAAAAA	16	5	yes
GATCTCACGATGAGCTATGA	91	39	yes
GATCAAACCCAGGGCTTTGT	41	5	yes
GATCAAAGGGTCAAGAGTCC	56	11	yes
GATCACTTTATTTGCTAGGG	27	12	yes
GATCAAAGGAAATGGAGCCA	86	19	yes
GATCTCAAGTTGAACCGACT	84	1	yes
GATCAAAGCACTGGCGGGCT	10	0	yes
GATCAAAGACGGTCCCCAGA	9	8	yes
GATCAAAGAAGGCTGTTGAC	3	3	yes
GATCTTTTTCTCCATCTCTT	593	6	yes
GATCTTTTGTCGGATATTTA	7	3	yes
GATCTTTTGGAACTGGAGTT	14	1	yes
GATCAAACGTGGCTGAGCGC	413	37	yes
GATCAAACGTGGCTGAGCGA	23	21	yes
GATCATCTTGTGAAAACCCA	424	58	yes
GATCATCTTGGAAGGATTCC	2	2	yes
GATCCACGTTCCTGACCCCA	17	5	yes
GATCTTTTCCACCTTCAGAG	144	6	yes
GATCAAACCCGTGGAAGAGG	20	2	yes
GATCAAACAGGCTGTCAAGA	5	5	yes
GATCTTTTACTTCGTGGCTG	172	4	yes
GATCAAAATGGAAGTCCTCA	21	1	yes
GATCTTTGTGGTGTGGGCCA	98	29	yes
GATCTCAAATTCCAGGACAG	13	12	yes
GATCTTTGTGAGTTGGAGAC	20	0	yes
GATCTTTGTCTTTTTGAGCG	9	2	yes
GATCAAAACCCATCAACACC	3	3	yes
GATCTTTGTCCAGTTCTGCA	14	13	yes
GATCTTTGTATGGCGGCTGT	20	2	yes
GATCCAAGCCCGGGGCCCGC	9	8	yes
GATCTTTCTGGCAAGGAAAC	1462	11	yes
GATCAAAATCGCAGTTACTT	177	8	yes
GATCAGGGAATGTTAATATG	7	6	yes
GATCATCCAGAACACAGCCT	210	90	yes
GATCCATTCACCTACGGCAA	4	2	yes
GATCTTTCTGGGAGCAGTGT	18	1	yes
GATCTGCTCCAAGAAATGTC	9	3	yes
GATCCTGATGCTGCCACGGA	63	18	yes
GATCTGCGCTTCCAGAGTGC	1908	270	yes
GATCCGCTCGACAAGACAGG	19	4	yes
GATCCACTCAGCCGTGGTTT	20	0	yes
GATCCATGGAAGAGTTGACC	11	0	yes
GATCAACTGTGCAGAAAACA	10	9	yes
GATCTCGAGAGGCTTTGTGT	73	41	yes
GATCCTGAGCTTTGACAAGA	1914	802	yes
GATCCTGAGCCAGATGTCAT	109	2	yes
GATCCTGAGATGCAGCTCAT	63	1	yes
GATCCTGAGAGCCTCATCCT	3	3	yes
GATCCTGAGAGAAAACAGCA	7	8	yes
GATCCTGACTTTGCCAGCTG	50	0	yes
GATCCTGACTCTGACACTAC	55	20	yes
GATCCTGACCTGGGCTTCCT	130	23	yes
GATCCTGACCACATGAACAA	825	229	yes
GATCCTGACCAATGACAATA	28	7	yes
GATCCTGACATAAACCCTTG	3	1	yes
GATCCTGACAGTGCACCTAA	130	29	yes
GATCCTGACAGAGCCTTGGT	154	17	yes
GATCCTGAATGTGGAAAAGA	101	28	yes
GATCCTGAATGACGTTCAGG	252	31	yes
GATCCTGAAGTGGCCTCAGC	11	3	yes
GATCCTGAAGTAGACAAAAA	29	13	yes
GATCCTGAAGGTCATCCGCA	66	3	yes
GATCCACGGCTCTTCACACT	8	0	yes
GATCCGCATCCTCAACCCAT	5	5	yes
GATCCACGCGAAAAGCCGGG	8	5	yes
GATCCGCACCGGGTGGGGAA	13	2	yes
GATCCTGAAGAACTTTGTCA	221	27	yes
GATCCTGAAAGCCAAGTTAG	231	11	yes
GATCCTGAAACTGACTCGCT	4	3	yes
GATCCTGAAAATTCTTTGCA	29	12	yes
GATCCTCTTTGCCAACCCCA	128	57	yes
GATCCTCTTTGCACAGAAGA	244	33	yes
GATCCTCTTTCACGCTTCTT	7	2	yes
GATCCTCTTGTTCCACGATG	68	2	yes
GATCCTCTTGTCCACTCCAC	50	7	yes
GATCCTCTTGCTGCAGCTTC	49	6	yes
GATCCTCTTGCGGGACAGTC	25	5	yes
GATCCTCTTGATTCCTTCTG	88	10	yes
GATCCTCTTGATGCAGAGAG	47	18	yes
GATCCTCTTCTTCCTCGTGA	147	21	yes
GATCCTCTTCTTCAGCACAC	382	55	yes
GATCCTCTTCTGCTGTTCTG	4	0	yes
GATCCTCTTCCTGCTCCAGC	528	75	yes
GATCCTCTTCCCATCCATCC	49	6	yes
GATCCTCTTCATCTTGGGCA	540	90	yes
GATCCTCTTCAGCCCTGTGA	37	12	yes
GATCCTCTGTTGGGGCCTCG	180	3	yes
GATCCTCTGTTGCGTATTCT	3	1	yes
GATCCTCTGTGTCCTTATTT	13	3	yes
GATCCTCTGTGGACTCATCT	171	9	yes
GATCCTCTGTGCCTCACTCC	277	33	yes
GATCCTCTGCTTTAAGTCCT	17	1	yes
GATCCTCTGCACCAGAAGAA	4	4	yes
GATCCTCTGCAAGAGCAACA	8	2	yes
GATCCTCTGAGGCAGTATTG	254	28	yes
GATCCGAGAGTGACAAATCC	7	4	yes
GATCCACCACCTAGAATCTA	4	0	yes
GATCAACTTCCAGAGCATGG	2	2	yes
GATCCTCTGAATGTTTTCCC	2161	170	yes
GATCCTCTCTTGTGCTACCT	15	3	yes
GATCCCAAGGTTAGAAAGTG	1	1	yes
GATCCTCTCTGAACCTCCTG	38	6	yes
GATCCTCTCTCGGTGTGGTT	109	11	yes
GATCCTCTCCTTCTGACCTC	42	6	yes
GATCCTCTCATTCAGTCTTC	44	6	yes
GATCCTCTATGAGCTAAGCA	6	1	yes
GATCCTCTAGGGGTTATGGG	419	38	yes
GATCCTCTAAGACACTCATC	13	3	yes
GATCCTCGTGCCTGTCTCCC	74	21	yes
GATCCTCGGGCAAGCCAAGA	2118	281	yes
GATCCTCGGGAGACCACTGG	96	7	yes
GATCCTCGGGAATTTTTACC	150	5	yes
GATCCTCGGAGGCTACCGAG	18	0	yes
GATCCTCGCAGCTTCTATGA	283	24	yes
GATCCTCGAGTGAGGACGAC	19	4	yes
GATCCTCGACAGGAAGCCAC	27	1	yes
GATCCTCCTTGTCAAGTACA	1816	114	yes
GATCCTCCTGTGAAGTGCCA	15	5	yes
GATCCTCCTGCGTGCTGACA	94	13	yes
GATCTGAGCTGAATTTGAAG	31	8	yes
GATCCACACGAGGGAAGCTG	39	4	yes
GATCCTCCTGCCCCTCCAAT	36	6	yes
GATCCTCCTGCCCCGACAAG	115	77	yes
GATCCTCCTGAGTGCTGGGA	73	1	yes
GATCCTCCTCCTGTGTTTCT	92	1	yes
GATCCTCCTCAGACTTGTCC	31	5	yes
GATCCTCCGTGAGTATGCCT	164	10	yes
GATCGTTTAGTTCTCTGTTT	21	3	yes
GATCCTCCCCTTTACGGACA	276	62	yes
GATCCTCCCCCTCTCCCACC	25	9	yes
GATCCTCCCCAGGGATGGGG	289	40	yes
GATCCTCCCACAGGGACACT	292	28	yes
GATCCTCCCAAGTGAATGAC	115	4	yes
GATCCTCCAGTCAGTCTATT	67	7	yes
GATCCTCCAGGACAAGGGGT	175	19	yes
GATCCTCCAGCAGAGTGGAC	29	3	yes
GATCCTCATGTTCAGTTTTT	12	2	yes
GATCCTCATCTTCATTCCTT	3	3	yes
GATCCTCATATGAGGACCAT	82	17	yes
GATCCTCAGTTACTCGCTGC	14	0	yes
GATCCTCAGTGGGTAAGTGC	10	6	yes
GATCCTCAGTGCTACTTGCG	26	6	yes
GATCCTCAGGGTCTGCCCTT	31	4	yes
GATCCTCAGGAGTTGCAATG	2489	273	yes
GATCCTCAGGAAACAGTCTC	60	2	yes
GATCCTCAGCTGGCTGGAGC	120	17	yes
GATCCTCAGCTGCCCTGCCT	95	18	yes
GATCCTCAGATTAGATGTTT	44	7	yes
GATCCTCAGAGACGTGCTCG	93	4	yes
GATCCTCAGAAGGTGAAGGA	4	3	yes
GATCCTCACCATCCACGTTT	62	12	yes
GATCCTCACCAGCCGCGGGC	1186	101	yes
GATCCTCAAGCGCCTCAACC	129	17	yes
GATCCAGTGCCTGTGTAGAA	64	8	yes
GATCCCTGCTCTGCAATGAG	53	9	yes
GATCCCAGACATTTCCCCGG	8	9	yes
GATCCTCAACTCCTCCAAGG	138	33	yes
GATCCTCAACATCCGCCTGC	132	6	yes
GATCCTCAACAAGATGCTAT	247	61	yes
GATCCTCAAATCAGGCAACC	17	3	yes
GATCCTCAAACAGACATTGT	102	21	yes
GATCCTATTTTGGATGGTGA	1	1	yes
GATCCTATTCTTTGTCTTAT	32	3	yes
GATCCTATTCTTAGGTCTAA	67	9	yes
GATCCTATTCTCCAAAGACT	21	3	yes
GATCCTATTCCAGCCAAATG	63	7	yes
GATCCTATTCAGTGGCACAA	2	2	yes
GATCCTATTAGCCAAACTTT	13	8	yes
GATCCTATGTGTTGGCCATT	105	11	yes
GATCCTATGTGGCTCTAAAA	1	1	yes
GATCCTATGTAGCCCAGGCT	5	2	yes
GATCCTATGGTGATTCCAGT	13	7	yes
GATCCTATGGCATATGCAAG	39	9	yes
GATCCTATCTCCCGGTTGGG	58	17	yes
GATCCTATCATTGCTGGTGG	45	5	yes
GATCCTATCACCAGCACTGA	63	2	yes
GATCCTATATTTCCTGCTGA	24	4	yes
GATCCTACTTTGGGAACATG	16	1	yes
GATCCTACTGTGGATGACAC	494	52	yes
GATCCTACTGATGAAGTGCC	69	3	yes
GATCCCTGAGGCTGCCTCGA	10	11	yes
GATCCAGGTTTTGTGGTCTT	1	1	yes
GATCCCTCTCCCAGGAACAA	3	1	yes
GATCCAAGCTGTCAAGAAGG	471	31	yes
GATCCAAGCTCCATTGTACC	6	7	yes
GATCCAAGCTAATCTGAGGA	2	0	yes
GATCCAAGCGGAAGACCTCA	3	1	yes
GATCCAAGCAGCCTTCAGGG	3	3	yes
GATCACCGGCTTGGTTCTCT	6	2	yes
GATCCTACGGAGCAAGTCTA	56	1	yes
GATCCTACCTTCTGCTTTCG	68	6	yes
GATCCTACCTGAGTGGCAGC	1390	36	yes
GATCCTACCATCCCTTTGAT	85	8	yes
GATCCTACCACAGAGCCTTA	38	4	yes
GATCCTACATCCATTCGGCT	142	2	yes
GATCCTACAGTGGCTGGCAA	995	33	yes
GATCCTACAGTCACTTCACA	93	9	yes
GATCCTACACATGGAGGCTG	95	14	yes
GATCCTACACACCTACCAGA	232	14	yes
GATCCTACACACAGTGGTGA	1432	13	yes
GATCCTACAAGCCTGTCCGT	97	5	yes
GATCCTACAACTCAGAAGAC	3	1	yes
GATCCTACAAAGGTCTTGAA	53	2	yes
GATCCTAATGGACAACAAAG	18	2	yes
GATCCTAATGATTTCAGCCC	7	8	yes
GATCCTAAGTAGAATCAGAT	4	0	yes
GATCCTAAGCAGATTCTGGG	52	1	yes
GATCCTAACTGTGGAACCTC	9	3	yes
GATCCTAACTCTGACCTTTC	86	8	yes
GATCCTGCACTTTGCTCCTC	80	6	yes
GATCCTAACTAAGCACATGA	31	11	yes
GATCCTAACCTAAGATGCCT	334	14	yes
GATCCTAACCCTGAACCCCA	122	34	yes
GATCCTAACCCAGTGGACTC	59	1	yes
GATCTTTGTGTGACTGGGTT	4	2	yes
GATCCAAGACATGGGCGCTA	1	1	yes
GATCCCGTTGAAGCACGGTG	71	12	yes
GATCAAGGTAAGAAACATTG	8	7	yes
GATCAAGGGGTCCAATCCAG	8	7	yes
GATCTCTGTGAATTCAGGGC	17	4	yes
GATCCTAAATTTGACCCAGG	15	1	yes
GATCCTAAATTCGATTCCCA	21	10	yes
GATCCTAAAGGCCGGTCACA	154	4	yes
GATCCTAAAGAAAGATTACG	4	3	yes
GATCCTAAACTCTGTTGCCA	11	3	yes
GATCCTAAAACTGAGGAAAG	7	4	yes
GATCCTAAAACCAAGGGAAT	666	41	yes
GATCCGTTTGGCCTCTCAAT	160	6	yes
GATCCGTTGTTTATGTGGAT	12	2	yes
GATCCGTTGGAAGGTTTACC	69	3	yes
GATCCGTTGCCTCCTTAAAG	36	10	yes
GATCCGTTGCCAGTTACCTG	459	53	yes
GATCACTTTTCACAGACCCC	6	5	yes
GATCCGTTCCTTATTGCCTG	7	4	yes
GATCCGTTCCTAGGGTACCT	263	7	yes
GATCCGTGTGTTGTTAAGAT	32	11	yes
GATCCGCTGTACCCATCATT	13	0	yes
GATCCGTGTGTGTGTGGGAG	343	63	yes
GATCCCAGGCTTCTGGGGAC	2	2	yes
GATCCGTGTGAAACTGGATG	1479	7	yes
GATCCGTGTATGTCTAAACA	458	86	yes
GATCCGTGGCTGCAGCAGAA	123	6	yes
GATCCGTGGAGAAACTTGCC	128	20	yes
GATCCAAAGGAGCTACTTAG	148	32	yes
GATCCCGGAAGGGGAGAAAG	3	3	yes
GATCCCGCCGCACGTTCCCA	4	2	yes
GATCCCGAGCTTCAAATCCC	2	2	yes
GATCCAAACCACAGGGATTG	16	1	yes
GATCCGTGCTGAGCGTCGGC	178	37	yes
GATCCGTGCTGAATTGGTTT	15	1	yes
GATCCGTGCATCTCATTGGC	64	6	yes
GATCCGTGAAGAACAAAAAG	24	0	yes
GATCCGTCTGTGGGGGCCTC	6	6	yes
GATCCGTCGCCTGGAGGTGG	161	26	yes
GATCCGTCAGTGGTCAGTGC	28	2	yes
GATCCGTCAGGCTTGCTCGT	62	4	yes
GATCCGTCAAGCTAACTGGA	134	41	yes
GATCCGTATCAGGTTCATGT	38	4	yes
GATCCGTAGTCTGAGTGATG	156	10	yes
GATCCGTACCCTGGTGCTGA	64	25	yes
GATCCGTAAGAAAGAGAAGG	13	5	yes
GATCCGGTTCTGGGACAGCA	13	1	yes
GATCCTCTCAGAAGCCATCC	5	5	yes
GATCCGGTCCCAAGACCGCT	637	56	yes
GATCCGGTCCAAGGCTCTTG	303	6	yes
GATCCGGGTGTCCAGTGACA	477	81	yes
GATCCGGGTGATGCGAATCG	32	7	yes
GATCCGGGTCCCCTTCCCTA	21	5	yes
GATCCGGGGGAAATTGGGAT	15	3	yes
GATCCGGGGCACACATTCTC	96	32	yes
GATCCGGGCAAAGCCTGCTC	206	37	yes
GATCCGGGAGTGCTGGACTT	43	15	yes
GATCCGGGAGGTGTGCGGCT	1959	262	yes
GATCCGGCTGTGCCAGGTGT	56	13	yes
GATCCGGCTGGGCCTGGCTC	784	65	yes
GATCCAAAATGTTCCATGGA	2	2	yes
GATCCCCTGGGCTTTAATAA	80	3	yes
GATCTTTCTCTTGTTTCCTT	3	1	yes
GATCCCCTGGAACTGGAATC	2	2	yes
GATCCAAAAAGCAGTTCAAC	14	1	yes
GATCAGTGTGTGCCAAGGAA	8	7	yes
GATCCGGCAGAAGGATGAGG	196	9	yes
GATCCGGATGGACGCACAGC	105	25	yes
GATCCGGATGAAACATTGTC	177	27	yes
GATCCGGAGTCTGGTTGCCA	1	1	yes
GATCCGGACTCACCTGGGAG	245	10	yes
GATCCGGACGCTTTGTGCTC	32	2	yes
GATCCGGACCAAGCCACCAC	192	16	yes
GATCCGGAAGAGCACAGCGA	34	32	yes
GATCCGGAAGAAGATGATGG	641	532	yes
GATCCGGAAGAAATAAAGGC	21	20	yes
GATCCGGAAATACAACCGAG	7	7	yes
GATCCGCTTGGCAGCCATTC	395	35	yes
GATCCGCTTCGTGGAATGGG	22	4	yes
GATCCGCTTACAGAGACTTT	194	27	yes
GATCCGCTGCTGGAAGAACC	21	5	yes
GATCCGCTGCAACCCGGTGC	788	38	yes
GATCCGCTCTGTGGTCGCCT	156	1	yes
GATCCGCTCTGAGGTTCTGT	436	57	yes
GATCCGCTCTCTGCATCTGT	10	2	yes
GATCCGCTCCTGGCGACTCC	55	11	yes
GATCCGCTCAGAGCCCAGCA	209	25	yes
GATCCGCTCACGCCCAGCAG	85	9	yes
GATCCGCCTTCTACTCGGAA	31	10	yes
GATCCGCCGCTAAGACCTGG	411	9	yes
GATCCGCCCTGTGAGTCACC	49	11	yes
GATCCGCCCACACCCACGTG	289	20	yes
GATCCGCCAAGTTATTCAGG	14	0	yes
GATCCGCCAAAAAAATGCAC	69	5	yes
GATCCGCATGATGGGAGGAG	20	2	yes
GATCCGCATCCGCAAGCCCT	137	26	yes
GATCCGCAGGTCAGATGACA	199	49	yes
GATCCGCAGCTTTTCCAGCA	68	1	yes
GATCCGCAATTATGAAGAAC	53	9	yes
GATCCGCAAGGTGCTGGACG	145	11	yes
GATCCGCAAGGACTTCTTAT	369	73	yes
GATCATTTCGGGCCAGTAGG	10	9	yes
GATCCAGACAGCCATCAAGG	201	49	yes
GATCCCCGAAGTCTCTCTCC	5	1	yes
GATCCCCCCGGAGTGTTCAG	5	1	yes
GATCCAGAAGTCATGGCAAA	4	4	yes
GATCCCCAGGACACTTTGCT	7	1	yes
GATCCGCAACTGTCCGGAAG	37	1	yes
GATCCGATTTCTGATTTTGC	26	4	yes
GATCCGATTGAAGCCTCAGG	39	6	yes
GATCCGATTACAGATGGTGT	16	7	yes
GATCCGATGGTGCTGAGACT	15	2	yes
GATCCGATGGGCCAGCCTTT	1228	58	yes
GATCCGATGCTTTAACAGCC	121	11	yes
GATCCTTTTATTTCACCGGG	13	12	yes
GATCCGATGAGGAAGATGAC	239	11	yes
GATCCGATACAAAACCATCG	3	3	yes
GATCCGAGTGAAAGCCGGAG	6329	219	yes
GATCCGAGGCTAGAGGGAGC	116	1	yes
GATCCGAGGCAGATTTTCTT	90	13	yes
GATCCGAGCGACTGTCACCA	96	16	yes
GATCCGAGCCTCACTACCTG	16	1	yes
GATCCGAGCAGCCACATTCC	13	1	yes
GATCCGACAGGAGGGTGTAA	404	9	yes
GATCCGAATTGCAGAGCTGT	79	22	yes
GATCCGAATAAACCATTCTT	3	3	yes
GATCCGAAGCTCATTCCAAG	370	29	yes
GATCCGAAAGGACAATCAGT	13	0	yes
GATCTGCAAGGCCTAATTAC	89	18	yes
GATCCGAGTAGTGGTTTGAT	5	5	yes
GATCTGCTTGGTGATACCAC	4	0	yes
GATCCCCACTTCGCTCTTGT	1	1	yes
GATCACGCTGCCCCCGACTC	1	1	yes
GATCCCTCTCTAAGCCCCTT	3	3	yes
GATCCTGTGCCCCCTCCCAA	89	9	yes
GATCACAGCTCCTGTGGCTG	5	3	yes
GATCTCTGGAAACCCAGAAA	2	2	yes
GATCTGCTTCCTGAAGAGTG	10	4	yes
GATCTGCTTCCCATTGTGGT	170	2	yes
GATCTGCTTCCCAACTGTTA	33	3	yes
GATCTGCTTCCATCCATCTC	62	6	yes
GATCCTCAGTCTTCCACAAT	1	1	yes
GATCTGCTTATCCCATTTAG	6	1	yes
GATCCTAGCTCAGAGAGGCT	119	0	yes
GATCTGCTGTTCCTCACGAA	16	3	yes
GATCTGCTGTGGCACAGGGC	127	2	yes
GATCTGCTGTCTACTACCTA	9	1	yes
GATCTGCTGGTCATTAAGGG	401	64	yes
GATCTGCTGGCAGTAGTAGT	125	2	yes
GATCTGCTGGAAGATAATCT	34	8	yes
GATCTGCTGCTAGGTATGTC	31	7	yes
GATCTGCTGCCTGCTCCCAC	44	13	yes
GATCTGCTGCCAGGTTTTGC	1	1	yes
GATCTGCTGCAGGGTTCTGT	349	23	yes
GATCTGCTGCAGCTAAAGTA	28	4	yes
GATCTGCTGATGTTACGTCG	70	15	yes
GATCTGCTGATGATGGAACA	29	4	yes
GATCTGCTCTTTTCGTGTTC	1	1	yes
GATCTGCTCTTGCTAATAAC	10	0	yes
GATCTGCTCTGTAGAAAGAA	22	7	yes
GATCTGCTCTGATGGTATGT	5	5	yes
GATCTCGTAGATGTTCAGAG	4	0	yes
GATCTCAATAACTTCAGCAC	4	4	yes
GATCTGCTCTCAAAAATTCC	3	3	yes
GATCTGCTCTAACCAGGCGT	17	5	yes
GATCTGCTCCTTCTGTCCCA	72	17	yes
GATCTGCTCCTTAACGTTTT	31	0	yes
GATCTGCTCCTGGAGGTGGT	5	1	yes
GATCTGCTCCTGAGTGCTGT	27	5	yes
GATCTGCTCCCAAGTTATCT	124	20	yes
GATCTGCTCCAACTACAGGA	6	2	yes
GATCTGCTCAGTGACTTGTG	48	4	yes
GATCTGCTCACTCTATTACT	22	4	yes
GATCTGCTCAACAACTCCTT	18	8	yes
GATCTGCTCAAAATCAAGAA	14	0	yes
GATCTGCTATGTACTCCAGG	92	18	yes
GATCTGCTAGAGCTGTAATA	1015	22	yes
GATCTGCTACTGGAGATGTT	35	1	yes
GATCTGCGTTCATGGCCAGC	3	3	yes
GATCTGCGTATGGCGGCCAT	2656	82	yes
GATCTGCGTACACCTGCGTC	414	263	yes
GATCTGCGGTGACTTGATGT	3144	60	yes
GATCTGCGCTATAGAAAAAA	7	1	yes
GATCTGCGCCTGCCTTGTCT	178	44	yes
GATCTGCGCCTGAGCCAAAG	62	8	yes
GATCTGCGAAGCCAGGCTTC	56	7	yes
GATCTGCCTTGGATTTCCTC	74	1	yes
GATCTGCCTGTTACCTCTTC	327	1	yes
GATCTGCCTGTCACTGTGGC	4	3	yes
GATCTGCCTGAACGTGTGTA	14	6	yes
GATCTGCCTCAGGAAAAATA	158	9	yes
GATCCTGTGCCACAGTGCTC	2	0	yes
GATCTGCCCTTTCTGGGTGA	333	13	yes
GATCTGCCCTTGCACCCGGC	53	0	yes
GATCTGCCCTTACATTCTTG	17	5	yes
GATCTGCCCGAAGCCATGAG	65	11	yes
GATCTGCCCCATGGTGTTTT	15	2	yes
GATCTGCCATTCCCATCTGT	16	7	yes
GATCTGCCATGGAGGAATCT	35	32	yes
GATCTGCCATGCTGGAAAAA	21	20	yes
GATCTGCCAGTTTTGGTGCC	158	5	yes
GATCTGCCAGTCCGAGGTTC	156	25	yes
GATCTGCCAGGACAAGCTGG	115	2	yes
GATCTGCCACTTGTTTTAAT	318	28	yes
GATCTGCCACTGCTTCTCTA	21	7	yes
GATCTGCCACAGCAAGAGTG	41	3	yes
GATCTGCCACACAGTAGACT	185	9	yes
GATCTGCCAATGGTGCCGTT	7	7	yes
GATCTGATTGTTCACTGCTA	15	2	yes
GATCTGATTGCCTTCATGGA	58	8	yes
GATCTGATTCCTTCTTTGGG	6	5	yes
GATCTGATGTGGTAATCAGC	5	4	yes
GATCTGATGTCCTTTTCCAG	12	11	yes
GATCTGATGTCCACTTCTGG	137	15	yes
GATCGGTCTGAGATGACTCA	20	12	yes
GATCAGTTCATCCACATAGA	14	13	yes
GATCTGATGTCAGTCGTGGT	11	2	yes
GATCTGATGTATGCCAAGCG	77	4	yes
GATCTGATGGTCCACTCTGC	7	0	yes
GATCTGATGGGTTTCTGGCT	80	7	yes
GATCTGATGCCTTCTGGTGT	128	31	yes
GATCTGATGCCCTTTTGTGG	14	13	yes
GATCTGATGCCCACTTCTGG	2	2	yes
GATCTGATGCCAGCCCCAAA	425	50	yes
GATCTGATGACTCCATATTT	25	3	yes
GATCTGATGAATAAAGGAGG	22	4	yes
GATCTGATAGTCAAGTGTAT	59	10	yes
GATCTCAAAACCAAAACCAC	149	23	yes
GATCTATTCTTGGTAAGGGG	3	1	yes
GATCGCCATGCTCCTCTTCT	19	6	yes
GATCGATACCGGCTGAAGCT	9	2	yes
GATCTATCGGCCTCTGCCTC	56	3	yes
GATCTATCCTAGCCGGGAGG	682	14	yes
GATCTATCCCAGAGTTCTAT	4	3	yes
GATCAGTCTCCATCAGACTT	10	3	yes
GATCTGAGTTCTGTGCCAGC	10	3	yes
GATCTGAGTGGGTGGGGGGT	208	23	yes
GATCTGAGTCCTCACACTGG	117	3	yes
GATCTGAGTCAGGAATAGTT	3	3	yes
GATCTGAGGTCCTGTTAGGG	10	9	yes
GATCTGAGGGTTGATTGACA	81	8	yes
GATCTGAGGGTGATTTCTCT	66	12	yes
GATCTGAGGGACTCTCCCTT	36	2	yes
GATCTGAGGCCTTGTTTTTT	350	49	yes
GATCTGAGGAGCAGATGATG	74	9	yes
GATCTGAGGACAGTTTTCAT	2	2	yes
GATCTGAGCTTTGTATAACA	11	1	yes
GATCTGAGCTGCCCTCTGCT	46	7	yes
GATCTGAGCTAAATGTCTAC	38	4	yes
GATCTGAGCCTCCACCTGTG	198	0	yes
GATCTACTGTGAAAAGCATG	16	1	yes
GATCTTTGGGAGGCCTGGAC	23	21	yes
GATCTTTGCCAAAATGTGTG	40	2	yes
GATCTTTGATTTTGCCCTGA	28	26	yes
GATCTTTGAGGTGCTAAGTT	58	16	yes
GATCTTTCTGATAACGCAGA	20	19	yes
GATCTTTCGGAGGAGATGTC	81	4	yes
GATCTATACAGTCGGGAAAC	212	19	yes
GATCTGAGCCCCACTGTTCC	4	4	yes
GATCTGAGCCCAGATGGAAG	27	10	yes
GATCTGAGCCACAAGTATAA	7	7	yes
GATCTGAGCATAGCGTCAGA	30	4	yes
GATCTGAGCAGGTGAAAAGT	112	1	yes
GATCTGAGCAGCAATGCGCT	2	2	yes
GATCTGAGCACAGCCAGCTA	3	1	yes
GATCTGAGAGGAAGGTGGCT	9	9	yes
GATCTGAGAGCCGTGGTGCC	205	17	yes
GATCTGAGAGAGGAAACCTT	16	5	yes
GATCTGAGAGAAGCTTGCCC	3	3	yes
GATCTGAGACCCTCCCTGAT	303	12	yes
GATCTGAGAAGATGTGGATG	38	6	yes
GATCTGAGAACAATGTAGAT	35	5	yes
GATCTGACTGTACCCTGCCG	6	6	yes
GATCTGACCTCGGAGTGTGC	40	10	yes
GATCTGACCCTCCAGACTTT	24	2	yes
GATCTGACCCCATGGCTTCC	30	28	yes
GATCTGACCAACAAGACCAC	77	2	yes
GATCTACCGTGCAGGGACTG	45	0	yes
GATCTCCACTGCGGGCACTG	1	1	yes
GATCTACCACCCTAACATCG	3	3	yes
GATCTTTCCAGAAGGTCTTC	123	84	yes
GATCTACACATGGGGCAACC	1096	55	yes
GATCTAGTGACTGAGGCACT	18	1	yes
GATCACTGACTGCCCCAAAC	71	5	yes
GATCTACAATGAAGCTCTGA	107	25	yes
GATCTAGCTTCCTGGGAGAC	7	1	yes
GATCTTTACAAGTCTGGCAC	88	15	yes
GATCTTGTTTGTGTCTCTGC	12	6	yes
GATCTTGTTGGCTGAAAGCA	7	6	yes
GATCCTGAACAACCTTCTAC	4	0	yes
GATCTGAATTTCTTCCTCTT	120	22	yes
GATCTGAATGTCCGAGAGAG	404	20	yes
GATCTGAATGGAAAAGCCAT	43	5	yes
GATCTGAATGCTGCCGAGTC	200	7	yes
GATCTGAATGCTGCAATGAA	50	5	yes
GATCTGAATGCTCTGGGGGC	80	20	yes
GATCTGAAGTTTGTCCAGGC	1	1	yes
GATCTGAAGTTCTGTGTTCA	110	9	yes
GATCTGAAGTCTGAATGGCA	37	6	yes
GATCTGAAGCTGCTGATGAA	158	10	yes
GATCTGAAGATTTCCCTATC	261	38	yes
GATCTGAACTGTCTAAAAGA	9	1	yes
GATCTGAACTCCAGAGAACA	215	4	yes
GATCTGAACCTGCCTGGAAA	3	1	yes
GATCTGAACACCCAGCGAGG	368	31	yes
GATCTCTTTTTTCAACCACC	3	3	yes
GATCTCTTTTGCCAAGAAGT	41	1	yes
GATCTCTTTGTGTTCAAGAC	24	12	yes
GATCTAATTGCAGTGGTTAA	42	10	yes
GATCTACGCACGCATCAGCA	87	13	yes
GATCTTGTGCCAGGTGGACT	3	3	yes
GATCTTGTCTCACCCTGAAT	23	5	yes
GATCTACCCTGACTCAGGTT	16	1	yes
GATCACTACAGTGAAGTATT	4	4	yes
GATCTTGTCCAGAGCTTCCT	11	12	yes
GATCTTGTATTCTCTGGCTT	9	0	yes
GATCTTGTACAAACCGGTTT	38	1	yes
GATCTTGGTTTTGAGTTCTT	10	3	yes
GATCTTGGTGGAGTGGGTCT	115	14	yes
GATCTTGGTGCAATAAAGTA	11	4	yes
GATCTTGGTCACAGAAAAAA	7	7	yes
GATCTCTTTGTCCTCCCAAT	10	3	yes
GATCTCTTTGCTTTGAAACT	55	4	yes
GATCTCTTTCTTGTTCCCCC	232	6	yes
GATCTCTTTCTGAGACCTTT	87	18	yes
GATCTCTTGTGAAACGAAAC	15	6	yes
GATCTCTTGAGTGTTTGAGG	3	3	yes
GATCTCTTGAATGACAGACA	21	20	yes
GATCTCTTCTCGCGCTCTCC	168	3	yes
GATCTCTTCCATGTTACAAG	8	3	yes
GATCTCTTCAGAAGGGCACT	8	2	yes
GATCTCTTCACTGTTTTTCT	35	5	yes
GATCCAAGAGAAAAACACTT	2	2	yes
GATCTTGGGGGAGAGAGGGA	81	4	yes
GATCTTGGGGAGTTTGACTG	36	4	yes
GATCTTGGGCTCTGCCATAG	25	3	yes
GATCTTGGCTCTGTGGAATG	80	14	yes
GATCTTGGAGGCTGAGTTGC	19	2	yes
GATCTTGCTTTGTGACTTTT	24	4	yes
GATCTCTGTGTTCAGGCTCT	60	13	yes
GATCTCTGTGTGTGTGTGTG	76	13	yes
GATCTCTGTGGGCCTTTGGG	37	1	yes
GATCTCTGTGCTTTCTTCCT	4	4	yes
GATCTCTGTGCTGGCGCCTG	80	10	yes
GATCTCTGTGCGCCTTCCTG	41	7	yes
GATCTCTGTGAGCCTAGGAG	14	1	yes
GATCTAACTCCTGTTGCTCT	46	20	yes
GATCTTGCTTCAGCCAACGC	64	12	yes
GATCGTGATTGTGCTGGGCG	461	280	yes
GATCTTGCTCTTCCTCTCTG	4	2	yes
GATCTTGCGTGTTCTGTCCG	20	6	yes
GATCTTGCCCCTGCCAGTGG	192	5	yes
GATCTAAAAGACCTGGGACT	20	2	yes
GATCACCTTTTTTGACGAGT	39	7	yes
GATCTTGCAGGACGTTCTCT	1	1	yes
GATCACGTCTATGACCGGCT	51	6	yes
GATCACTGCTGAGTGAGCGG	2	0	yes
GATCGTCTGCTGTGAAACGT	228	10	yes
GATCGTCCCCAAAATTGCCT	76	9	yes
GATCGTCAGTGCAGGAGCAT	4	3	yes
GATCGTACGGGGCTGGAAAC	149	2	yes
GATCACATGAGCCTCCAAAT	19	2	yes
GATCTTGACCTTATCCAGTC	35	5	yes
GATCTTGACAGGGAAGCCCT	5	5	yes
GATCGGTGGGACCCGGGCGA	676	7	yes
GATCGTGGGCTTCAGCACCC	71	22	yes
GATCTTGAAGTCTTTCTTGA	1	1	yes
GATCTTGAAAACCTGTCAGT	5	1	yes
GATCAAGACTTGTGCAGCAA	8	3	yes
GATCTTCTTGAGGTTTCCAT	3	3	yes
GATCTTCTGGTTCTCTTGCC	188	95	yes
GATCGGTCTGAGATGACTCC	150	13	yes
GATCACACTGAAGATGCCTC	118	13	yes
GATCGGCTTTGAGAGAGGGT	30	28	yes
GATCACCGGTTTCCGACTGA	88	7	yes
GATCGTCGCCCTTTGGGAAA	5	1	yes
GATCGGCCAGTTCCAAGTTT	103	11	yes
GATCTTCTCCCTGGGTTACT	29	0	yes
GATCTTCCTCTGCTAAAAAA	7	6	yes
GATCTTCGTCCCCGACCATC	2	0	yes
GATCTTCGAGGAGGGCGAGT	150	9	yes
GATCTTCGAGACTTTGTTAG	75	6	yes
GATCTGACTGCCAAATAAAT	15	16	yes
GATCTGTGCTAATTCAAGCA	21	1	yes
GATCAGTTGACAGTGGCAAT	294	30	yes
GATCTATCACCTGTCAACAT	27	29	yes
GATCACCAGCCTTTTGCAAA	56	17	yes
GATCGGCGGGAAATGGCGGA	139	9	yes
GATCGGCGCCGTGAGATTCG	72	10	yes
GATCTTCCCAGTTATGGCCA	19	18	yes
GATCTTTGAAGAGCAGGGAA	107	3	yes
GATCAGTGACTAAGTGCAGA	4	4	yes
GATCGCTCATTGGAACAGCT	3052	83	yes
GATCTTCCCAACAGTGCTGC	4	4	yes
GATCGCCCTTGCTGGTCTGC	174	13	yes
GATCTTCCAGATTGTGTGCA	2	2	yes
GATCTTCCAAGTCTCTCATT	24	4	yes
GATCTTCAGTAGTCTCTCCT	32	2	yes
GATCTGAAGCAATGTGACTG	46	5	yes
GATCAACTGGGCCATGGAAG	12	1	yes
GATCTTTCCTGCCTGTGTCT	6	6	yes
GATCTTCAGCCTCTTGGGGA	9	1	yes
GATCTTCACTCACGTCCGGC	50	10	yes
GATCGCCTGGAGAAATGAGC	78	10	yes
GATCTTCACCTCTTCTTCCG	77	13	yes
GATCTGGCACCACACCTTCT	1	1	yes
GATCTTCACCCTATCCAGTC	3	3	yes
GATCTTCACCATTGAGTATT	19	1	yes
GATCTTCACAGTGCATGGCT	80	0	yes
GATCGCCGCCTGAATGTGTG	1	1	yes
GATCTTCAATGGACACATTG	425	8	yes
GATCTTCAAGTGAACAAGTG	6	5	yes
GATCAGCCTCCCCACCCGGC	1	1	yes
GATCCTCCAGCCTGAGTGCC	4	0	yes
GATCTGTTGGTGCTGCTACT	6	5	yes
GATCAAAAGGGACTCGTGTA	32	5	yes
GATCAAAACTCAATATTGCA	16	3	yes
GATCTCTTTTCAGAAGTGTC	52	3	yes
GATCACTGTCTCTCTTCCTC	6	3	yes
GATCTGTTGCTCCAAGACCC	22	2	yes
GATCAATGTGGGGGGTCACA	16	15	yes
GATCTGAGCCGGTCGAGCCC	17	6	yes
GATCACTGGAGAGCCTCATG	5	5	yes
GATCAGGGATGCAGTACCAC	149	10	yes
GATCAAAGGTGGGATTTGTA	4	3	yes
GATCCCCAGAACCCACAAAA	50	12	yes
GATCTTGGTCACTTTCCTGC	5	5	yes
GATCATGTTCACAACGCAGG	34	2	yes
GATCTCTGTGCTGTAAACTA	59	11	yes
GATCTCAGGAGCACCGGGGC	1	1	yes
GATCCCTTTTCCATTCTGGA	40	8	yes
GATCCCTTTGGGGTGTGGAA	772	13	yes
GATCTACAGGAGTGGTGATA	33	3	yes
GATCCCTTTCTCTGGCCCAG	599	40	yes
GATCCCTTTCCACCTAAAAC	53	2	yes
GATCCCTTGTGAGCCCTAGT	223	14	yes
GATCCCTTGTAGCCAGAGTT	334	25	yes
GATCCCTTGGGCAAGTATCA	32	2	yes
GATCCCTTGCTTGCCTCTTG	261	16	yes
GATCCCTTGCTTCAACCTCC	15	0	yes
GATCCCTTGCTACATCTCCT	133	26	yes
GATCCCTTGCCTCCTGAGTT	55	4	yes
GATCCCAGCCCCTCTGTTAA	1	1	yes
GATCCCTTGCAGTTCTGTGC	92	2	yes
GATCCCTTGCACACAGCCCA	287	33	yes
GATCCCTTCTTTTTTGGCAT	88	21	yes
GATCCCTTCTGCTCTACCTC	65	9	yes
GATCCCTTCCTTTGAAGTGA	199	3	yes
GATCCCTTCCTGCCCTCTTT	473	41	yes
GATCCCTTCCCCAGCGGTTC	129	14	yes
GATCCCTTCCAGCTGAGCCC	145	7	yes
GATCCCTTCCAAATCTGCTC	54	8	yes
GATCCCTTCATTGGGGACCC	28	6	yes
GATCCCTTAGGTGTAGGTCC	96	5	yes
GATCCCTTACTGTTGTGTCT	3	1	yes
GATCCCTGTTCCCCTGAGAA	63	2	yes
GATCCCTGTTCATTACTATC	3	3	yes
GATCCCTGTGTTCTACATGG	165	17	yes
GATCCCTGTGGTCACTTAGC	95	14	yes
GATCCCTGTGGATTTTGAAA	56	7	yes
GATCCCTGTGAGTTCAAGGC	191	22	yes
GATCCCTGTCTGATTTCTGA	6	0	yes
GATCCCTGTCTCGGGAGGTC	21	1	yes
GATCCCTGTCTAGTCCCTGT	19	1	yes
GATCCCTGTCCTTTCTGTTT	66	5	yes
GATCTTGCGAGGGAAGGCGA	40	0	yes
GATCATGGGTTGGGAGCTCA	100	5	yes
GATCATGGGCAAAAAGCCCG	55	1	yes
GATCCACTCGATATGCAATG	3	3	yes
GATCAGGAGCTGGAGAGGAA	229	18	yes
GATCCCTGTACACTATGTCT	4	2	yes
GATCCCTGGTTGCATCTTCG	39	11	yes
GATCCCTGGTGTGCTTTACC	4	0	yes
GATCCCTGGTGGCTGCCCTT	456	19	yes
GATCCCTGGGTGCCAGTTTT	98	16	yes
GATCCCTGGGTCTCCTTTGA	19	17	yes
GATCCCTGGGGTCCACTTTC	9	2	yes
GATCCCTGGGGGCTGTGATG	157	2	yes
GATCCCTGGGGCTGCCTGTC	926	15	yes
GATCCCTGGGGCATGTTGTA	99	11	yes
GATCCCTGGGGAGCCTGCGG	30	6	yes
GATCCCTGGGAGGATATGAG	38	3	yes
GATCCCTGGGAACGAAGCTG	4	0	yes
GATCCCTGGCTCAGTGAACA	41	3	yes
GATCCCTGGCGTCCCTATCA	115	15	yes
GATCCCTGGCCCCTGTGCCA	68	5	yes
GATCCCTGGCCAGAAGTACA	65	2	yes
GATCCCTGGCACTGCTGCCT	95	24	yes
GATCCCTGGCACCCAGCATC	117	6	yes
GATCCCTGGAGTGACCAGAG	1198	84	yes
GATCCCTGGAGTCTCTGAAG	29	2	yes
GATCCCTGGAGGCTGGAGAG	6	6	yes
GATCCCTGGACTGGAACAAA	3	3	yes
GATCCCTGGAAGCTGTGATG	26	4	yes
GATCCCTGGAAGCAGGGACA	745	15	yes
GATCCCTGGAACAGAGTTAT	2	2	yes
GATCCCTGCTTTTGTGGCCT	1113	82	yes
GATCCCTGCTTCCTGCCCAG	215	3	yes
GATCCCTGCTGTTGGCAATA	41	11	yes
GATCCCTGCTCTTAGGTGCT	172	31	yes
GATCCCTGCTCTGGACCCTC	325	6	yes
GATCCCTGCTCCCCTCTGGG	103	0	yes
GATCCCTGCTCCAGGTCCTC	75	13	yes
GATCCCTGCTAATGGAAGAA	24	2	yes
GATCCCTGCTAAAACCATGT	1	1	yes
GATCCCTGCCTGTGGGGGGT	420	16	yes
GATCCCTGCCTGTCCTGAAA	5	1	yes
GATCCCTGCCTCGTCTGCCT	128	1	yes
GATCCCTGCCGAGGTGCTCA	178	10	yes
GATCCCAGGGACTCTGTTTT	6	6	yes
GATCATGGCTTTGAGGCCAG	27	10	yes
GATCATGGCGGTCAGCAGAA	6	7	yes
GATCATGGCCGACACCAGTG	8	2	yes
GATCATGGCAGGGATACGCA	39	0	yes
GATCATGGCAGGCCTTTAAC	85	7	yes
GATCTTGATGCGGGTGGAAC	600	39	yes
GATCCCAGAGTGCTTGATGC	11	1	yes
GATCCCTGCCCTTTGGCCTG	28	0	yes
GATCCCTGCCCATGCTGTTC	39	10	yes
GATCCCTGCCACCTCATTGG	86	10	yes
GATCCCTGCATTTCCTCAAG	130	19	yes
GATCCCTGCATAGGACTGTT	21	1	yes
GATCCCTGCAGTACCATCTG	255	14	yes
GATCCCTGCAGGTCGCTCAG	152	48	yes
GATCCCTGCAGCTGGGCGAG	25	3	yes
GATCCCTGCAGCGCTGTTTG	312	12	yes
GATCCCTGCAGAGGCTTCCA	13	5	yes
GATCCCTGCAGAAGGGGGGT	42	3	yes
GATCCCTGCACAAGGTGTTT	99	6	yes
GATCCCTGCAACAGCAAGGG	77	17	yes
GATCCCTGAGTTTACCAGCG	56	11	yes
GATCCCTGAGTTCAAGGCTA	110	31	yes
GATCCCTGAGTTCAAGGCCA	55	20	yes
GATCCCTGAGTAAACTTCTT	64	12	yes
GATCCCTGAGGTCTCCTGCC	147	11	yes
GATCCCTGACATAGCAGGAC	18	0	yes
GATCCCTCTTCTGGTGTGTC	139	13	yes
GATCCCTCTTACCTGCAACG	709	42	yes
GATCCCTCTGTACAGCATCC	9	10	yes
GATCCCTCTGGTGACTCCAC	64	12	yes
GATCCCTCTGGGTCATGTCT	174	39	yes
GATCCCTCTCTTTTCCTTCT	125	1	yes
GATCCCTCTCTTCAATGATG	79	11	yes
GATCCCTCTCTCTGGGGAAT	50	9	yes
GATCCCTCTAAGCCCCCTCC	103	5	yes
GATCTTCTGACTGTGGAAAC	43	12	yes
GATCCCACTTCTGCGTCTTA	20	2	yes
GATCCCACCTGTAACTGAGG	6	2	yes
GATCCCTCGGTGACCACATT	537	84	yes
GATCCCTCGACGGCCAAGCC	217	45	yes
GATCCCTCCTTGTGAGCAGC	209	15	yes
GATCCCTCCTGGGCATTGCT	54	7	yes
GATCCCTCCTCAGGCATCTG	935	60	yes
GATCCCTCCCTTGGGCCTCC	169	23	yes
GATCCCTCCCTCCGAGGCCA	79	9	yes
GATCCCTCCCCTCCCTGGCT	19	5	yes
GATCCCTCCCAGAAACCTGC	6007	4	yes
GATCCCTCCCACTCTGGCTC	10	1	yes
GATCCCTCCAGCCTCTACTG	37	1	yes
GATCCCTCCAGACACCAAGG	122	36	yes
GATCCCTCCACAAGATTCTG	32	5	yes
GATCCCTCAGGGTGTGTGCC	27	2	yes
GATCCCTCAGGAACAGAGGG	1454	10	yes
GATCCCTCACCTCCTTCATC	130	8	yes
GATCCCTATGCTGACCCCAA	297	22	yes
GATCCCTATGAAGTGTCTTA	43	6	yes
GATCCCTAGTGGCCCATCAT	64	8	yes
GATCCCTAGGGAGAAGGTGG	144	5	yes
GATCCCTAGGCAATTAAGTA	5	4	yes
GATCCCTAGCCCCATCCCAA	3	3	yes
GATCCCTAGCATTCTGTACT	317	50	yes
GATCCCTAGAGCCAGCACAT	92	1	yes
GATCCCTACTGCACCACCTT	153	34	yes
GATCCCTACTATTGATTCTG	95	5	yes
GATCCCTACTACGTGCTGGA	1303	136	yes
GATCCCTACCTACAACCCTA	234	61	yes
GATCCCTACCCCACATGCTG	62	11	yes
GATCCCTACCCATGGGAATG	86	12	yes
GATCATGAGAAAGCTCAGGT	5	5	yes
GATCCCAATCTGGACCCGCT	18	3	yes
GATCTTCGGTGCCACCGGCA	113	2	yes
GATCATGACATTGTAGCCAG	12	0	yes
GATCATGACAGTCCCCCCAC	26	2	yes
GATCCCAAGTGGCACTGTTT	5	4	yes
GATCCCTACCCATGGACCCT	223	29	yes
GATCATAGCAGATGCAGGGG	1	1	yes
GATCCCTAATGAGAGCAGAG	46	2	yes
GATCCCTAAAGGGTGTGCTA	11	3	yes
GATCCCTAAACTACCTCTTG	117	6	yes
GATCCCGTGTGACACATTTT	13	1	yes
GATCCCGTGTCCCATAGTTG	2	2	yes
GATCTGTGCAGGGTATTAAA	4	3	yes
GATCCCGTGGCTTGTGGAAG	4	3	yes
GATCCCGTGGACTGTTTGCT	28	2	yes
GATCCCGTCCAAGGAGCATC	424	38	yes
GATCCCGCGAGGCCCGGAAG	1506	59	yes
GATCCCGCCTGCCCAGCTGA	311	11	yes
GATCCCGCCGTTCCACCCTC	69	1	yes
GATCCCGCCCACCCAAAGCT	47	4	yes
GATCCCGCCAAAAGAATTAC	284	28	yes
GATCCCGCACATCCACAAGT	111	8	yes
GATCCCGAGATTGCCAGCCT	746	46	yes
GATCATCTGCTAGGGTGTGG	9	3	yes
GATCCACAAACTTCCTGACA	20	4	yes
GATCCTGAGAACTTCAGGCT	32	15	yes
GATCCCGACACCAAGGAGAT	2465	146	yes
GATCCCGAATAAATGAGTGT	28	5	yes
GATCCCCTTTTTGAACAGGT	87	0	yes
GATCCCCTTTCTTTACCTTC	38	0	yes
GATCCCCTTTACCTTCTGGG	589	44	yes
GATCCCCTTGGTTGCTGGAT	191	17	yes
GATCCCCTTCTCAGGGTCTA	158	9	yes
GATCCCCTTCCTACCTCTAG	137	28	yes
GATCCCCTTAGCTGATGAAT	2	2	yes
GATCCCCTGTTGACTTACAA	48	2	yes
GATCCCCTGTATATGTTGAA	20	2	yes
GATCCCCTGGGTTGAGAGAT	21	8	yes
GATCCCCTGGGGCAAGCTGC	316	2	yes
GATCCCCTGGGAGGAGACAG	387	55	yes
GATCCCCTGGATACATGGTC	19	1	yes
GATCCCCTGGATAAAAGCGT	62	5	yes
GATCCCCTGCTACACTGATG	22	0	yes
GATCCCCTGCTAATGAAAAT	6	2	yes
GATCCCCTGCCTCCACCTCC	15	16	yes
GATCCCCTGCCTCAGCTCCT	187	55	yes
GATCCCCTGAGATGGAATTA	5	1	yes
GATCCCCTCTTCCCAAATAA	168	3	yes
GATCCCCTCTGTGGGTATGA	39	7	yes
GATCCCCTCTGGGCCTCCGA	14	0	yes
GATCCCCTCTCCTGCCCACA	16	2	yes
GATCCCCTCGGACCCCCTTG	451	13	yes
GATCCCCTCCTTTCTGCCTG	11	3	yes
GATCCCCTCCTCCAGGCAGT	89	17	yes
GATCCCCTCCCTTGCTTTCT	75	11	yes
GATCCCCTCCCTCTGATTTT	50	4	yes
GATCCCCTCCCACAGAATAG	3280	198	yes
GATCCCCTCACATGTGCTAT	235	18	yes
GATCCCCTATGGGGAGGAGG	240	23	yes
GATCCCCTATGCAAGCTGTG	35	1	yes
GATCCCCGTTGTACCTGGTG	45	10	yes
GATCCCCGTGTGTTTGCAGG	206	4	yes
GATCCCCGTGCCCCTGCCTA	500	41	yes
GATCTTTCTCTAGGGGGTCC	17	4	yes
GATCATCCCCTGGCAAAGGC	3	1	yes
GATCTTCACTGCAGATGTGG	13	5	yes
GATCATCACGTACAGGAACC	15	1	yes
GATCAAACTGAATGAAACAC	13	14	yes
GATCCCCGTCTGTGTCTGTG	707	96	yes
GATCCCCGGTGCTCTTCGTG	1123	56	yes
GATCCCCGGGAAAGTGTAGT	6	5	yes
GATCCCCGCAGAATCAGGAA	314	34	yes
GATCCCCGCAAAGTGAGCGA	40	11	yes
GATCCCCCTTTGCTGCCTCC	1	1	yes
GATCCCCCTGATGGAGAGAA	1	1	yes
GATCCCCCTCCCTGCTCTCA	8	7	yes
GATCCCCCTCCCCCGCTGGC	95	9	yes
GATCCCCCTCCCCCCAGTGG	2018	228	yes
GATCCCCCCCTTTTTTTGTC	30	1	yes
GATCCCCCCCAGCACACTCT	28	10	yes
GATCCCCCCACCCCACCACC	891	106	yes
GATCCCCCCAACTGTGTGCC	70	13	yes
GATCTTGTTGGCCCATCTAT	48	13	yes
GATCCCCCAGGTCTCAGAGG	208	22	yes
GATCCCCCAGGGAAAGACTT	21	7	yes
GATCCCCCACCTCCTCGGCC	6	6	yes
GATCCCCCACCCCCACCCCC	46	50	yes
GATCCCCCACATCCTGGGGC	126	7	yes
GATCCCCATTTGCAGTAAGA	85	2	yes
GATCATCACCTGACCCACTT	1	1	yes
GATCTTCAAGCCGTGGAAAT	1	1	yes
GATCCATCCACCTTCAATGT	9	5	yes
GATCCCCATGTTGAGCTCTG	204	35	yes
GATCCCCATCTGCAGTACAA	18	7	yes
GATCCCCAGTTGTGTCAATG	8	3	yes
GATCTCACGTCTCCTTCCTC	3	3	yes
GATCCCCAGTCTTTAGTCCC	428	25	yes
GATCCCCAGTATGCAGTAAT	51	11	yes
GATCCCCAGGTCCCCTTCAA	9	4	yes
GATCCCCAGGGGCTCCCGGT	173	12	yes
GATCCCCAGGGAGGGAATGT	20	5	yes
GATCCCCAGGAGATGAGGTC	36	0	yes
GATCCCCAGCTCCTTTCAAA	11	1	yes
GATCCCCAGCCTTGGATAGT	178	16	yes
GATCCCCAGCCCAATCTTTC	17	5	yes
GATCCCCAGCATTAGGCCAT	64	10	yes
GATCCCCAGCAGTAACACTT	71	13	yes
GATCCCCAGCACAGGAAGGC	101	7	yes
GATCCCCAGAGTCCCCTGTG	186	22	yes
GATCCCCAGAGCCTTGGGGA	86	3	yes
GATCCCCAGAATCCCCAATA	46	6	yes
GATCCCCACTTCTGTGACTT	17	15	yes
GATCCCCACTGTGCCTTTTT	196	22	yes
GATCCCCACCAGCCACCCCC	382	5	yes
GATCCCCACAGGTGTAGTCT	4	0	yes
GATCCCCACAGCTGCGTATG	342	25	yes
GATCCCCAAGTCTGTGACAC	154	2	yes
GATCCCCAAGAGTCCCCCAA	5	4	yes
GATCCAAACATTCCAAGAAA	9	1	yes
GATCCCCAACAATGTGAAGA	546	45	yes
GATCCCCAAAGGGCAGGTCC	46	2	yes
GATCCCCAAAGCCTGGAGCC	399	15	yes
GATCCAGTGTGGGGCAGCGC	6	7	yes
GATCATAAGTTCAAGGTCTT	72	7	yes
GATCATAAGAGGCACGTGAT	12	11	yes
GATCAGTTTGTGCCCAACAG	7	7	yes
GATCAAAACAAGACCCAGCT	15	16	yes
GATCCCCAAAAGGGTTAAAA	44	11	yes
GATCCCATTTTTGACAGCAA	133	13	yes
GATCCCATTTCAGAGTATGC	18	4	yes
GATCCCATTTCACAGGTGTA	5	1	yes
GATCCCATTGGAGCTCTGTT	31	8	yes
GATCCCATTACTTAAGTCCT	18	0	yes
GATCCCATGTTCAAGCTGGT	264	24	yes
GATCCCATGTGTTTAGTAAT	9	6	yes
GATCCCATGTGTCTTTTTGC	44	2	yes
GATCCCATGTGTCTCCCCCA	141	28	yes
GATCCCATGTGCCACCATCA	79	13	yes
GATCCCATGTCCTGCTTTCT	30	5	yes
GATCCCATGTCCTGCTAAAA	11	3	yes
GATCCCATGCTTTGAAAAAT	51	1	yes
GATCCCATGCTAGCCTCTTG	279	10	yes
GATCCCATGCCTGGAATTTG	41	2	yes
GATCCCATGCAGAGCGGCCT	290	48	yes
GATCCCATGATGGAAATATT	37	3	yes
GATCCCATGAATCATTTGCC	130	0	yes
GATCCCATGAAATCCCCAAA	62	5	yes
GATCCCATCTTCAGAGCTTA	48	0	yes
GATCCCATCTCCTGGAAGGA	167	2	yes
GATCCCATCTCAAAAGAGAT	20	4	yes
GATCAGGGCAAGAGTGTGCG	6	2	yes
GATCCCATATCCCTGTGAAA	70	10	yes
GATCCCATACCTGACATGAC	97	3	yes
GATCCCATACAATGCCGCCC	63	11	yes
GATCCCAGTTTGCTTCATGA	19	1	yes
GATCCAGTCACACCCCACCC	22	15	yes
GATCAGTTACTTACCCACTC	21	3	yes
GATCCAAACTTCTACAGCAA	42	4	yes
GATCCAGGTGCTATGTCTCG	3	3	yes
GATCAGTGGGTGCCCGTGAT	26	6	yes
GATCCAGGGGGTGTGGCTGC	3	3	yes
GATCAAGGCCACGGGGAGGA	118	26	yes
GATCCCAGTTCATAATGAAC	15	3	yes
GATCCCAGTTCAAGAGGGGT	22	9	yes
GATCCCAGTGTTGCTACGTG	55	8	yes
GATCCCAGTGTGAATCATGG	129	19	yes
GATCCCAGTGGTATTCCGCC	128	20	yes
GATCCCAGTGGATGAAGTGT	33	8	yes
GATCCCAGTGCTGTGGAAGT	68	23	yes
GATCCCAGTGCTGGTCAGTT	293	15	yes
GATCCCAGTGAGATGCTGGT	18	1	yes
GATCCCAGTGAAGGGTTTCT	92	9	yes
GATCCCAGTCTGAGTGATTA	705	68	yes
GATCCCAGTCCGAAATGGGG	63	9	yes
GATCCCAGTACTTGGGAGGC	10	9	yes
GATCCCAGTAATGTAAACAA	24	2	yes
GATCCCAGGTGTCCCCATTT	131	1	yes
GATCCCAGGTGGAGCAACCC	165	12	yes
GATCCCAGGTCCCTCTGGGA	82	15	yes
GATCCCAGGGTTTTCTTGGT	10	1	yes
GATCCCAGGGGTCCTAGGGG	202	7	yes
GATCCCAGGGGCTCTTCTGC	305	5	yes
GATCCCAGGGAAAGTGCTAT	605	13	yes
GATCCCAGGCTCCACCAGCG	4	3	yes
GATCCCAGGCTAGCAAGCAA	404	6	yes
GATCCCAGGCGTCAAGCTCG	134	3	yes
GATCCCAGGCAAGGGATGGT	123	4	yes
GATCCCAGGAGTCAAGCTCT	112	8	yes
GATCCCAGGAGAGAGGCTTC	83	9	yes
GATCCCAGGAATATAAAAAG	50	10	yes
GATCCCAGGAAGGACCATCA	73	6	yes
GATCCCAGGAAAGTTCTAAT	312	8	yes
GATCCCAGCTATGATGTAGC	42	2	yes
GATCCCAGCCCTGGCTCCCC	5	1	yes
GATCCCAGCATTTGGGAGGC	13	5	yes
GATCTTACAGAGCAGCAGAA	8	1	yes
GATCCTCTTTGACTTCACGT	10	1	yes
GATCCTACTATGAGCAAAAA	34	6	yes
GATCCTAGAAGGACAGCTTT	5	5	yes
GATCTCTGTCTTTCCCTGGT	176	11	yes
GATCTCTGTCATCCCCCACG	5	2	yes
GATCTCTGTCACATCCGATG	684	32	yes
GATCTCTGTAAGTTCTAGTC	2	2	yes
GATCTCTGTAAACAGTTTGG	4	4	yes
GATCCTGAGCACCATGGCTG	4	0	yes
GATCAAGCCTCACCTGCAGC	17	6	yes
GATCTCTGGTTGCTTTCAAG	24	22	yes
GATCTCTGGGGCAGACGGTG	1	1	yes
GATCTCTGGGCAGTCATGGT	118	15	yes
GATCTCTGGCTCTTCATCCT	144	6	yes
GATCTCTGGCCTGTGGAGTA	149	13	yes
GATCTCTGGCCAGGCAAGTT	3	3	yes
GATCTCTGGATGGAAATGTA	52	3	yes
GATCTCTGGAGGTCCCGGTG	114	11	yes
GATCTCTGGAGCCTGAATTC	5	4	yes
GATCTCTGGAAGGTGAGCCT	245	29	yes
GATCTCTGGAAAATTGCCAT	327	25	yes
GATCTCTGCTGTGGGAAAGG	2046	142	yes
GATCTCTGCTGTCGGTTTCT	57	16	yes
GATCTCTGCCCCAAATCCAA	14	4	yes
GATCTCTGCCCAAACCAGGC	840	31	yes
GATCTCTGCCACCCACCCAC	24	2	yes
GATCTCTGCAGCTGGAGTCT	220	29	yes
GATCTTCGTGACGGACAAGG	1	1	yes
GATCACACCCTTCAACCTGC	2	2	yes
GATCTCTGCAAGCAGTTGTC	78	7	yes
GATCTCTGCAAAATAGACTT	112	5	yes
GATCTCTGATGGCTGGGGAG	155	4	yes
GATCAAAAGGTAAAGGCCAG	68	6	yes
GATCAAAAGGAGTATCAAAG	3	1	yes
GATCTCTGAGGAGGTGGCTC	74	66	yes
GATCTCTGAGCGTGTGGGTC	7	7	yes
GATCTCTGACTGTGACCTTC	6	0	yes
GATCTCTGAAGAAAAGCAGA	2	2	yes
GATCTCTCTTGTTGGAAGGA	74	1	yes
GATCTCTCTTCCCAGAGGAA	1594	50	yes
GATCTCTCTTACATACTGTT	11	2	yes
GATCTCTCTGGAACTATCTA	105	21	yes
GATCTCTCTGCTCATACCCT	86	3	yes
GATCTCTCTCCTTGGCCTTC	31	8	yes
GATCTCTCTCCTGAGCACTA	24	4	yes
GATCTCTCTCATTCAACTTT	25	3	yes
GATCTCTCTCATCGAGAGCA	18	6	yes
GATCTCTCGTGTGCCTTTGG	28	11	yes
GATCTCTCGGATGTAAATGT	13	0	yes
GATCTCTCGAGCAGCAGCAG	50	25	yes
GATCTCTCCCGTTCTCAGCA	14	5	yes
GATCTCTCCCCAGAGCAACG	18	17	yes
GATCTCTCCATATCAAGCGA	3303	26	yes
GATCTCTCCATATCAAGCAA	25	27	yes
GATCTCTCCAAGCTCACAAG	6	5	yes
GATCTCTCATTCCCAAGTAA	4	4	yes
GATCTCTCAGGCCAGGATTT	31	4	yes
GATCTCTCACTGGACCAGCG	59	10	yes
GATCTCTCAAATCTTGGATT	29	0	yes
GATCTCTATCCTAACGTCCA	81	3	yes
GATCTCTATCACCGCAGGAA	10	9	yes
GATCAAGATAACGGTGGCTT	54	5	yes
GATCTCTAGAAAAGTCGTTT	8	1	yes
GATCTCTACTTTGGAGTCCT	4	0	yes
GATCTCTACTGGCAGGCCAT	117	24	yes
GATCTCTACTGCTGTTAGGT	34	8	yes
GATCTCTACTCCCAGGAGAT	79	7	yes
GATCTCTACCCTTCATGATT	39	3	yes
GATCTCTACCCAACTGTCCA	48	10	yes
GATCTCTACCATTTGATTAA	65	7	yes
GATCACGTGTACTATTTCCT	3	3	yes
GATCTCTACCACCCAGGTAG	218	23	yes
GATCTCTACAGACAAAATCT	6	7	yes
GATCTCGTTCATTGGCAAAA	61	7	yes
GATCTCGTTCAAAAAAAAAA	35	5	yes
GATCTCGTGCAACTGTTGTC	372	20	yes
GATCTCGGTTTCGTTTCGCT	55	0	yes
GATCTCGGTGTCATCAGAGG	42	12	yes
GATCTCGGTCTGTGCCGGGG	228	14	yes
GATCTCGGGTGCGTGGCTGG	63	1	yes
GATCTCGGCCTCACAAATCC	20	4	yes
GATCTCGGAGTCCTGGCCCC	244	30	yes
GATCTCGGAGAGAGGAGCTT	109	101	yes
GATCTCCTTTGTGAATGGTG	4	0	yes
GATCTCCTTTGGCAGACACT	6	4	yes
GATCTCCTTTCCGGAAGCAA	686	68	yes
GATCTCCTTGGGGAGGTGGG	10	9	yes
GATCTCCTTGGCATGAGGGG	11	10	yes
GATCCATGAGAATGAGAAGC	17	0	yes
GATCTCCTTGGAGTCTCAAG	1491	271	yes
GATCTCCTTACTTAGCATCC	22	24	yes
GATCTCCTGTTGTCTGGGCT	27	7	yes
GATCTCCTGTGAACACCACA	9	1	yes
GATCTCCTGTCTGAGGTGTC	3	3	yes
GATCTCCTGTCTATGTGGGC	119	4	yes
GATCCACATTTGCTGGTTGG	4	4	yes
GATCTCCTGGTCAGGAAGAA	54	3	yes
GATCTCCTGGGCTGTTTCTC	5	4	yes
GATCTCCTGGAAGCTAGCAG	33	14	yes
GATCTCCTCTTCGGGGTTCT	26	0	yes
GATCTCCTCGCTGGAAAAAG	6	0	yes
GATCTCCTCCTTGCTTTCCT	68	18	yes
GATCTCCTCCTTATTCCCCA	436	60	yes
GATCTCCTCAGAGAAGTCTG	31	5	yes
GATCTCCTCAACCAGTGTGT	3	3	yes
GATCTCCTAGGAGTGGAGTT	7	7	yes
GATCTCCGTCTCATTCTTTC	16	3	yes
GATCTCCGTCCCTCAGCTCC	558	81	yes
GATCTCCGCGGCCCGAGTGC	3	1	yes
GATCTCCGCCTGGCACCCAG	43	2	yes
GATCGCAGAGAGGCGAGAGC	205	42	yes
GATCTTACTTAGCATGCACA	22	2	yes
GATCTGTGCATGGCATTTTT	3	1	yes
GATCTCCGCACTGTGTGTAC	189	40	yes
GATCTCCGACGAAATGGAAG	3	3	yes
GATCTCCCTTTGTACTGTCT	27	3	yes
GATCTCCCTGTTCTGGACTC	2	2	yes
GATCTCCCTGCCCCTGAGCC	87	12	yes
GATCTCCCTCGTGCAGTGGC	78	5	yes
GATCTCCCGTGTTACCAATG	160	11	yes
GATCTCCCCTTTGTAGGACT	20	0	yes
GATCTCCCCTGGACCAAAGG	41	23	yes
GATCTCCCCCACCCCAGCAG	2	2	yes
GATCTCCCAGGACGTTGAGA	4	3	yes
GATCTCCATTCTATGTGTAA	16	3	yes
GATCCTTTCCTCCGAATAAA	36	10	yes
GATCCTTTCAACTCAAAAGC	36	6	yes
GATCTTATTGGACAGTATTG	6	6	yes
GATCTTATTGCCAAGTTCCT	49	8	yes
GATCTGGGTCTATAAACTCT	27	7	yes
GATCTTATCTTGCCAGGCCG	11	1	yes
GATCTTAGGCAAGTTCTTGG	9	8	yes
GATCTTAGCAGTCGTTCTTT	5	5	yes
GATCGCATACATCATGACTG	3	3	yes
GATCTTAGAGAAAGGCCAAC	280	11	yes
GATCTTAGACAGGCGATGTG	13	4	yes
GATCGCAGCACTGAAAACAA	3	1	yes
GATCTTACTCGATAGGACAT	10	3	yes
GATCCCTCAGGAACAGGCTG	8	9	yes
GATCTCCATGCGAACCCTGG	8	8	yes
GATCTCCATCTTCCAAATAC	16	5	yes
GATCTCCATCGTGCAGGGAT	84	1	yes
GATCTCCAGTCCAAGGCTTC	39	1	yes
GATCTCCAGGGACATCAGAA	3	1	yes
GATCTCCAGCTTCTCTGCCT	15	3	yes
GATCTCCAGCACAGCAGAGG	171	11	yes
GATCTCCAGAGTCGCTTGGA	12	2	yes
GATCTCCAGAGGAACACCAG	28	26	yes
GATCTCCAGAATAGACCTGG	8	0	yes
GATCTCCACTTTCTACAACA	99	5	yes
GATCTCCACTCTCCCTCTGG	18	2	yes
GATCTCCACGGGTGCTTAGT	44	7	yes
GATCTCCACCACCGAGGACA	4	4	yes
GATCTCCACATCTCCAAGGA	59	4	yes
GATCTCCACAGGCCAGCCTT	79	19	yes
GATCTCCACACAACAGGTGA	192	31	yes
GATCTCCAATGTTGTGCTAA	64	3	yes
GATCTCCAACTTTGAAAGGC	22	2	yes
GATCACAGCCCTGTCGCAGG	2	2	yes
GATCACAGCCAGTTCAAAGC	15	1	yes
GATCACAGCAGTAAATGTGA	85	18	yes
GATCACAGCAGCTGAGCTGT	615	60	yes
GATCACAGATTTAAGGGGAG	24	2	yes
GATCACAGATTGCTTCTCTG	34	2	yes
GATCACAGAGGTAGGAACTG	4	3	yes
GATCACAGAGGGACACACTA	11	6	yes
GATCACAGAGAACACAGAGG	53	8	yes
GATCACAGACTTCGGCCTTG	2	0	yes
GATCACAGACTGTTGGCCCC	4	3	yes
GATCACAGACACCTGCACTG	69	10	yes
GATCACAGAAGTGAGCGGAT	58	7	yes
GATCCTTCTGCAGACACCGA	14	13	yes
GATCCTTCTGACTTGGCTTT	13	4	yes
GATCCTTCTCAGAAGAGTCT	63	5	yes
GATCACAGAAACAATAAAAG	1592	153	yes
GATCACACTTCCCACAACCC	92	14	yes
GATCACAGGGAGCCTGTGTT	180	7	yes
GATCTTAAATGGCGTAGTAT	187	12	yes
GATCACAGCAGAGATGGCCA	61	1	yes
GATCTGTTTCTCTAACAACT	19	2	yes
GATCTGTTTCCCTTCTGTTC	3	3	yes
GATCTCATTGTTCTTGGAGA	15	1	yes
GATCTCATTCCGGATGAAGC	15	1	yes
GATCTCATTCCCGAGAGAGG	29	8	yes
GATCTCATGTGTGGGAACCA	30	1	yes
GATCTCATGTGTACCAGCCA	28	2	yes
GATCTCATGTCTCTGGAGGA	62	6	yes
GATCTCATGGGAAGAAAAGT	1	1	yes
GATCTCATGACCTGTAAAAA	2	2	yes
GATCTCATCCTCTCACCTCC	22	4	yes
GATCTCATCCAGTCTGCTGT	19	3	yes
GATCTCATCAGACAGTAGAA	55	11	yes
GATCTCATCACAGGAGCATC	20	2	yes
GATCTCAGTTTTCATCAAGT	72	5	yes
GATCTCAGTTTGAGTGGATG	38	6	yes
GATCTCAGTTTCGCTGATGT	163	1	yes
GATCTCAGTTCTGTGTTTAC	180	8	yes
GATCTCAGTTCACGGGGTGG	219	2	yes
GATCTCAGTTCAACAGCTCC	214	5	yes
GATCTCAGTGTGGAGAGCAT	103	7	yes
GATCTCAGTGTCCTAAAGAT	24	4	yes
GATCTCAGTGGGGGTGGGAG	273	7	yes
GATCTCAGTGCTGGGGAGGT	116	14	yes
GATCACACTGATGGAGCTGT	8	0	yes
GATCACACGGCAAAACAGTA	70	17	yes
GATCACACCTTGCTGTTCCC	7	8	yes
GATCACACCTGTCCCTACAC	1014	80	yes
GATCACACCTGCAGTTTGGG	39	3	yes
GATCACACCGTTTCTTCCTA	14	0	yes
GATCACACCGAGATTCTTTT	29	8	yes
GATCACACCGAGACCAGTGG	22	2	yes
GATCACACCATTGAGTTCCG	36	2	yes
GATCACACCAGTCCTGTGAG	15	7	yes
GATCACACCACCGTGTCAAA	40	4	yes
GATCACACCAAGCCCCAGGA	12	0	yes
GATCACACATTTGCAAGGGA	46	9	yes
GATCACACAGATGTTTTCTA	15	1	yes
GATCACACAGAGCTGAGGGC	39	1	yes
GATCACACACTCAGTCCTTG	58	11	yes
GATCACACACGGCAACCGAC	133	24	yes
GATCACACAAGTGTGGGTTT	68	4	yes
GATCACACAAAACTGTCAGC	46	11	yes
GATCACAATCAGGAACTCAC	10	1	yes
GATCACAAGTTTGCATTCAG	18	5	yes
GATCACAAGTTTGAGACCAG	47	5	yes
GATCACAAGTTGTTTCCTGT	5	1	yes
GATCACAAGTTAAGGTCAGC	38	5	yes
GATCACAAGTGCAGCATTCT	178	21	yes
GATCACAAGGTTTACATCTG	3	3	yes
GATCCTTCATGTTGAGCCAG	137	19	yes
GATCACAAGGCTGAAAACAA	1	1	yes
GATCACAAGAGTTACTAGTT	25	4	yes
GATCTGTTGTTTGCGTTGAA	1	1	yes
GATCCTTGACTCTCAAGCCC	27	30	yes
GATCTGTTGCAGGAGTTGGA	2	2	yes
GATCCTTCTGTCGGCTTCCT	25	5	yes
GATCCTTCTGTCCTGGATTT	3	1	yes
GATCTGTTACTTTGGCGAGG	410	4	yes
GATCTGTGTGTCATCAGATG	2	2	yes
GATCCTTCTCTGCCCTTCCC	18	0	yes
GATCTGTGTGGGACCAAGGC	57	6	yes
GATCTGTGTGGCTCCTCTGC	68	10	yes
GATCTGTGTGGATGTCCTGA	50	5	yes
GATCCTTCCTTTCCCTTGGC	6	4	yes
GATCCTTCCTTCTTCTCTTC	47	10	yes
GATCTCAGTATCTCTTTCTC	8	9	yes
GATCTCAGTAGTATTCCTCC	2	2	yes
GATCTCAGTAACTGTCGAGC	106	14	yes
GATCTCAGGTGTTTGGTCAT	27	5	yes
GATCTCAGGGTTCCCATGGT	9	8	yes
GATCTCAGGATTTGTTGGGG	2	2	yes
GATCTCAGCTTGCATAGCAT	306	36	yes
GATCTCAGCTGACTCCTTTT	12	1	yes
GATCTCAGCTCCACTGTGAA	93	27	yes
GATCTCAGCTAAACTTTCAA	2	2	yes
GATCTCAGCGAAAGTGAAGA	2	2	yes
GATCTCAGCCCCTACTCCCA	60	2	yes
GATCTCAGCCATAGTCGTTG	522	56	yes
GATCTCAGCACTTGGGAGGT	5	4	yes
GATCTCAGCACTGTGGCTGT	683	39	yes
GATCTCAGCACTAGAGGAAT	1	1	yes
GATCTCAGATTTAATGCTCT	2	2	yes
GATCTCAGATAAAAACTTGT	7	0	yes
GATCTCAGACAGCTCTGTGT	2	2	yes
GATCTCAGAACTGTGCCAGG	9	9	yes
GATCTCAGAACACACAGGTA	46	43	yes
GATCTCACTGTTTGCTAACA	34	6	yes
GATCTCACTGTTTCATGCTG	41	2	yes
GATCTCACTGCCTCCCTCTC	214	3	yes
GATCTCACTCAGCAACAAGT	169	5	yes
GATCTCACGGGCCGACCGAG	22	20	yes
GATCACAAGAGGCCCGTTTG	115	6	yes
GATCACAAGAGAGTTGCAAC	2	2	yes
GATCACAAGAAGTTAGTTTG	4	4	yes
GATCGGGGGGATGACCAGCT	56	5	yes
GATCACAACTTTAATCCCAG	4	3	yes
GATCACAACTTCTGAAACAC	16	0	yes
GATCACAACTGTAGGGAATA	126	14	yes
GATCACAACTGATTCCTGCT	6	1	yes
GATCACAACGGCTTGCGTGT	235	5	yes
GATCACAACCCTGATGGCAG	472	22	yes
GATCACAACCCCCAAGTCAG	38	3	yes
GATCACAACATTAGAGCAGT	3	3	yes
GATCACAAATACAGATTCTG	24	4	yes
GATCACAAAGTTTGAGAATG	961	51	yes
GATCACAAAGGTGGAATGTT	79	10	yes
GATCACAAAGAACAAGTGTA	32	2	yes
GATCACAAACTTCTGCAAAA	70	2	yes
GATCACAAACATCACAGAAG	13	3	yes
GATCACAAAATGAGTCACTC	1	1	yes
GATCACAAAAGGCTGTTTTG	20	19	yes
GATCTCTCCAAATGGCTCTT	7	2	yes
GATCAATGTGAGGATGTCTT	42	4	yes
GATCAATGGGCAGCAGCAAT	75	6	yes
GATCAATGGCTTTGATGCAG	12	11	yes
GATCCTGTCCTGTGCCTTTT	3	3	yes
GATCTGTGTATACCCCACTC	183	20	yes
GATCTGTGGTGCTAACCCAA	2	2	yes
GATCTGTGGTCCCTGCCTCC	22	2	yes
GATCTGTGGGGTGCCCAGAA	16	5	yes
GATCTGTGGAGTTTTTCTCC	53	2	yes
GATCTGTGGACGACGAGAAC	15	0	yes
GATCCTGTGTGTTCCCTTCT	3	3	yes
GATCTGTGCCATCCCATACA	164	3	yes
GATCCTGTCTCCCGTGGACA	7	8	yes
GATCTGCTGGGCGGTAGTGG	12	0	yes
GATCTCACCGTGAGGCCCCG	46	4	yes
GATCTCACCCTAGGGCAGGC	19	17	yes
GATCTCACCCAGAAGCATGA	571	102	yes
GATCTCACACAAGCTGGGGA	26	5	yes
GATCTCAATGAAGTAGCTAA	28	3	yes
GATCTCAATGAAAGAGGACT	37	12	yes
GATCTCAACTGACTCCTCTT	955	21	yes
GATCTCAACAAGATGACCTT	28	7	yes
GATCTCAAACTCAGAGGTTT	6	0	yes
GATCTATTTTTTCTTGCGAT	23	3	yes
GATCTATTTTCCTAACCGTT	19	7	yes
GATCAATGGAAAGCTAAATA	4	3	yes
GATCAATGCTGAAGTCATTT	17	15	yes
GATCAATGCAGGCCATGAGG	6	6	yes
GATCAATGCAATGACGTGGG	94	8	yes
GATCAATGATGAGGACAAAC	579	60	yes
GATCAATGATGACTCCAGGA	1	1	yes
GATCAAGTCCGGGAACTCTC	515	2	yes
GATCCTGGTAGGAGCACTTG	33	7	yes
GATCAATCTTCTGGTTCATC	26	2	yes
GATCCTGGGTACTGCACAGT	1272	44	yes
GATCCTGGGGGTGGACTGCA	4	4	yes
GATCAATCCAGGAGTCTCTG	55	50	yes
GATCAATCACATGGACACTA	15	14	yes
GATCTGTGATTTGCTTCTAT	6	2	yes
GATCTTGGAATGTGAAAAAA	1	1	yes
GATCTTGGAAAGTCAGTTAT	13	2	yes
GATCCTGGGAGTGGGCCCTG	41	4	yes
GATCCTGGGACATAATCACC	2	2	yes
GATCCTGGGAAGCCTCCTCA	54	12	yes
GATCTGTCTCAACAGTCTGG	12	2	yes
GATCAATATGGGGAAAGCAG	6	6	yes
GATCTTCCAAACTTCAGCAA	2	0	yes
GATCAATAAAGTGGGTTTTT	5	4	yes
GATCCTGCGGGTGGGAGGAA	48	2	yes
GATCCTGCCTTGAATTCCTG	12	1	yes
GATCAAGTTTGTGGTGTGTT	48	3	yes
GATCAAGTTTGGTGTTTCCT	53	5	yes
GATCAAGTTTCAGGAAGGCT	65	8	yes
GATCAAGTTTCACATCCTTC	28	1	yes
GATCCTGCATATCTCAAAGA	65	3	yes
GATCCTGCAGCAGGAGTGCA	38	2	yes
GATCTGTCCTGATGAAGGCT	283	8	yes
GATCCTGATTTAGGAAGTGT	103	3	yes
GATCTGTCCATCTTGGAGTT	29	8	yes
GATCTGTCCAGGGTGCAACA	21	1	yes
GATCTGTCAGTGTTATGGAA	11	10	yes
GATCTGTCAGCTGTGCTCTC	17	6	yes
GATCCTGCTCAGACCATACC	2	2	yes
GATCCTGCCAGCCAGACCAA	43	2	yes
GATCTGTAGGCGAGGGAATC	35	9	yes
GATCCTGCAGACACTCAGAG	37	3	yes
GATCAAGTTGGGAATGAGGG	4	2	yes
GATCAAGTTGCCAGCATTTG	34	2	yes
GATCAAGTTGAAAGAGTGTG	40	7	yes
GATCAAGTTCAGTGCGCAGG	5	5	yes
GATCAAGTTATGTGTGGTTT	5	4	yes
GATCAAGTTACTGTGGAGAG	5	1	yes
GATCAAGTGTGACCCAGAAA	10	9	yes
GATCAAGTGTCGGATGGAAT	35	1	yes
GATCAAGTGTAAATGTGCTG	59	17	yes
GATCAAGTGGTCAAGGTACT	17	16	yes
GATCAAGTGGATTCGGCGGT	142	10	yes
GATCAAGTGCTTTGCCAAGT	6	6	yes
GATCAAGTGAGCTGTATCAG	50	38	yes
GATCAAGTGACAATTATCTG	1	1	yes
GATCAAGTCTTGTCAGTTTG	97	6	yes
GATCCTGAGTGGCTTGCTAG	8	2	yes
GATCAAGTCGTGCTTCTGGC	2216	24	yes
GATCAAGTCCTTTGTGAAAG	448	39	yes
GATCAAGTCCGAGGTCCCCC	6	0	yes
GATCAAGTCCCTCCTTTTAC	38	7	yes
GATCCTGAGGAGTCAAATAT	58	8	yes
GATCCTGAGGACATTCTAGA	18	20	yes
GATCCTGAGGAAGGCCAGGC	1105	5	yes
GATCAAGTATGGGGAGAGCC	16	15	yes
GATCCTGAGAGCATCTTCGA	15	2	yes
GATCAAGGTGTTGCCTGGTG	358	10	yes
GATCAAGGTCCTAAAATTTC	166	15	yes
GATCAAGGTCCAGGTGGAAG	3	3	yes
GATCTGTACCTACTGTTAGA	11	10	yes
GATCCTGAATGGGCAAGAGT	137	11	yes
GATCTGGTTCCTGAGCCCAT	205	35	yes
GATCTGGTGCTGATAGGAAG	52	19	yes
GATCCTGACTCCTTGAAGCC	3	3	yes
GATCTGGTCACTGGTCAGAG	7	1	yes
GATCCCCGCATCTTCCTGGT	23	5	yes
GATCTGGTATGAACATCGGC	77	9	yes
GATCTGGGTTTGTCAACAGG	5	1	yes
GATCTGGGTTGTGAGGAGGT	39	5	yes
GATCTCTGTGAAAGTAGTAC	68	4	yes
GATCTATCTGCTTGCCTCCC	25	3	yes
GATCAAGGTCCACTTAGTGG	34	6	yes
GATCAAGGGAATCTTAAAGG	1	1	yes
GATCAAGGCTTTCCTCGGGC	6	6	yes
GATCAAGGCTCTGGAGATAA	27	5	yes
GATCAAGGCTCCCGGTTTTG	1086	55	yes
GATCAAGGCCTTTCTGTCCT	694	23	yes
GATCAAGGCCTTTCTGCCCT	14	13	yes
GATCAAGGCCCACTGTGGAG	28	3	yes
GATCAAGGCCACTGTGTAAC	87	8	yes
GATCCTGAAAGACCGGGAAA	47	16	yes
GATCAAGGCAAAAGGAGGAT	8	1	yes
GATCAAGGATTGAAGGAATG	81	7	yes
GATCAAGGAGGTAGATATGG	540	169	yes
GATCAAGGAGGCTGTTGCTG	31	11	yes
GATCAAGGAGGAAGTGTTGT	89	4	yes
GATCAAGGAGAGAAGCAGGA	56	11	yes
GATCAAGGAAGAGGAACCTG	5	5	yes
GATCAAGCTTTTTGGAAGTT	195	12	yes
GATCCTCTGGCAGATGTTTG	35	3	yes
GATCAAGCTTAGCAGTCAAG	413	37	yes
GATCAAGCGTCCACTCCTCA	3	3	yes
GATCAAGCGGGGAGGGCCCC	6	6	yes
GATCAAGCGGGCTTTCCTTA	707	50	yes
GATCAAGCCTGTTAGCCCTG	8	3	yes
GATCTGGGTGGGACAGTCAC	27	19	yes
GATCCCTTTGGTGCCCCTGA	5	1	yes
GATCTGGGGAGGGAGTCAGT	15	2	yes
GATCTGGGCTGAGCTTGGTT	18	2	yes
GATCTGGGCAGTTGTTTTGC	5	1	yes
GATCTGGGCACTGCTGTGCT	2	0	yes
GATCTGGGCACCGAGGCTGG	65	11	yes
GATCTGGGCACCCACTGCCT	6	0	yes
GATCTGGGATAAGGAGAGCG	76	13	yes
GATCAAGCCTGAATAAATAT	39	9	yes
GATCAAGCCCTTCTTCCATT	741	3	yes
GATCAAGCCATCCATCAACT	194	29	yes
GATCAAGCATCATGATGCTC	18	19	yes
GATCAAGCAGTTTCTGGAGT	21	5	yes
GATCAAGCAGTAGAGTTTTT	113	8	yes
GATCAAGCAGCGAGAGGCTG	917	10	yes
GATCAAGCAGCAGCACGGGG	21	5	yes
GATCAAGCAGAACCTGGAGA	199	16	yes
GATCAAGCAAAATATCCCTA	35	3	yes
GATCAAGAGTTTATTGCATT	6	6	yes
GATCAAGAGGATTTGGATTT	12	1	yes
GATCCTCCTCACTTAGCACC	36	4	yes
GATCAAGACTGTGACTTTTG	276	31	yes
GATCAAGACTCTCCTGGAGA	25	1	yes
GATCAAGACGCCTGTCATTT	85	0	yes
GATCAAGACCCTCCAGAGGT	31	5	yes
GATCAAGACCACCACTGCAT	422	13	yes
GATCCTCCCAAAAGCCATCT	49	10	yes
GATCCTCCAGCTGGGATTCC	5	5	yes
GATCAAGAATTCAGGGTCAT	31	29	yes
GATCCTCCAGCTCCATCAGT	24	22	yes
GATCCTCCAGCTCCATCAGC	57	18	yes
GATCAAGAACTTCCATTACT	31	4	yes
GATCCTCAGGTTTGTGTTGC	20	2	yes
GATCTGGGAGCCAAAGGTTG	94	5	yes
GATCCTCACTGGCAGCAGCT	53	6	yes
GATCTGGGACGTGAACAAAA	27	5	yes
GATCCTCACCCACCTGCTGG	80	33	yes
GATCTGGGACAGCAAATGGG	4	3	yes
GATCTGGGAAGGACCCTTTC	15	4	yes
GATCTGGGAAGACTTCTCTA	330	38	yes
GATCTGGGAAACAGCATTGC	46	7	yes
GATCTGGGAAAATGGCAGTT	27	2	yes
GATCTGGCTTTTGTTTTCCA	14	6	yes
GATCTGGCTGGTCCAGTACA	22	23	yes
GATCTGGCTCCCTCTTCTGG	6	6	yes
GATCTGGCCTGAGCCTGTCC	107	24	yes
GATCTGGCCGAATGGTAAAA	14	9	yes
GATCTGGCCCTTTTGTCCTT	89	6	yes
GATCCTGGTTTGGATAAACC	5	5	yes
GATCAACTTTTTTCCCCCAA	16	0	yes
GATCAACTTGCTGGGACCTA	793	53	yes
GATCAACTTGATTATGATGT	2	2	yes
GATCAACTTAATTCCCTTTT	71	4	yes
GATCAACTGTGCAGACAACA	954	507	yes
GATCAACTGCTACGATGTGT	77	2	yes
GATCAACTGCGACATCTAGG	90	27	yes
GATCAACTGAGGTCTTTCTT	22	20	yes
GATCAACTCTTTGTTTTGGC	4	2	yes
GATCAACTCTTGGCTTTGAC	51	3	yes
GATCAACTCTAAGTCCCCTG	33	5	yes
GATCAACTACCTGCAGGAAG	505	31	yes
GATCAACGGAGGACTATCAT	2	2	yes
GATCAACGCGGAGTTCGTCA	16	0	yes
GATCTGGCCAGGGTGCCTTT	13	1	yes
GATCTGGCCAACACAAGAAC	8	1	yes
GATCTGGCATAAACCCTACT	15	16	yes
GATCCTCCCTGTTCTCATCT	9	1	yes
GATCTGGCAGATGTGAGGTT	7	1	yes
GATCTGGATTGTGGAGCCAA	48	6	yes
GATCTGGATAGGTGTTTATT	5	5	yes
GATCTTCACTCTCTGACTCA	5	1	yes
GATCTGGAGGTGGACGGACA	11	10	yes
GATCTGGAGGTGGAAGTGGT	59	1	yes
GATCAACGCGATTTAGCTGA	21	8	yes
GATCAACGAAGTGGATGCTG	2	2	yes
GATCAACCTGAGAGGGAGAT	6	5	yes
GATCAACCTCGTCGACTGGG	28	4	yes
GATCTGGATGAAGGATAAGC	23	1	yes
GATCAACCGACAGCTGGAGG	142	35	yes
GATCAACCCACAGGAGTACC	9	9	yes
GATCCCAGCATCATCTTTGC	24	12	yes
GATCAACCCAATACCTCTTG	1	1	yes
GATCAACCATTCCTGTGTCA	15	2	yes
GATCAACCACTGCAAATTCG	6180	568	yes
GATCAACCACTGACCTGCCT	53	2	yes
GATCAACATGAACTGAGATT	16	15	yes
GATCAACATCATTGAAGAGT	18	16	yes
GATCAACAGTGAGGCAAGCA	27	1	yes
GATCAACAGTAGTTGTCTTT	4	4	yes
GATCAACAGCTGCCCTGCCT	589	118	yes
GATCAACAGCTACAGAAAAT	6	6	yes
GATCAACAGCGTTGCCTTCC	69	7	yes
GATCAACACTTACGTTAGGA	16	8	yes
GATCAACACGAACACGTTTT	19	12	yes
GATCCCCAAGATGTCGCAAT	2	2	yes
GATCAAGCCTGGAGAGGTGG	14	3	yes
GATCCACTCAGTCAAGGGTC	3	1	yes
GATCCTGCGGGAGGCCTATG	31	2	yes
GATCGGCTCTTCCCACCTAC	5	4	yes
GATCTCCGAGATGACCCCAA	5	4	yes
GATCTCCCCGTCACAGAACC	27	2	yes
GATCAGTGCAGCGGGTAACA	2	2	yes
GATCAGTGCAAATGTTTTTG	18	1	yes
GATCAGTGAATGGGTCAAGA	12	3	yes
GATCAGTCCTTCCCTCGAGA	7	3	yes
GATCCAGGAGGCTCTGCACG	53	15	yes
GATCTTCTGGACCTTGGAAG	3	3	yes
GATCAGTCAGCCCGGGCCAG	39	36	yes
GATCAGTTTCAAGAAGCGTG	2	2	yes
GATCCCAGCATTTCTCAATT	19	8	yes
GATCCCAGCATCGGCAAGCG	289	35	yes
GATCCCAGCAGCTGTTACCT	134	10	yes
GATCCCAGCACTGCAAAAGA	28	12	yes
GATCCCAGCACACACCGTGA	88	14	yes
GATCCCAGATGGACATGGCA	1	1	yes
GATCCCAGATGATACCCACT	171	6	yes
GATCCCAGAGGAAAGGGTTT	10	1	yes
GATCCCAGAGACAATCTCAT	182	28	yes
GATCCCAGACGCCTCAAATG	45	1	yes
GATCCCAGAAGCCGCACAGG	5	1	yes
GATCCCAGAAGCACACTGGC	140	6	yes
GATCCACAGCCTCCTCTGCC	1	1	yes
GATCCCAGAACCATTGCCTG	35	5	yes
GATCCCACTTCACCTGTTAT	70	4	yes
GATCCCACTGTTGATAAGGA	11	7	yes
GATCCCACTGCTCATTTGAC	110	25	yes
GATCCCACTAACCTGCAGTG	25	3	yes
GATCCTCAGGCTGTGAGTGA	9	3	yes
GATCCCACGGTAGAACCTGA	302	12	yes
GATCCCACGAGCCAGAGAAC	305	9	yes
GATCCTGCATCACTTGTTTT	12	1	yes
GATCCAGGAAGAGTCTCTGA	6	1	yes
GATCCAGGAAATGCTGGAGA	2	0	yes
GATCCTAGCGGACCTCAACC	19	5	yes
GATCTGTCTGTAGCGGTCAA	3	3	yes
GATCTCCAACATCTGTCAGA	9	1	yes
GATCAGGTTTCTTCTTTTCC	16	0	yes
GATCTGTCCAGGGGACATTA	34	6	yes
GATCTTCCCACGGTGGTCAC	2	2	yes
GATCCAAGTCAGGGAGAAAG	197	11	yes
GATCATCAGCTGGACTTTGT	2	2	yes
GATCCCACCTTCACCTCCCT	135	9	yes
GATCCCACCTGTCACCCCAT	12	0	yes
GATCCCACCTCACGTGTGAT	164	11	yes
GATCCCACCGGTCCAGTGGA	1	1	yes
GATCCCACCGCAGCTACCAG	74	12	yes
GATCCCACCCCGAGCCTGGT	4	3	yes
GATCCCACCCCAGTAGGAAG	941	9	yes
GATCCCACCATTCTCCTTGG	195	41	yes
GATCCCACCATCCTACCTAC	2	2	yes
GATCCCACATTTCCCTTGCC	21	10	yes
GATCCCACAGTGTGACTGAT	29	6	yes
GATCCCACAGGCCGGTGGAG	17	0	yes
GATCTGCATGCCCTGGGTTT	10	11	yes
GATCCCACAGCCAGGCTCAC	2250	7	yes
GATCCCACAGATGTAGTTTG	3	3	yes
GATCCCACACTTAAGACTTC	177	27	yes
GATCAGGTGGATGTGCAGGA	91	9	yes
GATCAGGTCCTAAACATGGC	9	1	yes
GATCTGTAGCACCCCAGTTC	40	16	yes
GATCCCACACAGCAGACAGA	68	4	yes
GATCCCAATTGGTGGAAAGG	80	5	yes
GATCCCAATTCTGTCCCAAT	21	5	yes
GATCCCAATTACAACCCACT	175	30	yes
GATCCCAATGGTCACACACC	77	4	yes
GATCCCAATGCTGCCCCATC	32	2	yes
GATCCCAATGATAGATTCAA	83	27	yes
GATCCCAATGAGCCCACCTA	31	8	yes
GATCCCAAGTTCAAAGCCAG	10	9	yes
GATCCCAAGTGCTGGGAAAG	124	11	yes
GATCCCAAGTCCAACACCCA	2	0	yes
GATCCCAAGGGTCAGCACTG	4	4	yes
GATCCCAAGCCTCACCGGCT	26	2	yes
GATCCCAAGCCAAGAAACAC	13	1	yes
GATCCCAAGAGGAAGGGTAT	2	2	yes
GATCCCAAGAAAGGATGGAA	53	11	yes
GATCCCAAGAAACTACTTGA	104	4	yes
GATCCCAACTGTCAGTGCCA	68	10	yes
GATCCCAACTCTGCAAGAGC	4	2	yes
GATCCCAACATTTGAGAGGC	4	0	yes
GATCCCAACATTGTTGGCAA	38	3	yes
GATCCCAACACCCATATCCA	4	3	yes
GATCCCAACACAGCGATATG	548	62	yes
GATCCCAAATTGGGTTGTCA	28	0	yes
GATCCCAAATCTGTGGTGTG	32	17	yes
GATCCCAAATACTCAGTGCT	20	7	yes
GATCCCAAAGGCTCCAGGGT	81	6	yes
GATCCAGATGTTTGTGGCTG	2	2	yes
GATCAGGGGCCAAGGTCCTT	151	8	yes
GATCTCATCCAAGCAAATGG	258	21	yes
GATCAGGGCTCCAGTGGTCC	10	0	yes
GATCAGGGCCTGGACTCTGG	24	4	yes
GATCCAGAGCTCCTAGCACT	20	22	yes
GATCCCAAAGAGACTAATTT	13	5	yes
GATCCCAAACTGTATCCTTG	61	4	yes
GATCCCAAACTGCTTTCTCA	1	1	yes
GATCCCAAACTGAGGCAGCA	115	24	yes
GATCCCAAACTACTTAATAG	70	5	yes
GATCCACGTGCCTTTGTCTC	21	3	yes
GATCCCAAACAGCTAATATG	14	6	yes
GATCCCAAACAACTAAGAAT	339	40	yes
GATCCCAAAATGCTGCGGAG	109	1	yes
GATCCCAAAATAGGTGTTGA	72	21	yes
GATCCCAAAAGGGACATTGT	22	13	yes
GATCCCAAAAACCGTGCAGC	13	0	yes
GATCCCAAAAAATCTGTGCC	33	1	yes
GATCCATTTGCTTACACTGT	190	21	yes
GATCCATTTGATGCTTCCAG	43	4	yes
GATCCATTTCTTCTGCATGA	92	7	yes
GATCCATTGTTCCTCTGTTT	17	8	yes
GATCCATTGTGTGGTTTAAC	63	24	yes
GATCCATTGTATGGCTTTAT	300	44	yes
GATCCATTGGTTTCTCAGTC	71	3	yes
GATCCATTGAGACGTATGAA	2	2	yes
GATCCATTCTCCCGCCACAG	15	5	yes
GATCCATCTTTTTCTTTGGA	26	4	yes
GATCCATCTTCAGCTGACTG	67	6	yes
GATCCATCTCTTTCCTTCTG	81	7	yes
GATCCATCTCCTCTGGCTCT	43	7	yes
GATCCATCTCCAGCACATGC	68	14	yes
GATCTGGGTTGGATGGGGCT	27	4	yes
GATCTGGGTGGCCAGTACTT	129	11	yes
GATCTGGGTAGGGGACCAGG	83	3	yes
GATCCAGAATGTCAGCTGGA	54	23	yes
GATCCAGAATCCAACTGAAT	20	4	yes
GATCAGGCCTTCCCCCTAGG	3	3	yes
GATCAGGCCGGGGCGGCAGG	195	28	yes
GATCAGGCCCTAAAGCATTG	121	2	yes
GATCCATCGACTGTGATAGG	187	12	yes
GATCCATCCTTACTTGGTTT	7	1	yes
GATCCATCCTGTAACCCTTC	5	1	yes
GATCCATCCTATCCATCCGT	12	2	yes
GATCCATCCCCGGCAAAGAG	67	6	yes
GATCCATCCCAGAGGGACTG	2699	22	yes
GATCCATCCAGCATTTATGT	3	3	yes
GATCCATCCAGCAAAGAGGA	43	9	yes
GATCCATCCACCAGCAGGAG	91	6	yes
GATCCATCCAATGGCTTACC	193	11	yes
GATCCATCAGGGCTGAGCCT	15	1	yes
GATCCATCACAGGACTATGT	27	1	yes
GATCCATCACAAGGCAAAAC	63	5	yes
GATCCATATCTTTTTGCTGT	18	4	yes
GATCCATATACCCATTAATA	53	9	yes
GATCCATAGAGCTTGCTGGC	11	2	yes
GATCAGGAGCAGGCAACACC	1622	8	yes
GATCCACTCACAGCACCTCC	29	13	yes
GATCCACTCCCTGTTCCCTT	7	8	yes
GATCCATACTCCCCAGTATG	43	3	yes
GATCCATACCCACCACTGTG	4	2	yes
GATCCATACAATTTGTGCCA	430	67	yes
GATCCATAATGGCTCAGTAT	13	14	yes
GATCCATAAGTTTGCCCAGT	36	16	yes
GATCCAGTTTTGGGAAAGGA	162	5	yes
GATCCAGTTTCTGACTCGGG	32	9	yes
GATCCAGTTTCATTCTCTAA	22	7	yes
GATCCAGTTGTTTGAAGATT	2	2	yes
GATCCAGTTGTGCAGTAGAG	23	12	yes
GATCCAGTTGGAGAGATTTG	22	2	yes
GATCCAGTTGCTCTAAGTTT	144	10	yes
GATCCAGTTCTGCTCAACTA	264	28	yes
GATCCAGTTCTACGAGCGGC	68	18	yes
GATCCAGTTCTAAAACTTGT	277	7	yes
GATCCTTGACCAGAAGTCTC	17	1	yes
GATCCAGTTACCAGAAGATG	405	36	yes
GATCCAGTGTGTTGCTGGCA	107	4	yes
GATCCAGTGTGGACCAGCTC	6	4	yes
GATCCAGTGTGCTGGTCTTT	27	1	yes
GATCCAGTGGCGGCAGAAAC	2	2	yes
GATCCAGTGGCAGCCTCAGC	93	3	yes
GATCCAGTGCCTCATTGTTG	44	4	yes
GATCTGGCCCGCCGAGCCAT	2	2	yes
GATCCAGTGAGAGCCAGACA	320	56	yes
GATCCAGTGACGTCAGACGC	251	18	yes
GATCCAGTCCTGGAGGACAG	474	22	yes
GATCCAGTCCATTCAGCAGT	49	7	yes
GATCCAGTCAGGAGTACTCA	17	5	yes
GATCCAGTCAGGACATATGA	66	14	yes
GATCCAGTCAGCCCCTGGGG	464	96	yes
GATCCAGTATCTGAAAGACC	101	30	yes
GATCCAGTACTTGGTTTGTG	5	1	yes
GATCCAGTACTACCAGAATG	85	13	yes
GATCCAGTACCTGTAATACA	2	2	yes
GATCCAGGTTCAGTAAATTA	16	0	yes
GATCCAGGTTCACCACCGGG	77	4	yes
GATCCAGGTTCAATTTCCAG	60	6	yes
GATCCAGGTGTGCTGAGTGG	198	31	yes
GATCCAGGTCCGTGAACCCC	86	10	yes
GATCCAGGGTGTGCAGTGGG	505	36	yes
GATCCAGGGTGCCCCTCCAA	348	48	yes
GATCCAGGGTCCTCTGCCTG	113	8	yes
GATCCAGGGGGGACACCTGC	49	2	yes
GATCCAGGGCTCAGGAGCAC	35	10	yes
GATCCAGGGCGATGTTGGGG	108	27	yes
GATCCAGGGCCTGTGAATCA	303	33	yes
GATCCAGGGCCTGGTGGAGG	106	10	yes
GATCCAGGGCCTCTGCGCCT	23	5	yes
GATCCAGGGCCACTTTGTCT	5	1	yes
GATCAGCGGCCGAATGTCCC	7	1	yes
GATCCACCCACTGTCCCAAC	4	3	yes
GATCTACGGTTCCCAGGCAT	1	1	yes
GATCCACCAGGATTGAAGGA	4	4	yes
GATCCACCACAGCAGGCAGG	9	1	yes
GATCAGCCTCAGTCTTCAGG	31	0	yes
GATCAGCCGGGGCTTTGAGG	77	71	yes
GATCCACAGTGCAAAGAAAA	9	0	yes
GATCTTTGCCTCTCTGTAGA	10	3	yes
GATCCAGGGAATCAAGGAAT	2	2	yes
GATCCAGGGAAGCCTGTGCT	1	1	yes
GATCCAGGCTGGCCTCAGCA	5	5	yes
GATCCAGGCTGAGGACATCA	1	1	yes
GATCCAGGCTCTGATGTTTC	52	2	yes
GATCCAGGCTCGGGAGCTAA	23	1	yes
GATCCAGGCTCACAGTGTGA	69	9	yes
GATCCAGGCTAAAATCCCCG	16	17	yes
GATCCAGGCGGCCCTGCCAG	5	5	yes
GATCCAGGCGGCCAAGAACT	146	12	yes
GATCCAGGCGGAGGATGACG	1	1	yes
GATCCAGGCCTCCCTTCTTG	115	23	yes
GATCCAGGCCTACTTCGCGT	7	3	yes
GATCCAGGCAGCTGTGTACA	10	2	yes
GATCCAGGCACGTGATTCTC	8	0	yes
GATCCAGGAGTTCAAAGAGG	552	47	yes
GATCCAGGAGTCAGTTCTGC	29	9	yes
GATCCAGGAGGGGTTTGCTC	43	11	yes
GATCCAGGAGCAGGAGCTGC	23	1	yes
GATCCAGGAGCACGTGAAGA	66	6	yes
GATCCAGGACTTCTTCATCC	9	1	yes
GATCCAGGACCTGGAAGTAT	2	2	yes
GATCCAGGACCATCCTCTCA	16	2	yes
GATCCAGGAAGTTTTGTTGT	168	12	yes
GATCCAGGAACTACTCCACA	127	30	yes
GATCCAGGAAAGCAGCCTGT	936	28	yes
GATCTACCCAGGTGTGTTTC	3	3	yes
GATCCAGCTGGGCGAGGATG	134	16	yes
GATCCAGCTGGGCAAAATTC	17	4	yes
GATCCAGCTCCTAAACTGTT	16	3	yes
GATCCAGCTCAGGCGGTGTC	22	2	yes
GATCCAGCGAGAAAGAAGAA	121	15	yes
GATCCAGCCTGAGCTCAGTG	5	5	yes
GATCCAGCCTGACCTGCACA	108	9	yes
GATCCAGCCCATACAGAAGA	41	11	yes
GATCCAGCCATTTGTGGGTG	12	2	yes
GATCCAGCCAGTCTCTCATT	10	2	yes
GATCCAGCATTTAAATTTCT	897	4	yes
GATCCAGCAGTTAAAGCAGT	148	31	yes
GATCCAGCAGAGAGGGCAGG	161	45	yes
GATCCAGCAGAGACTCCACA	31	1	yes
GATCCAGCACCGTGTGTACC	39	5	yes
GATCCAGCACATACAAGTCT	59	3	yes
GATCCAGCAAACTTGGTTGG	85	23	yes
GATCCAGCAAAACTACTGCT	43	1	yes
GATCCAGATGATGGTTCTTT	392	44	yes
GATCCAGATACAACGCTCAC	19	10	yes
GATCCAGAGTGGCACAGGGT	96	17	yes
GATCCAGAGTGGAACTGTCC	31	0	yes
GATCCAGAGGTGTTAGCTAC	20	13	yes
GATCCAGAGGTGCTGGGCAT	3	1	yes
GATCCAGAGCTTCTGCAAGG	8	3	yes
GATCCAATTCGAGAAGTCAA	20	0	yes
GATCAGCAGATGCAAAAGAT	8	8	yes
GATCCAAGTTTGATGCCGGC	15	6	yes
GATCCAGAGCTGGAATAGCA	2	2	yes
GATCCAGAGAGATGGGTCAG	24	2	yes
GATCCAGAGAGACTTGGTTG	18	6	yes
GATCCAGAGAACTCAGCTGT	60	8	yes
GATCCAGAGAAAGCAAAGGC	32	5	yes
GATCCAGAGAAAGACAAAAT	2	0	yes
GATCCAGACTTGCCTTATAA	372	29	yes
GATCCAGACGAATCTTGTCA	30	1	yes
GATCCAGACCTGCCACAGAC	20	7	yes
GATCCAGACCCGGGAAGGGA	105	4	yes
GATCCAGAATTGCTTTCCCA	59	1	yes
GATCCAGAAGTTGGGAAAAC	32	7	yes
GATCCAGAAGCAGTGGAATC	596	72	yes
GATCCAGAAGATTTGAACTC	31	6	yes
GATCCAGAAGAACCTACCAC	26	2	yes
GATCCAGAACCTCTCAGCCA	18	0	yes
GATCCAGAACATTCTAGAAA	33	8	yes
GATCCAGAACAGTACAGCGT	166	33	yes
GATCCAGAACAGCGACGATG	2	2	yes
GATCCAGAACACATTAACCT	92	21	yes
GATCCAGAAAGAACGATTTG	23	3	yes
GATCCAGAAAGAAAATGTCA	2	2	yes
GATCCAGAAAACATGGGCTC	110	3	yes
GATCCACTTGGGCTCTGTCA	47	7	yes
GATCCACTTGCTGCCTGAGA	30	2	yes
GATCAAGAGCACCTGGATAA	14	13	yes
GATCCCAGAGTTTGAGCCGA	2	2	yes
GATCACAGCAGAGATGCCCA	10	9	yes
GATCGCCACCTACCGCAAGC	45	1	yes
GATCCTCCCACAGGGACACA	19	17	yes
GATCAAGTTTGCCGTCCATG	202	6	yes
GATCGCCTTAACTACTGTAA	6	5	yes
GATCTTAGCCACTGAAGCAT	4	4	yes
GATCAACACTACGGTGCCAG	104	51	yes
GATCCGTGCTTCCTGCACCC	3	1	yes
GATCCTCACATGGAAAGTAC	14	15	yes
GATCCTCAACGAGGATGGCA	266	33	yes
GATCTAAGTGACAGACAACT	7	6	yes
GATCCTATGTTGCTGGAGCT	81	1	yes
GATCCTATGGGTGACTGTAC	10	2	yes
GATCCTAGTTAGAAGGCTGT	2	2	yes
GATCCTAGTGGGTCTACCAG	465	56	yes
GATCCTAGTGCTGCTCTGGC	54	17	yes
GATCCTAGTATCATTTCAAT	2	2	yes
GATCCTAGGTGTCTTCTGTT	16	3	yes
GATCTGAAAGGAATGGAATG	19	4	yes
GATCCTGCACAATTTAACTC	1	1	yes
GATCCTAGAGAGAAGAAAAG	24	26	yes
GATCCTACTACAAAGCATGG	10	2	yes
GATCCTACCGCCTTTAACAA	107	13	yes
GATCCTACAGAAGGCCCACT	104	2	yes
GATCTGGAGGCCGCTGTGAG	16	5	yes
GATCCTCAACCAAGTGGAGC	9	1	yes
GATCCTAACTAGCAAGGGTT	20	2	yes
GATCTGGAGCCTCCACGATG	27	11	yes
GATCTGGAGCCCACAGACCA	56	9	yes
GATCTCTACGCACATGTGGT	2	2	yes
GATCTGGACTTGTTTTCTGG	57	3	yes
GATCTGGACTTCTGAATCTG	2	2	yes
GATCTGGACCTCACCTCTGA	62	1	yes
GATCCACTTGTGCATGTAGT	16	1	yes
GATCTGGTTGTACTGTCCAA	925	1	yes
GATCTGGAAGTTTCGTAGGC	1	1	yes
GATCTGGAAGTTGGCAGATG	277	36	yes
GATCAACAATAAACCACAGC	3	3	yes
GATCAACAACTTCTGACCTG	1	1	yes
GATCAACAAATCTCCTAGGC	4947	4251	yes
GATCAACAAAACTGTACCTG	13	6	yes
GATCAAATTGGTCTTCACCT	31	2	yes
GATCAAATTGGTACAGAAAT	48	1	yes
GATCAAATGTGCCATAGCAC	79	2	yes
GATCCGTGTCCCTGCGTGCA	287	10	yes
GATCAAATGCTCTTATCATT	10	1	yes
GATCCGTGGGCCTGGCCTCC	375	1	yes
GATCCGTGGACAGTCTTCAC	65	11	yes
GATCAAATGAGAACACTGCT	84	15	yes
GATCTGGAAGAGACTTTGGC	51	47	yes
GATCTGGAACCTGGTGTGCG	128	38	yes
GATCTGGAACAGTTTTTGGC	4	3	yes
GATCTGGAAAGTGAACAAGA	3	3	yes
GATCTGGAAAGCTCTGGGGA	60	15	yes
GATCTGGAAACACTGTAGCA	18	16	yes
GATCCGGGTGTTGTGCCTAA	6	1	yes
GATCTGGAAAACGCTGGAGA	12	3	yes
GATCTGGAAAAAGCAACTCC	14	13	yes
GATCTGCTTGCTTTTCAGTT	27	4	yes
GATCTGCTTGCCAGGCCACT	67	7	yes
GATCAAGAATTTGGTGTGGA	1403	5	yes
GATCTGCTTCCAGGTCCTCA	15	5	yes
GATCTGCTGTCCAGAGCAAG	164	16	yes
GATCTGCTGCTGGTGCTTGC	108	18	yes
GATCCTAGAATGTTTGTAAG	36	12	yes
GATCCCCTTTCTCTATGTCT	290	10	yes
GATCAAATCACTGGCAGACA	87	13	yes
GATCAAATCAAGACCAATCC	55	9	yes
GATCAAATATGTGGAGATTT	3	3	yes
GATCAAAGTTGTTTCACTGT	30	2	yes
GATCAAAGTGCCAACAGCGG	8	8	yes
GATCAAAGTGAGGGAAGCGG	49	2	yes
GATCAAAGTCTCCATAGTTG	206	18	yes
GATCAAAGTCATTGCGGTTA	55	4	yes
GATCCGGGCAGCCCAGGAAA	19	4	yes
GATCAAAGTACTTGTTAGGG	15	2	yes
GATCAAAGGTTTAAAGTCTT	6	5	yes
GATCAAAGGCTTCAATCACA	24	2	yes
GATCAAAGGAGACTGGCAGC	35	1	yes
GATCAAAGGAGACAGACAGT	6	6	yes
GATCCGGCCCTACTGTGTGT	124	8	yes
GATCAAAGGAAAGGGGAGGG	396	26	yes
GATCAAAGCTGGCAAGGTTC	8	8	yes
GATCAAAGCTGGCAAGGTAC	705	19	yes
GATCAAAGCCCGGAAAGGCA	1806	40	yes
GATCAAAGCCACGGGGTCAG	171	21	yes
GATCAAAGCCAAGTATCCTG	128	4	yes
GATCAAAGCCAAACCCTTTC	13	3	yes
GATCCGCTGTACTCTCCTCC	118	23	yes
GATCCGCGCTGAGGAGCAGC	2	2	yes
GATCTGCTGACAAGACTTGA	9	10	yes
GATCCGCGAATGCTCGGAGG	1308	24	yes
GATCTGCTGAAGGAGAAAGC	24	4	yes
GATCTGCTCTCGGGCCTCGC	13	2	yes
GATCTGCTCCCTGTATGTGC	5	1	yes
GATCCGCAGTGGCATGTTCT	686	6	yes
GATCCGCAGCGCCTCTTCTT	113	2	yes
GATCCCTGTCTAAGCTAGAT	12	11	yes
GATCCTAACTTACTCCATTT	3	3	yes
GATCCGTTGCTGACCTTGCG	48	0	yes
GATCTGCGCTCCGAACTATC	4	0	yes
GATCCCAGCCCACAGGATGT	19	7	yes
GATCAAAGAGTTCAGCAAGA	18	1	yes
GATCAAAGAGGCTGCTGTCT	89	0	yes
GATCAAAGACTTGGAGCCTG	3	3	yes
GATCAAACTTGGCAGTGGTG	2	2	yes
GATCAAACTGAGTCTGAAGG	190	2	yes
GATCCGCAAGTTTTCTATGA	20	5	yes
GATCAAACTAATCAGGCATC	76	7	yes
GATCAAACGAGTTGTGTGTC	9	2	yes
GATCAAACCAGCCTGTTTTT	9	2	yes
GATCAAACAGTAAAGGTGTG	29	10	yes
GATCCGAGAAAGAGAGAGGC	5	4	yes
GATCCGACTGCAAAATTCAT	28	1	yes
GATCCGAATGGGTCGACTGA	197	0	yes
GATCAAAATGTTTGTTGCTT	4	2	yes
GATCCCTTTCACACACCTGC	6	3	yes
GATCAAAATGTGGTGCCAGA	102	6	yes
GATCCGTGTGTGAACTAAAA	13	1	yes
GATCCCTATGAGCCCCTCCC	4	0	yes
GATCCGTGGTATCAGTGGGA	4	3	yes
GATCCCTGTGCCTAGCTGCT	17	2	yes
GATCAACTCAGATTTGGCTC	4	3	yes
GATCCGTGACATCGAGGAAG	13	1	yes
GATCTGCCTGAAACCAGGGG	39	4	yes
GATCCGTGAATTCTCCTTAT	8	1	yes
GATCTGCCTCCCAAGTGCTG	17	0	yes
GATCTGCCTCAGTCCACAAG	48	7	yes
GATCCGTCACAGAGAGCAGG	2	2	yes
GATCCAGCCTGGTCTACAGA	3	3	yes
GATCTGCCGAAGCGGGCTTG	10	1	yes
GATCCCCGGTGCTCTTCGTT	35	11	yes
GATCTGCCCCTGACCCTCCA	9	10	yes
GATCACTGTCCCCATGTGAA	2	2	yes
GATCAAAATGCTTGGAGAAA	18	1	yes
GATCAAAATGCCTGAGCTGT	14	3	yes
GATCAAAATGAGGCAGAGGA	254	25	yes
GATCAAAATCGCAGTTACTG	203	32	yes
GATCAAAATATGCTGCAGAC	276	33	yes
GATCAAAAGTGCCCAAGAAA	31	4	yes
GATCAAAACTTAAGCCAAGG	4	0	yes
GATCAAAACTCAAGAAAAGG	1	1	yes
GATCCCTGGTCCTTAGGTGG	85	2	yes
GATCAAAACCCGAAATAGAG	56	13	yes
GATCAAAACAGGTCCAGAAG	11	4	yes
GATCAAAACACGATGTCCAA	13	0	yes
GATCAAAAACAAAAGCGAAA	24	0	yes
GATCTGCCCACTGTCCTCAT	3	3	yes
GATCCGGGCGTCGGCAGAGC	33	5	yes
GATCTGCCAGGAACATGAGA	42	3	yes
GATCTGCCAGCCGTACATCC	69	1	yes
GATCCCTGATTGCCTCCATG	605	7	yes
GATCCCTGATGCAAAAGAGA	209	5	yes
GATCGCTCTTTTGGAGGAGG	8	7	yes
GATCCGGCTCCAGATTCAGG	2	2	yes
GATCTGCAGTTGCTCCAGCA	9	2	yes
GATCTGCAGTTGAACTTTTT	1	1	yes
GATCTGCAGTTCCTGGAAGG	74	5	yes
GATCCCAGCCATCTCAGCCT	9	10	yes
GATCTGCAGGTGCCTGGGAA	87	10	yes
GATCTGCAGGCTCTTGGCTC	12	11	yes
GATCCAGGACACAAAGAAAC	2	2	yes
GATCCAGAGCGAGCATCCAT	1	1	yes
GATCAGCAACTTCTGAGTGG	1	1	yes
GATCATAGCCAAAGAATTTG	17	2	yes
GATCCCTCTGCAAACCAAAC	73	21	yes
GATCCCTCTCCCAGCTCTTC	225	74	yes
GATCCCACAGGAAGTCAAGA	14	7	yes
GATCTGCAGGAGGATGGTAA	96	13	yes
GATCTGCAGGAGGATGCCTG	258	5	yes
GATCTGCAGGAGCCGTTTGC	16	5	yes
GATCTGCACTCGGTACCCTC	95	14	yes
GATCAAGACTGTGGATGGCA	31	6	yes
GATCACTACTGGCACTTTTT	15	0	yes
GATCCCTCAGTGTAGCATAG	102	8	yes
GATCCCTCAGTCTTTATGAG	25	3	yes
GATCCCTCAGCTTTCTCCAA	11	4	yes
GATCCCTATTAAAGGCCTGC	224	14	yes
GATCTGATTTTGACCAAGAT	18	2	yes
GATCCCGTCAACTTCAAGCT	15721	67	yes
GATCTGATTTTCCCCCTGTT	12	6	yes
GATCCCGGGGGCTCCAGGAA	71	2	yes
GATCCGCAGACGTCACTCTG	102	46	yes
GATCCCGGGGCAGTCCAGCC	73	8	yes
GATCTGATTGCCACTTTGCT	2	2	yes
GATCAAATTCCCACTGCCCC	928	72	yes
GATCTGATTCCCGCAGGTTC	79	12	yes
GATCCAGCCTGGGCTAGCAA	10	1	yes
GATCCAGAAAGAAAATGTCT	3	3	yes
GATCTGATGCTTCTTCTGTG	3	1	yes
GATCCTTTGGACCGGGGCTT	28	30	yes
GATCCCGGGCAATGCTTTCA	13	12	yes
GATCTGTGAGATGAAGCTGG	152	9	yes
GATCTTCGCGGGCCTGGCCT	20	19	yes
GATCCCCTTGGGATTAAAGG	11	10	yes
GATCCTTCCACCAGCATCAA	6	0	yes
GATCTGAGTTCCCGAAGCAA	4	4	yes
GATCCCTTTCCTTTAGCAGT	6	0	yes
GATCTGAGTGGCTAGCAGGG	20	19	yes
GATCCTGCTCCTGTCTTTTC	30	8	yes
GATCTGTCCTTTGTGTGCAG	8	5	yes
GATCCCCTGAGAAGCTGTAT	117	18	yes
GATCCCCGGCGTCTGTTTGA	2233	103	yes
GATCCCCCAGCCAGGCCAAA	18	16	yes
GATCCCCCAAGTTCAAGCCA	6	5	yes
GATCTGAGGCTGAGGGTATA	45	0	yes
GATCTGAGGAAGACATTTTG	10	9	yes
GATCTGAGCCCTGTGCCTTC	52	9	yes
GATCTGAGCCCCCTGAGGTT	77	2	yes
GATCTGAGCACGTCCCGCTG	17	4	yes
GATCCCTGGAGCCACCAGCT	117	12	yes
GATCTGAGATGAGCAGTGAC	14	1	yes
GATCCCTGCTTTCATGGAAG	12	5	yes
GATCTGAGAAGCTGTGATGG	28	9	yes
GATCCTAACCGTGTTACAGA	6	1	yes
GATCTGAGAAACGGGGAAGC	23	5	yes
GATCTGACTGCAAAGCTTGT	33	3	yes
GATCTGACTCCCTCTTCTGT	888	19	yes
GATCTGACTCCACTGCCCAG	4	4	yes
GATCTGACTACCATTTACTG	2	2	yes
GATCTGACGCCGAGGAGGTA	114	25	yes
GATCTGACCTGTTAACCCAT	13	9	yes
GATCTGACCTGGGTCCTGAC	30	9	yes
GATCTGACCTCAGGTTCCCA	5	1	yes
GATCTGACCGGCTGCTGTAC	8	8	yes
GATCCCTATGGACACTGACA	55	6	yes
GATCAGCACCTGCATCCTGC	7	3	yes
GATCTGCTTCGGGGACGGGC	10	5	yes
GATCTATTTTTGCACTGGAA	76	3	yes
GATCCAGCTGCAATGACATT	3	1	yes
GATCTGCTGTGTGTGTTTAG	5	1	yes
GATCCACTTGAAACCGGGAG	12	2	yes
GATCCACTTCAGAAGCAGCC	129	10	yes
GATCCACTGTTGTCCAGAGG	72	8	yes
GATCCACTGTGTGTCTGGTA	3	1	yes
GATCCACTGTCTTCCTAGAG	124	10	yes
GATCCACTGTAATGTATTAT	6	0	yes
GATCCACTGGGCCAAGGAGC	74	19	yes
GATCCACTGGCTGGATATAG	58	15	yes
GATCCACTGGAGATACAGGT	146	16	yes
GATCCACTGCTGGAAGTACC	591	35	yes
GATCCACTCTTTTCATACCC	54	3	yes
GATCCACTCGGGGGCTGTGA	10	2	yes
GATCCACTCCTGCAGAGCAC	69	3	yes
GATCCACTCCAGGCTGCGAG	187	12	yes
GATCCACTCAGACGAACAGT	4	3	yes
GATCCACTACTACCAGGGAC	9	3	yes
GATCCACTAATGCAGCTGGT	67	28	yes
GATCCACGTCTCGTCGTCAG	1657	151	yes
GATCCACGGGGCACCCGCAC	27	0	yes
GATCCACGGGCTGGAATCTG	32	11	yes
GATCCACGGACACCAAGTTA	298	40	yes
GATCCACGCAGCCATCTTGG	3	3	yes
GATCCACGACTACTTGGACA	1	1	yes
GATCCACGACAGAGTGGAGA	13	1	yes
GATCCACCTGTGGTGCTAGT	25	7	yes
GATCCAACTGCCTTTGCCTC	87	27	yes
GATCAGAGCTACACAATGGC	11	2	yes
GATCAGAGCCGCCTGACTTC	188	13	yes
GATCAGAGCATAGCCTATGT	46	11	yes
GATCAGAGCAGGAAGTTTTC	141	25	yes
GATCATGTTCCGCCAGCGGT	13	1	yes
GATCCACCTGCTTCTCCCTT	59	9	yes
GATCCACCTGCTGCTGCCTC	506	32	yes
GATCCACCTGCCTGTGCCTC	12	4	yes
GATCCACCTACTTTTTCAGC	25	7	yes
GATCCACCTACCTGCCTCTC	12	13	yes
GATCCACCCTGAAAGTGTCT	6	1	yes
GATCCACCCCTATCTGAGAA	21	1	yes
GATCCACCCACCCTGGGCAT	70	21	yes
GATCCACCCACCCCTGCCTC	64	6	yes
GATCCACCATCTGTAATGTC	32	13	yes
GATCCACCAGTGCTTCTGCT	204	14	yes
GATCCACCAGTCCTTGAAGC	42	3	yes
GATCCACCAGGATGTTTGAT	67	2	yes
GATCCACCACATGTGCCAAA	280	15	yes
GATCCACATTTGCTGGTTTG	58	13	yes
GATCCACATTGCTGTCCTAT	18	2	yes
GATCCACATTCTCCATTCTA	39	11	yes
GATCCACATGTGCTCGCAAA	60	13	yes
GATCCACATGTACCATCAAC	70	21	yes
GATCCACATGCGTGTAGCAG	467	14	yes
GATCCACATGAGGAGATACT	125	15	yes
GATCCACATCTCCCTCCCCT	18	0	yes
GATCAGACCGTGGCGGTTGG	7	6	yes
GATCCACAGTCCCTATGTGT	21	1	yes
GATCCACAGGGTACCTCCCT	192	1	yes
GATCCACAGGCAGTTGTGCC	13	3	yes
GATCCACAGGAGGGTTCCAA	27	1	yes
GATCCACAGCAAATTGAACA	3	1	yes
GATCCACAGATTCTGCCTGT	20	2	yes
GATCCACAGACAGCAGGAGG	93	24	yes
GATCCACAGAAGCACTGCAG	30	6	yes
GATCCACAGAAGACCTGATT	12	11	yes
GATCCACACTTCTGAAGACT	39	3	yes
GATCCACACTGCCACTAAAA	144	19	yes
GATCCACACGGAAGGGGAAA	11	3	yes
GATCCACACCTGATGGCTCC	6	6	yes
GATCCACACCTGAAATGCTA	8	2	yes
GATCCACACCCTAACTCCCA	24	9	yes
GATCCACACACGACTCTCCA	60	2	yes
GATCCACAAGTCTTAGCTGT	266	15	yes
GATCCACAAGCGACTCATTG	2122	260	yes
GATCCACAACCTGATTCCCG	87	2	yes
GATCCACAAAGGCAGAGCCC	15	7	yes
GATCCACAAAACCAATAAAA	276	30	yes
GATCCAATTGTGGTGTTCTG	15	14	yes
GATCAGAAGGCTGAGCACTG	20	19	yes
GATCAGAACAGAACAGGTGA	3	3	yes
GATCAGAACACCCCACATTT	6	6	yes
GATCAGAAATGGCGCCACGC	6	5	yes
GATCTGCCACTGAAGTAGAC	6	6	yes
GATCCAATGGTTTTGCCTCA	4	4	yes
GATCCAATGCTCTATCAAAC	1	1	yes
GATCCAATCTTTGTCTTAGG	39	6	yes
GATCCAATCGACTGGGTTTC	189	6	yes
GATCCAATCCCTGTGCAGCA	56	0	yes
GATCCAAGTTTGGATAATGA	54	5	yes
GATCCAAGTTGTACATGAAT	1	1	yes
GATCCAAGTTCGAAACATGG	9	3	yes
GATCCAAGTGTTTAACCATA	186	41	yes
GATCCAAGTGAGTCTATGAA	17	7	yes
GATCCAAGTCCAGGAACCCT	498	13	yes
GATCCAAGTCATGATTTGAA	530	45	yes
GATCCAAGTCACCCCCCGAA	61	16	yes
GATCCAAGTATTGGCACCCA	10	9	yes
GATCCAAGTATGAGATGGCT	1	1	yes
GATCCAAGTACTACCATAGG	16	0	yes
GATCCAAGTACACCTAAGGG	79	4	yes
GATCCAAGGTCAAGGCAGAG	269	23	yes
GATCCAAGGCCTCAGGTCAC	743	52	yes
GATCCAAGGAGTGGTACCCA	36	4	yes
GATCCAAGCTCTGGGAAGCA	3	3	yes
GATCCAAGCTCATCATTTGC	6	1	yes
GATCCAAGCGTTACAATCGC	5	1	yes
GATCATTCCCACAGCCAAAA	6	5	yes
GATCATGTGCCTACCCTGAC	3	3	yes
GATCCAAGCGTGAGCCAGTC	167	5	yes
GATCCAAGCGGACAGAGTGA	18	4	yes
GATCCAAGCAGGCCCCTTAT	59	24	yes
GATCCAAGAGGAGGAGCACA	48	5	yes
GATCCAAGAGCCCACACAAG	2	0	yes
GATCCAAGAGACCACCTTTG	4	2	yes
GATCCAAGACCAGGGTGGCT	68	8	yes
GATCCAAGAAGTCAGTCGGC	5	1	yes
GATCCAAGAAGAAAAGCAAG	61	1	yes
GATCCAAGAAAGGAAGAAGA	9	4	yes
GATCCAACGTGTTAGCCTTG	88	21	yes
GATCCAACGTGGTCTTTAAG	28	8	yes
GATCCAACGAGTAGGAGTGT	83	11	yes
GATCCAACGAAAAACACTTG	55	2	yes
GATCCAACCCCACCTCAAGT	57	9	yes
GATCCAACCCAATTCAGTAT	29	2	yes
GATCCAGCACGCTCAACATC	28	1	yes
GATCCAACCAACCTGAAGAA	18	7	yes
GATCCAACATTGTCTTCTGG	4	0	yes
GATCCAACATTGACTTTCTT	2	0	yes
GATCCAACATGGAAGGTGTA	147	50	yes
GATCCAACAAAGGTTGTGAG	357	28	yes
GATCCAACAAAACACGCAGG	100	14	yes
GATCACTTCCTTCTGGAATC	9	3	yes
GATCACTGTGGCGTCTTGAA	2	2	yes
GATCACTGTCGTGTTTGGTA	1	1	yes
GATCATGGTTCGGTGGCAAT	73	3	yes
GATCACTGGAGGCCAGAGAA	18	17	yes
GATCACTGGAGCAGGCCTCC	46	7	yes
GATCATGCTTACCCTGGACT	44	7	yes
GATCCAAATGGGATTTCCCT	6	2	yes
GATCCAAATCTTCCAGGCCC	17	5	yes
GATCCAAATATTGTCATAGC	42	10	yes
GATCCAAATACCCAGGATAA	3	3	yes
GATCCAAAGTTGGCCAGCAT	246	28	yes
GATCCAAAGTCACACCTCCA	180	36	yes
GATCCAAAGGCAGCAAGAAG	404	243	yes
GATCCAAAGCTTTCCCATTT	40	8	yes
GATCCAAAGCTGCTTAAATC	694	115	yes
GATCCAAAGCTCAGGAGACA	12	0	yes
GATCCAAAGCCCCAGTAGAA	46	9	yes
GATCCAAAGCAGTGCTCCCA	100	6	yes
GATCCAAAGAGAGAAAGAGC	87	18	yes
GATCCAAAGACTCAGGTGTT	26	4	yes
GATCCAAAGACACAGTCTGT	252	12	yes
GATCCAAAGACAAGAAGGAA	3	3	yes
GATCCAAAGAAGACAAAATG	74	1	yes
GATCCAAACTTAACGAGCCC	37	9	yes
GATCCAAACCCCAGTGTACC	121	17	yes
GATCCAAACCCAGAGACCAA	6	5	yes
GATCCAAACAAGAAGACTGA	16	1	yes
GATCCAAACAAAGACACAAG	80	0	yes
GATCCAAAATGTGGCATTTT	21	5	yes
GATCCAAAATGCTACTGTTA	63	19	yes
GATCCAAAAGGTTACTGAAA	826	98	yes
GATCCAAAAGGAGACTTCTA	120	21	yes
GATCACTGCAGCCCCAAACT	68	13	yes
GATCCCGCCAAAAGAATTAA	10	5	yes
GATCTGATGGCTTAGGGTGG	29	26	yes
GATCATGATGTGCTGCCCAG	17	15	yes
GATCTGATGCCCTCTTCGGG	80	3	yes
GATCTTCTTGCTGGTCTTGC	59	8	yes
GATCCAAAAGCCTGCTCGGT	106	2	yes
GATCCAAAAGCAGCGTTTGC	22	7	yes
GATCCAAAAGAGCCTGATGG	41	4	yes
GATCCAAAAGAAGAAAAAAA	11	12	yes
GATCCAAAACAGCAAATAGG	50	8	yes
GATCCAAAAATGGGGATGTT	47	1	yes
GATCCAAAAATGCTGGACTT	9	3	yes
GATCCAAAAATACAGCCTGC	28	6	yes
GATCCAAAAATAACCTTAAC	4	3	yes
GATCCAAAAAGCTAATAAAA	134	36	yes
GATCATTTTTCTGTAGCCAT	5	2	yes
GATCATTTTGTCGAGTGAGT	89	6	yes
GATCATTTTGTAAAGTACAG	5	4	yes
GATCATTTTCTGCCGTACCA	2	2	yes
GATCATTTTCCCAACGTTAC	15	1	yes
GATCCCCATGTTGAGCTCTC	8	1	yes
GATCACTCAGGGTGGGCAGT	23	9	yes
GATCACTCAGGACGGTACCC	9	5	yes
GATCACTCACGAGAACATCT	3	1	yes
GATCATCGGCAAGGTGGAAA	2	2	yes
GATCACTAAAGGGTTTCCTG	96	12	yes
GATCACGGTCACTTTCAACA	91	4	yes
GATCATTTGTCCAGGAGTGT	79	0	yes
GATCATTTGGTGCTAAAACA	7	7	yes
GATCATTTGCGTTTGGAGGT	81	8	yes
GATCATTTGATTCCCCTCCC	11	10	yes
GATCTGCGCTTCCAGAGTGA	37	35	yes
GATCATTTCTTTCTGGCCTG	166	10	yes
GATCATTTCTCGCTCAGATT	15	14	yes
GATCCAGGAGCACCGGGTCC	16	3	yes
GATCATTTCAGGTGAGCAAT	2	2	yes
GATCATTTCAGATGGGCACA	16	15	yes
GATCATTTCACTGGTGGCTG	174	29	yes
GATCTGGCTGTGACTTTCAT	2	2	yes
GATCATTTACAAACTCCAGA	33	1	yes
GATCACGGCATCGAAAGGAA	95	4	yes
GATCCTACCATAGAGCCTGA	6	5	yes
GATCATTGTGGCCCCGCCCC	215	25	yes
GATCATTGTGAACACCTCGT	6	6	yes
GATCATTGGTTGAATCGGTT	15	0	yes
GATCATTGGAGAGGGGTCTG	28	5	yes
GATCATTGCCACGGAAAACA	32	4	yes
GATCATTGCAGTCTGAGGCT	4	0	yes
GATCATTGAGAGCAAGCGAG	13	8	yes
GATCATTGACAAACTGGAAG	2	2	yes
GATCACCTAGGGAGTGTGGG	6	5	yes
GATCACCTAGATGACACTTG	4	3	yes
GATCACCGCCTGCACCGCAG	207	17	yes
GATCATACCCGTCCCTCTCT	5	3	yes
GATCACCGACCGCATCGAGG	27	25	yes
GATCACCCTGTCTCTTTACC	33	14	yes
GATCACCCTGGGCCTGGTCA	478	119	yes
GATCACCCTCAGCTGAAGAC	12	4	yes
GATCTGAGAGGAGTGTGTGG	1	1	yes
GATCACCCCCAGGAAGAGTA	10	9	yes
GATCACCCATCTTCATTACT	1	1	yes
GATCCCTGAGACAAAGAAAA	5	5	yes
GATCCCTGGAACCTGCAGTT	10	1	yes
GATCATTCTCCAAAGGCAAC	339	17	yes
GATCATTCCTAAGTTTTGAC	1	1	yes
GATCATTCCGAAAAAAAAAA	6	2	yes
GATCATTCAGGACAAAGGAG	142	89	yes
GATCATTCAGACAGTACATT	36	0	yes
GATCATTAGGGGTTTGGTCT	58	9	yes
GATCATTAGCCCACATACCC	8	9	yes
GATCATTAGCCAGAAATCAA	11	10	yes
GATCATTAGCATGCCAGGAA	31	9	yes
GATCATTACACGGAGAACAC	6	5	yes
GATCCAAACGTCAAGTCAAT	14	4	yes
GATCCCTCCTCAGGCATGTG	2	2	yes
GATCGAGCTCAGAGGCAAGG	5	5	yes
GATCCCTTCCCTCCAAACTA	85	0	yes
GATCCTTGTCCTCACTCTCC	5	4	yes
GATCCCCAAGGCTACTCTGG	2	2	yes
GATCGGAGCCAGTGGGGTGG	3	1	yes
GATCAAGTTCTACAGTCAGG	3	1	yes
GATCCTTCTGAATGCCTGCT	106	8	yes
GATCAATAGGAGCAGTTGTG	13	4	yes
GATCAAGGCTCCCGGTTTGC	2	2	yes
GATCTGTGGATGGGAAGGCA	9	8	yes
GATCTGGGTGCTTCTCATTT	11	6	yes
GATCTGGATTTTAGGTGGTA	57	21	yes
GATCTTTGAGGAGGGTTCCT	13	12	yes
GATCCTTGCAATACCCTGTC	6	6	yes
GATCCACAAGAAAGAAAGTG	2	2	yes
GATCCTCACGTCCTTTGTGG	10	6	yes
GATCTTCCAGGCCCGGCTCA	24	22	yes
GATCCCCAATATGCTGTTGA	27	13	yes
GATCCCCAAGGCAGCTACCA	19	17	yes
GATCTGGGGGGTCCTCACCT	5449	11	yes
GATCTGGAAGGGCCTAAATG	20	5	yes
GATCCCTGGCAAAGCCCTCT	2	2	yes
GATCCCAGTGGATGAGCATG	199	22	yes
GATCTGACCCACCACGGAGA	46	5	yes
GATCTGACCAGTTTTAACAT	111	6	yes
GATCTGACAGGACCGCAGAG	10	11	yes
GATCCCGTTCCTATAGTCCA	3	3	yes
GATCTGACACTCTTCTGGAG	27	5	yes
GATCCCAGCACTTGGGAGGG	24	15	yes
GATCCCAGCACCGAGGGGAA	395	36	yes
GATCTGAATGGGTACCGAGG	2	2	yes
GATCAGGCCTTCCTCCAGTT	3	3	yes
GATCTGAATGGCCTCAAAGA	68	8	yes
GATCTGAAGTCTTACAAAGC	7	1	yes
GATCCCAGAATCCAAGAAGT	39	1	yes
GATCCCACTGCACCGCCATT	61	3	yes
GATCCCACTGCACATAGGAC	9814	401	yes
GATCCCACGGGGTGCAGTGA	892	41	yes
GATCCCACGAAGAATTCTTC	134	2	yes
GATCCCACCTAGCAGCCACC	699	39	yes
GATCTGAAGGGGTGCCCTAT	48	5	yes
GATCAAACTGGCCTGCAAAA	8	1	yes
GATCTGAAGGAGTCCAGGGT	30	5	yes
GATCTGAAGAGGAATCTGTA	49	6	yes
GATCTGAAGAATTTTGAAAG	50	3	yes
GATCTGAACTTTGTACAGGA	44	2	yes
GATCCCCTCCCTCATGTTAA	7	6	yes
GATCAAACAACCCAACAGGA	7325	836	yes
GATCCCCGTGTCTGTGGAAA	84	14	yes
GATCTGAAAGTAGACTCTGC	14	13	yes
GATCACTTTCTGAGCTGTAA	3	3	yes
GATCCCAAGTTTTTCCTTAA	210	8	yes
GATCTGAAAATGTGTCTAAG	31	4	yes
GATCCCAAGACCACCCACCT	33	1	yes
GATCTGAAAACCATGCCTGA	3	3	yes
GATCTGAAAAACAACTCCTA	73	1	yes
GATCTCTTTTCCTGACCCTC	209	7	yes
GATCCCAACAACATAAAAAC	2	2	yes
GATCCCAAAGCCTCGTATGC	54	22	yes
GATCTCTTTCCCCGAGTTGC	2	0	yes
GATCCCCAGTCCAGGATGTG	1	1	yes
GATCTCTTCTCAGTTGATTT	7	2	yes
GATCCACAACACCCGAGTAT	24	2	yes
GATCTCTTCGTCGCCATCGT	1	1	yes
GATCTCTTCGTCGCCATCGA	37	1	yes
GATCTCTGCTCACTGCTAAT	11	2	yes
GATCCATTCTGACGTGTGGA	1	1	yes
GATCCATTCGCTGTAACATG	4	0	yes
GATCCATTCCAGAGGGACAT	32	9	yes
GATCCATGTTTTCCAGGTAT	33	1	yes
GATCCATGTTGGGGGTTGGG	136	37	yes
GATCCATGTTGACCAAATGC	17	2	yes
GATCCATGTGTTGGTTGAGA	172	13	yes
GATCCATGTGATTGGAAAGT	5	5	yes
GATCCATGTGATGGACTGCA	83	2	yes
GATCCCCAAGAAGTCTTATT	68	17	yes
GATCCATGGTGGGGCCATTT	64	4	yes
GATCCATGGTAGTCAGATAG	64	18	yes
GATCTCTGTGAGTTCAAAGA	40	2	yes
GATCTCTGTCCGAACTGTGA	35	5	yes
GATCTCTGTCCACTGTATGC	5	1	yes
GATCTCTGTCAAGGTGGTGG	7	5	yes
GATCCAGAAGGAGAAATAAC	4	0	yes
GATCTCTGGTCTCCACAGGC	32	4	yes
GATCCATGGGCCTTAGGGCT	83	8	yes
GATCCATGCCTGTAATCCAG	18	5	yes
GATCCATGAAGTTTTCAGTC	19	5	yes
GATCCATGAAGTTTCCCTAC	6	6	yes
GATCCATGAACTCTAACTCC	11	12	yes
GATCCATCTGCATTTGCGGC	2404	3	yes
GATCCATCTGCACATGGCTC	27	0	yes
GATCTCTGGGAAGGGCTGCG	5	4	yes
GATCTCTGCTATGAGGCTAC	290	45	yes
GATCACACTTTCTGAGTTAC	2	0	yes
GATCCCAGGAAGTCCCACGA	103	11	yes
GATCTCTCTGTTCTCCTGTG	27	6	yes
GATCCATAGGGAAATTGTCC	2	2	yes
GATCTCTCCCAGATGGTAAA	12	1	yes
GATCTCTCCAAAGCACACGC	191	2	yes
GATCTCTCAGGCCATGGGTC	204	12	yes
GATCTCTACCCAGATGTCAC	48	6	yes
GATCTCGTAGCTGCCTTTTT	12	11	yes
GATCCAGTTTCCTCACAAAT	25	5	yes
GATCTCGGTGGCCAGCTTCC	25	13	yes
GATCTCGGGAGATTGGCTGG	9	2	yes
GATCTCGGGAATCAGAGTTC	82	76	yes
GATCTCGGAGCTAAGTGTAT	116	1	yes
GATCTCGGAATGGACCCCAA	356	329	yes
GATCTCGCTTACAAGAAACC	4	4	yes
GATCCCACCTCCCCCCAGTC	184	11	yes
GATCCAGGTTGAATTCCCAG	9	3	yes
GATCTCGCCTTATGTTGTCC	12	2	yes
GATCTCGCCCTGTCAAGCAT	54	5	yes
GATCTCGCAGCCTTCCCCTC	208	4	yes
GATCTCGCAAGCACAAAGCC	182	17	yes
GATCTCGAGTCACAGCCAGC	280	34	yes
GATCTCGACCAGTTATACCT	24	4	yes
GATCAAAGCATGCACCTGTA	17	16	yes
GATCTCGAATCAGGTCTTTT	10	11	yes
GATCTCCTTGGAAAGCGACT	87	26	yes
GATCAGGGCCGGGAGGGGGG	14	9	yes
GATCCCAATGGAATCTATTT	23	3	yes
GATCCAGGGTGGGAAGGAAG	145	11	yes
GATCCAGGAGACTCGAAGAT	236	2	yes
GATCCAGCTTCCCTCCGAGA	227	1	yes
GATCCAGCGAGGGAGCTGCC	5	5	yes
GATCCAGCCTTCTTTCACAC	10	1	yes
GATCTCCGCCCGAGCCTACG	76	17	yes
GATCACCAACGAGAAGCCGG	19	3	yes
GATCTCTTGTAGCCTGGTCT	1	1	yes
GATCCAGCCAGGAAACCCCA	7	7	yes
GATCCAGCATCACCCAGACA	51	6	yes
GATCCAGCAGACCCAGCACA	27	9	yes
GATCCATTTTGTTCGTGGAC	24	4	yes
GATCTCCCGCAAGCCAGAGC	18	19	yes
GATCTCCCCTCTTCCTGGAT	15	2	yes
GATCCAGAGTAAAGACAGCT	68	0	yes
GATCTCCCCGAAGGAGAGAT	17	15	yes
GATCCATTGTACTACAAGTT	44	4	yes
GATCTCCCCACCACCCCAGG	25	23	yes
GATCTCCCAATTTTCAGGTT	10	1	yes
GATCTCCATTGAGGAGTTGG	6	6	yes
GATCTCCATCCAGGACTAAG	19	21	yes
GATCTCCATAATTCCAACTT	8	2	yes
GATCTCCAGGGTGGATTTCT	9	1	yes
GATCTCCAGGCTGAAGTCAG	38	22	yes
GATCCTTCTCTGTGTCAGCT	19	0	yes
GATCTCCACTCCGCCACCTG	5	5	yes
GATCTCCACCCTATGCGAGT	35	1	yes
GATCTACGTACACCTGCATC	4	3	yes
GATCTCCACACAGCACACAG	211	36	yes
GATCTCCAATGCTGGGTCTG	18	6	yes
GATCTCCAAGTCTCTCAGTC	14	1	yes
GATCTCCAACTGTGCTTTCA	75	4	yes
GATCTCCAAAGTCCTGCTAG	60	0	yes
GATCTCCAAAATCAACAACA	31	29	yes
GATCCATATCCTGCTCCACC	5	1	yes
GATCTCATTGCTGGAAGGAG	3	1	yes
GATCCATCATGCCCTGGACG	5	5	yes
GATCTCGCTGTGGATTGGAT	2	2	yes
GATCCCCTGGCACTGCCTAC	1	1	yes
GATCACCCAGGAAGAGAAAT	163	11	yes
GATCACCATCCTGATTATAT	84	1	yes
GATCTGAGAAGGAGCCAGAA	4	3	yes
GATCACCAGGAAACTTGAAA	2	2	yes
GATCAGTTCCTCTTCAGAAT	7	3	yes
GATCACCAGAAGCCATGCTC	138	31	yes
GATCATTAATGCCCTTGAAG	19	18	yes
GATCATTAAGACCCTGTATC	2	2	yes
GATCATGTTGATTCTGAAAT	6	0	yes
GATCATGTTCTTTCCGCAGG	344	49	yes
GATCATGTTCGCCTGGACAC	329	72	yes
GATCATGTTCCTGGAGGTCA	41	2	yes
GATCATGTGTCAAAAGCAAA	36	8	yes
GATCATGTGGCGTTCTCTCT	67	13	yes
GATCATGTGGATTCCAGGAA	5	1	yes
GATCATGTGGATGCCTTCCC	165	1	yes
GATCATGTGCTCACCTGCAT	30	14	yes
GATCACATGGTGACTCTAGC	6	1	yes
GATCATGTGAGCATCGTGGA	276	1	yes
GATCATGTGACAAGTGAGAG	7	7	yes
GATCATGTCTTCTCCATGTT	1259	164	yes
GATCATGTCTGAAAAATCCA	10	4	yes
GATCATGTCTCAAGGTGGCA	41	15	yes
GATCATGTCTATCTCAGGGG	55	20	yes
GATCATGTCCCACAGGCATT	131	18	yes
GATCATGTCATTGCCTGTTA	24	0	yes
GATCATGTCAGCATGAGTAG	6	7	yes
GATCATGTCAGAGGGAGATG	42	6	yes
GATCATGTACAGAGGTCTTT	31	1	yes
GATCATGTACAAGCTGATGG	43	9	yes
GATCATGTAAAGACGCTGGG	7	7	yes
GATCATGGTTCAAGTGACAA	834	84	yes
GATCATGGTGTGGCTTGTGG	24	5	yes
GATCATGGTGTCTTGTGGTT	50	5	yes
GATCATGGGTGTTGCTACCA	20	19	yes
GATCATGGGTGTGCCAGGGG	50	10	yes
GATCATGGGGTTCTGACTAT	10	9	yes
GATCATGGGGCTGGAGAGAT	7	2	yes
GATCATGGGGATGGACGGGG	555	23	yes
GATCATGGGCTTTCTGCTTC	12	2	yes
GATCAGGGGTTTCTCTGTGA	10	4	yes
GATCACAGGCCTGAGCTGGG	11	12	yes
GATCTGTCTACTTTTCCTAT	6	1	yes
GATCATGGCTGCGGCAGTAA	16	2	yes
GATCATGGCGTCTCTGCGGA	8	0	yes
GATCATGGCCTTTACGATGC	8	4	yes
GATCATGGCCTTCAGATATG	129	19	yes
GATCATGGCCCAGACCTGAG	77	20	yes
GATCATGGCAAAGGATGACC	236	21	yes
GATCATGGATGTGTGGGGAA	8	6	yes
GATCATGGACATGAAGGAAG	86	23	yes
GATCATGCTTTCTTCTCTAT	36	11	yes
GATCATGCTGTGTTCGTGAT	7	2	yes
GATCATGCTCCTGCAGCTGA	181	11	yes
GATCATGCTCCTGAGTGGCA	38	8	yes
GATCATGCTCATCTTCACTG	31	5	yes
GATCATTGGGGGAGGGTAGT	113	10	yes
GATCATGCTACCACTGCATC	138	2	yes
GATCATGCGCCTTTCTAAGC	30	5	yes
GATCACAGTGGCTATATCTC	21	14	yes
GATCACAGCTATGCCCTTTC	16	5	yes
GATCGTGTGTTGCCATTTTG	16	0	yes
GATCACAGCAGCCCAAGCTC	5	5	yes
GATCACAGAGATACTACAGT	17	8	yes
GATCATGCCGTGCTACGCTC	55	4	yes
GATCATGCCGCCCCTTAGTG	51	28	yes
GATCATGCCCCAGGACACAA	18	11	yes
GATCATGCCCAAAACAACCA	80	11	yes
GATCATGCAGTAGTTCACAG	19	1	yes
GATCATGCAGACTGTTCCTT	1246	156	yes
GATCATGCAGAAGAACGGTG	140	11	yes
GATCATGCACTGTATTCACA	3	3	yes
GATCATGATTTCCGAGCTAC	17	2	yes
GATCATGATTCTCCCTCAGC	53	8	yes
GATCATGATAGCAGCACAGA	170	7	yes
GATCATGAGTTCAGTGTTAC	16	2	yes
GATCATGAGTGTCCCACTAC	14	10	yes
GATCATGAGTGACCACAGTT	1	1	yes
GATCATGAGGGAGTTCCGGT	339	21	yes
GATCATGAGGCTGTCTGCAG	21	12	yes
GATCATGAGCCTGGAAATTC	5	5	yes
GATCATGAGCCATTTTTAAC	1	1	yes
GATCATGACTGGGAGCATGC	12	11	yes
GATCATGACGCTGGTAGATG	9	1	yes
GATCATGACCCTTAGACTCA	6	1	yes
GATCATGACCAAGAAAGGAA	4	3	yes
GATCATGACATTCCTCAGAT	41	11	yes
GATCACAGACCATGGTCTCA	43	1	yes
GATCGGTGGCTCCATTCTGG	6	6	yes
GATCATGAACATCATCCAGG	57	5	yes
GATCATCTTGTTGCGTTTCT	5	3	yes
GATCATCTTGCTGCTTGACA	3	3	yes
GATCATCTTCATCCTGGGTT	42	10	yes
GATCATCTTCACTCAGCCAG	3	3	yes
GATCCTTTCGGCTGAGCCTC	2	2	yes
GATCATCTGGTGCTGTGTCG	1	1	yes
GATCATCTGGCAAGCAGAAG	30	12	yes
GATCATCTGCCCTTTCTATC	8	8	yes
GATCATCTCACAGGACAGGG	830	68	yes
GATCACACCACTCTCAACCA	12	2	yes
GATCACACATCTGGGCAGTG	53	2	yes
GATCATCTCAAAGCCTGTTT	3	3	yes
GATCATCTACGACAGAAAGT	31	4	yes
GATCATCGTGTCGGGATGAT	88	23	yes
GATCATCGTGGGCCTTGAGC	19	1	yes
GATCATCGTGGACTCACCCT	15	3	yes
GATCATCGTCTGCCTCTTTG	5	5	yes
GATCATCGTCAGTGACGTTT	79	26	yes
GATCATCGGCATGGCATACG	907	69	yes
GATCATCGGACGGCCAGTTG	3	3	yes
GATCATCGGAAGGATAGATG	61	7	yes
GATCATCGAGTTGTGGATGG	7	2	yes
GATCATCCTTGTGTTGTGAA	122	32	yes
GATCATCCTTCAAAGGGGAT	25	5	yes
GATCATCCTGTCAGAGTTCT	3	3	yes
GATCATCCTCTCACAGATGG	25	3	yes
GATCATCCGCAAAGTTGTGA	69	5	yes
GATCATCCCGGAATTCGGCT	12	2	yes
GATCATCCAGGGCTGCCCCT	33	1	yes
GATCATCCACCTGCTCACTG	408	11	yes
GATCATCCACAAACTTCCAG	3	3	yes
GATCATCCAAGTGTTTGAGC	22	4	yes
GATCATCCAAGCTGTTGTAA	7	7	yes
GATCATCATTCGTGTGCAGA	32	2	yes
GATCATCATGCTTCCAGATG	29	5	yes
GATCACAAGATGGCGTTATC	6	5	yes
GATCAGGTCATCGCCTCCTT	460	17	yes
GATCAGGGTTAAGGAGGAGC	138	6	yes
GATCAGGGAAGCAGACATTG	99	36	yes
GATCAGGCTGTCTGGAGACT	7	7	yes
GATCAGGCGAGACATGTTCT	250	8	yes
GATCAGGACTTGAGGGTTAT	12	1	yes
GATCAGGAAATCCTAACTAC	6	0	yes
GATCATCATCTTGACAGCTT	2	2	yes
GATCATCATCATTGAATGAA	37	1	yes
GATCATCAGTTAGAGTTCTG	1	1	yes
GATCATCAGTGTGTTGGAGC	2	0	yes
GATCATCAGCTGAGGCAAGG	3	3	yes
GATCATCACTGCTGCCCTAT	17	9	yes
GATCATCAACAAGACTATCT	18	9	yes
GATCCTCTTTGCCAACCCCC	155	16	yes
GATCATAGGATTCTGATTTT	52	5	yes
GATCATAGCTTCCTGTCCCC	60	4	yes
GATCACAAACATAGCCAATG	21	3	yes
GATCAATGCCTGGACGGCTC	75	81	yes
GATCAGATGAGGCGTCCTGG	17	15	yes
GATCAGAGGCCACATAGCTT	6	0	yes
GATCAGCGTGCGCCTAGCGG	151	2	yes
GATCAGCGGTGGGAATGACG	31	29	yes
GATCAGCCTCTTTCCCATCA	9	3	yes
GATCAGCCCTGGCAAGGAAG	70	6	yes
GATCAGCCCCATTGCGGTGC	14	6	yes
GATCCCAGCTGTTTGGGGCT	4	4	yes
GATCAGCCAAGCCAGACTTG	11	10	yes
GATCAGCATTCCACCCCGGA	36	4	yes
GATCATAGCTGATGGCCTTC	45	3	yes
GATCATAGCTCTAGCAGAAC	46	9	yes
GATCATAGCTACTTTGTGCT	15	0	yes
GATCATAGCAAAGATGGACG	166	26	yes
GATCATAGATTGGGCTACAT	43	5	yes
GATCATAGATGACTTTGCCT	95	0	yes
GATCATAGAGGTGTGGCTTT	12	2	yes
GATCATACGTAGTTGTGAAA	3	3	yes
GATCATACGCCCAGGGAGAG	36	4	yes
GATCATACCCTCTCTGGCTT	18	7	yes
GATCATACCAAGAGGTGAGG	729	50	yes
GATCATAACAGTTCTGTGAA	16	1	yes
GATCAGAGGAGCAAGAGAGC	8	1	yes
GATCAATCAGAGGGATTACC	32	35	yes
GATCAAGTTGGGAGTGGCAG	2	2	yes
GATCAGCAGGTGGTTATCAA	22	8	yes
GATCAGCAGCCGGAGACGAC	61	6	yes
GATCAGCAGATGTTGGTGGC	27	6	yes
GATCAGCACTGGGGTCAACG	78	16	yes
GATCAGCACTCTCGGTATGC	121	32	yes
GATCAGCACGCTGACTCTTT	6	1	yes
GATCAGCACCACACTGGACT	21	5	yes
GATCCCAGAGGAGTCAGAAG	20	2	yes
GATCAGAGGCGCATCGAATG	34	6	yes
GATCAGAGCCCTGTCGATGG	5	1	yes
GATCAGAGATGGGCTCTGTG	7	6	yes
GATCAGAGAAACTGGGTAGA	52	1	yes
GATCAGAGAAACTCTGACAT	71	12	yes
GATCAGACTAACCCCGGAGT	139	3	yes
GATCAGACGAGGTTCTCTCT	27	3	yes
GATCAGACCATGGTACTGGC	34	2	yes
GATCAGTTTTTGGTGTCATT	924	161	yes
GATCAGTTTTGGTCTTGATG	28	3	yes
GATCAGTTTTGGAGTGCAGC	11	10	yes
GATCAGTTTTGACCTCTTAT	5	5	yes
GATCAGTTTGTTTTCACTGT	140	8	yes
GATCAGTTTGGTGGAATAAG	8	8	yes
GATCAGTTTGCCAATCATCT	81	8	yes
GATCAGTTTGAGCCTACCTT	44	41	yes
GATCAGTTTCTGTGACTGTA	21	3	yes
GATCAGTTTCAGCCAGGAGT	11	10	yes
GATCAGTTTATCAGTCCGTT	19	6	yes
GATCAGTTGGTTGATTCCTA	18	9	yes
GATCAGTTGCCAAATGATTG	33	5	yes
GATCAGTTGATATCTGGGGG	4	4	yes
GATCAGTTGAAACTTGGAAA	333	17	yes
GATCAGTTCTTATCTACTTG	1	1	yes
GATCAGTTCTGAGCCGAGGA	35	5	yes
GATCAGTTCCTGGTATACAG	2	2	yes
GATCAAGTGCTGTGACAGTG	4	3	yes
GATCAAGTGCAATGGTTTGG	43	8	yes
GATCTTTGATTCTGCCGCCC	12	5	yes
GATCAAGGTGGCGGATTTTG	2	2	yes
GATCAAGGTGGCGGAGGACG	1	1	yes
GATCAAGGTCGGAAAGAAAT	747	11	yes
GATCAGACAGTATCAGGGCT	41	7	yes
GATCAGAATGAGGGACCTCC	11	2	yes
GATCTGTGCAGGGTATTAAC	2368	122	yes
GATCAGAAACCCGAGCTGAA	82	4	yes
GATCACTTTGACTTCATCCT	5	1	yes
GATCACTTGCTGCTCTTGCA	4	4	yes
GATCTGTGCAAAAGCAGTGA	845	9	yes
GATCACTGCTCTGGACCTAA	33	20	yes
GATCAGTTCCATGTTACACA	12	11	yes
GATCAGTTCAGTGTGCATCG	75	0	yes
GATCAGTTCAGACAACTGTG	18	16	yes
GATCAGTTATCTTGAGCCTT	2	2	yes
GATCAGTTATCTAGGTTAAC	5	4	yes
GATCTCTATAGTGGGCTAAT	36	6	yes
GATCTCCGTTGCTCTCTGCT	2	2	yes
GATCAGTGTTTCTGCGAAGG	22	4	yes
GATCAGTGTAGTGACTCCAG	22	20	yes
GATCAGTGGCTTCAGTCACA	32	30	yes
GATCGGCGTGACTACCCCTT	19	17	yes
GATCAGTGCTGTACTTCACT	68	3	yes
GATCAGTGCTCTGCTAACGC	671	35	yes
GATCAGTGCCTTTGTTGGCA	141	2	yes
GATCAGTGCATTTCAGAGTT	6	6	yes
GATCAGTGCACACAGCTCTC	2	2	yes
GATCAGTGAGTGTGAGTGTG	17	2	yes
GATCACTCAGTAACTGCTGG	63	11	yes
GATCACTCAGGATTTGTTCC	1	1	yes
GATCACTACTCCTTAGACGT	10	5	yes
GATCACGTTTGTGTTGTCTT	7	7	yes
GATCACGTTGAGTTCTATTT	7	5	yes
GATCACGTTCTGATTGAGCT	8	3	yes
GATCACGTGTATGTGTCGTG	26	10	yes
GATCACGTGGGCTGCGTTTC	128	14	yes
GATCACGTGGCTGTTCTTGT	93	10	yes
GATCACGGTGCCTGGTTACA	237	47	yes
GATCACGGGAGCTGAGCAAC	5	3	yes
GATCACGGAGCTGGAGTTCG	79	14	yes
GATCACGGAGCCAAGGAAGA	38	36	yes
GATCACGCTATGGGCAGGAG	2	2	yes
GATCTGATGCCCTTTTCTGT	54	3	yes
GATCACGCAGTCTTAGAAAT	14	7	yes
GATCACGACGACGCCCACGC	24	2	yes
GATCACGAATGGCTCTGGGG	11	10	yes
GATCACCTGCCAGACTGTTA	5	1	yes
GATCTGTCTGTTTAGTGGAT	22	6	yes
GATCACCTCCCAGATTCTGA	33	3	yes
GATCACCGTTCCCATCCCCG	5	1	yes
GATCACCCACCCATCAGCCA	52	5	yes
GATCTCATTATGGGTGGCTG	6	6	yes
GATCACTGTCAGCAGGACTT	6	1	yes
GATCACCAAGTGGAATGAAA	6	6	yes
GATCACCAAGGAATCCAAGG	19	4	yes
GATCACCAACTCACGTCATG	356	40	yes
GATCACCAACCACCCCAGCA	88	14	yes
GATCACCAAAAACATCCAGG	7	7	yes
GATCACAGTGGAATCTTCGG	66	5	yes
GATCACAGTGAGATTCTCAT	6	0	yes
GATCACAGGTCTGAGCAAAG	17	11	yes
GATCACAGGATTGGCGTCCC	19	3	yes
GATCACAGGACTTGACCCAT	53	2	yes
GATCACAGAGGGGCCAGGAT	7	5	yes
GATCACACTGGAACAGAACC	70	6	yes
GATCACACCTGTAGACAAGA	97	8	yes
GATCACACCCAAAGCTGTCC	22	2	yes
GATCACACAGGGAGGCCTTG	69	9	yes
GATCACACACTACTGAGGGC	8	1	yes
GATCACAAGGTGCTCCTGCA	4	4	yes
GATCACAACTGATGGCGGGT	484	3	yes
GATCACAAACACCGGTGAGA	12	4	yes
GATCAATGTCGTCATCATCC	3	3	yes
GATCAATCCACAGACGACTG	41	7	yes
GATCAATCACCAGCGCGAAG	57	6	yes
GATCAAGATTTGGCCAATTG	78	20	yes
GATCCGACCATTCAGAGTAA	1	1	yes
GATCAGGAGGTGAACAGAGA	61	5	yes
GATCACTGTGCGGATTGAGC	21	19	yes
GATCTGTGACGAGCTTATGG	3	3	yes
GATCAAGAATCCAGTCTGCT	3	3	yes
GATCAACTCAACAGCCACAC	5	5	yes
GATCAACGGACCATTATGAG	15	14	yes
GATCAACGCCATGACCTACC	17	9	yes
GATCAACCCGTGTGCATTGC	10	1	yes
GATCAACACTTTTCTCTCAG	70	4	yes
GATCAACACTCCCTGTATCT	36	4	yes
GATCAAATTCCCAGGGACAT	41	6	yes
GATCCGAATCTGTGCCCAGC	554	15	yes
GATCATTCATTGAAGCCCCT	2	2	yes
GATCCTGAAGGAAGTCCTGA	115	30	yes
GATCATGTTGTATCCCGCCT	3	3	yes
GATCCCTCTCTCACACTCCT	3	3	yes
GATCAAATACTCTGCACATA	155	16	yes
GATCCTCCTGGGCTTGAACT	18	3	yes
GATCAAACAGCTGTACCTCA	50	1	yes
GATCCCTTTATGAACCTTGT	68	8	yes
GATCTACCTCTAGCAGCTAG	4	4	yes
GATCTGGTCCTGCTCCTACC	15	2	yes
GATCCCTTCCCCTTCCACTA	63	3	yes
GATCAGGCAGCTGTTGAGTT	1	1	yes
GATCAGTGCTTAGCAAGTGC	2	2	yes
GATCAGCTCTTCCCATCCCT	1	1	yes
GATCAGTAGCCAATCAAGTG	3	3	yes
GATCAGTACGAGCGAGAAGG	3	3	yes
GATCGTCACCAACGCCCACG	1	1	yes
GATCCAGAGGCCCTAGCCAG	69	7	yes
GATCCAGAGAGCTTCCTAAA	115	0	yes
GATCCAGAATGTGTGGCAAC	3	1	yes
GATCCAGAATACTGAGCAAA	50	3	yes
GATCCCTCATGCTGTGTTGG	6	7	yes
GATCCCTCTTGGTTTGTGAC	27	9	yes
GATCCACTGCGTTTCCATGC	144	1	yes
GATCCACCTTGTGGCCTGGC	127	1	yes
GATCCACCTGTCTCTCCTTC	23	7	yes
GATCTCATGGCCAAAGTAAG	14	13	yes
GATCTCATGGCACACATAGC	20	19	yes
GATCCCTCCCATGTTGGGAG	3	1	yes
GATCCACCGTACCAGGAAGC	74	9	yes
GATCTCAGTTTTTGGTTACA	4	2	yes
GATCTCAGTCCCCGCCTGCA	64	59	yes
GATCTCAGGGCCCAATGTGC	83	4	yes
GATCTCAGGCACCAGGTAGA	31	0	yes
GATCTCAGGATGCTGAACTA	9	2	yes
GATCTCAGGAGACTTCACCA	82	13	yes
GATCTCAGAGGTAGGGTGGC	79	73	yes
GATCTCAGAGGAGAGGTGCT	24	6	yes
GATCCTGCCCCCACGCTGGG	22	6	yes
GATCCACCAAGGTAGAAAAC	38	20	yes
GATCCACCAAGAGAAGAAGA	1	1	yes
GATCCCAACAACTGCTGCAG	3	3	yes
GATCCCTGGGGCTCCCTGTC	6	7	yes
GATCCACAGGCTCCTGGGCC	6	7	yes
GATCCACACTAGTTATGGGA	1	1	yes
GATCCACACGGGCGAGAAGC	54	4	yes
GATCCACACAGGAGAGAAGC	112	20	yes
GATCCAGGACAGCCAGAGCT	15	14	yes
GATCCAGGACACAGCGTGGT	15	5	yes
GATCTCACTGGACTTGGTGT	97	9	yes
GATCCCGTGTAGCCTTCGTT	118	19	yes
GATCCAGGAACCGAAGAATG	7	6	yes
GATCTCACTAACCTGCCACC	29	12	yes
GATCTCACGGCCTGCGGGGT	27	4	yes
GATCTCACGGCCAGACAGAC	95	8	yes
GATCTCACGCCTCTTGGGGA	25	23	yes
GATCAAGCCTAGCCAGGACC	37	3	yes
GATCCAAGTTATTGGCACAC	31	4	yes
GATCCAAGTCATGATTTGAT	414	73	yes
GATCCAAGTAGAAGCTTCTA	135	74	yes
GATCCAAGGGCCCTGTATGT	17	0	yes
GATCCAAGGAGCTGGGGAGG	15	2	yes
GATCCAAGGACAAGACACCA	19	4	yes
GATCTCACAGTTAGTAGTCA	51	6	yes
GATCTCACAGGTTGGATTTA	43	16	yes
GATCTCAAGGACAGGAGGTC	15	6	yes
GATCTCAAGCGCTTTGCTCT	18	3	yes
GATCTCAAGAACAAGAACCT	24	8	yes
GATCCAGCAAATCGGGACAG	219	30	yes
GATCTCAAAGTGGCTGATGC	3	3	yes
GATCTCAAAGTCTGTTCAAA	7	6	yes
GATCTCAAAGGGAAACTGAC	5	3	yes
GATCTCAAAGGAACTTCTCC	36	6	yes
GATCAGCAAGCAGCCAGCAG	6	0	yes
GATCCAACTGACTGGCTAGC	433	54	yes
GATCCAACTGACAGATGAGG	13	9	yes
GATCCAACTCTGTAAAGGCT	25	5	yes
GATCCAACTCAGTTAGGCTT	100	12	yes
GATCCAACTCACCCCATCAG	120	130	yes
GATCCAACGCAGCACCGTCT	89	10	yes
GATCCAACCCCCTCTCCTGA	17	6	yes
GATCGAGCCCCTCCGAGCCG	2	0	yes
GATCGAGCAGGCCCGGCTGC	20	2	yes
GATCAACATGAACCTGGGTG	4	3	yes
GATCCAGAGAAGGCTCAGTG	4	4	yes
GATCCAAAGACGCTAGATGT	32	7	yes
GATCCAAACGTCACAGAATT	47	10	yes
GATCTATGTCATGGCCACGC	76	7	yes
GATCTATGGAGGACGGCAGA	43	13	yes
GATCTATGAGACAGAACTGG	49	4	yes
GATCTTGGTGGTAGTAGCAA	5	4	yes
GATCCAAACAGATGAAGGCA	27	5	yes
GATCCAAAAGGAAGCAAATT	21	7	yes
GATCCAGAAACCGCAGTCAT	27	0	yes
GATCCACTTGCGTTGTGAGC	29	5	yes
GATCTAGCCTTATGCCCGGG	28	2	yes
GATCTACTTGTGTGTGTGTG	15	4	yes
GATCTACTTGCTACCAGTCT	7	1	yes
GATCCACTCTGAGGGAGAGG	6	4	yes
GATCCACTCCAGGGCTTGGA	19	10	yes
GATCTACTCCTTCAGAGCCT	14	4	yes
GATCTACTACCAGACAGACA	36	2	yes
GATCCACGGGGTGACTTCCA	17	5	yes
GATCTACGGTTCCCACGCAT	244	14	yes
GATCTACGGCCTGGACTTCT	21	8	yes
GATCCTCCCGATGCCCATCT	3	3	yes
GATCCTGTGTCTCAGCACTT	3	1	yes
GATCTACCTTGAAATCCCTC	30	9	yes
GATCTACCTGCCTCTGCCTG	13	12	yes
GATCTACCTGACCTTGTTGA	25	3	yes
GATCCACCTTCCTCTTCGTT	3	1	yes
GATCTACCTACCCGTGGTGT	30	9	yes
GATCATTGATAAGGACAGCA	9	8	yes
GATCTACCAGGTGGACACCC	87	14	yes
GATCTACAGGGCACAGAGGG	27	10	yes
GATCTACAGCGTGCCCTGGA	41	12	yes
GATCCACCAGCGTGTGCATG	13	0	yes
GATCTACAAGGTTCTAGTTC	2	2	yes
GATCCATCCCCACCAGGATG	3	3	yes
GATCAGTACCTAGCGCCCAC	39	3	yes
GATCATTCTGAAGTACATTG	10	9	yes
GATCATTCCAAGTTTCACGT	14	3	yes
GATCTAACTTAATCAGGCAC	3	3	yes
GATCTAAATGCCCAAGTTGA	18	16	yes
GATCCACACAATGGAGACCT	42	3	yes
GATCTAAAGTTACTCTGCTT	2	0	yes
GATCTAAAGTGCCTCTTTGT	15	4	yes
GATCTAAACTGTGGTGTGAA	48	5	yes
GATCAGAGAAGCAGATATTT	602	20	yes
GATCCAGAGGAGAAACTAAG	5	1	yes
GATCCTTCCCATCCCACTCT	16	2	yes
GATCGTTGTGAGCCACCATG	10	1	yes
GATCGTTGGTGTTTCAAAGT	35	3	yes
GATCGTTGGATACTCACAGA	41	1	yes
GATCGTGTCCGGCATGAAGT	347	22	yes
GATCGTGGTGCAAGGAGAGC	57	32	yes
GATCCAAGGCGGCGACCCGA	9	8	yes
GATCGTGGGATACAGCAGCA	5	5	yes
GATCGTGGGAGTGGCAAGCG	10	2	yes
GATCGTGGCTAGTGAGATAG	25	3	yes
GATCCAAGGACTGCGGTGCA	63	15	yes
GATCCAAGAGGCTGTTTTCG	34	2	yes
GATCGTGAGGATGGAGAAGG	62	2	yes
GATCGTGACGGCACTGACGT	13	4	yes
GATCGTGAAGCCGCTGAATC	41	5	yes
GATCTTTGGAGGAATCACGG	37	1	yes
GATCGTCTCCGTGCTGGTGA	3	3	yes
GATCGTCTCAGTTACGAGGC	6	5	yes
GATCGTCCCCCAGCCACCTG	21	16	yes
GATCCTAACCCCAGAAGCTC	5	1	yes
GATCGTCACCACAGTGGGAA	15	1	yes
GATCGTCAAGTGGTCAGATG	7	6	yes
GATCGTAGTAGTTCCTGTTG	9	4	yes
GATCGTACGGCTGTAACAGG	6	5	yes
GATCGTAAGTTCTGGGACGC	18	3	yes
GATCGGTGTCGAGCACGGAC	9	2	yes
GATCCAGGCCATGTTGAGAC	4	2	yes
GATCGTGGTCATCCATGAGG	7	4	yes
GATCCCACAAGCCATATTCT	31	2	yes
GATCCCGGCAGCGACACAGT	2	2	yes
GATCTAGGGATGGGAGTGGG	4	4	yes
GATCAGTGAAGTTCTGTCTT	35	7	yes
GATCAGTCTTTTCAGTATTT	109	12	yes
GATCAGTCTGAATTGAACAT	6	5	yes
GATCAGTCTCGTCTACAGAG	3	3	yes
GATCAGTCTATGAGTCAATA	95	12	yes
GATCAGTCGTAAAGGACTCA	121	18	yes
GATCAGTCCTCTAGCATTTC	130	14	yes
GATCAGTCCTACAAAGTTCC	18	19	yes
GATCAGTCCCTTCCCCCAAC	68	6	yes
GATCAGTCCAGTTTTGGCTG	46	5	yes
GATCTGCCTGCCTTTACCTC	3	3	yes
GATCGGCTGCTTTTGTCTCT	18	2	yes
GATCGCTTTAGCTTGCCTAC	27	11	yes
GATCGCTGGGAACGTGGTGG	3	1	yes
GATCAGTAGGAAGCACAGGT	8166	323	yes
GATCAGTACTGCAGTTCCTG	30	3	yes
GATCAGTACTACTGTGGTGT	3	3	yes
GATCAGTAATTGTCTGCTTG	27	25	yes
GATCAGTAATTGAACTGGAA	4	3	yes
GATCAGTAAGGATTCCTGTA	42	4	yes
GATCAGGTTTGGACTCCTTC	14	10	yes
GATCAGGTTTGCACCAAGGT	21	5	yes
GATCAGGTGTTCAAAGTCAC	31	0	yes
GATCAGGTGTCAGTTTTCTA	43	7	yes
GATCTGCGATGAACTGGGAG	515	21	yes
GATCGCATCATACGTGAGGT	34	2	yes
GATCAGTCGTGTCCTTCCCT	16	5	yes
GATCAGGTGAAGACCCTCTC	6	6	yes
GATCAGGTCAGAGATGCGGT	3371	177	yes
GATCAGGTAGAGAGAGCTTG	115	54	yes
GATCAGGTACCTTGCCTGCG	3	3	yes
GATCAGGTACAGCAGTGCCT	2	2	yes
GATCAGGTAAAGAAGCGTTT	27	25	yes
GATCAGGGTGGAATGTGCCT	52	1	yes
GATCAGGGTCCTCCTTCCCT	30	2	yes
GATCAGGGGTGGACTTGCTT	6	3	yes
GATCAGGGGTAGTGTGAATG	21	5	yes
GATCAGGGGGAAGGGGTCAG	38	36	yes
GATCAGGGCGTGGTAGAGAA	18	1	yes
GATCAGGGCCGTGTGGATGC	124	29	yes
GATCAGGGCCGAGTGATGAG	38	3	yes
GATCAGGGCCCATTAGTGAG	55	3	yes
GATCAGGGCCAGGGGAGGTC	236	19	yes
GATCAGGGCAGAGATGGAAG	88	3	yes
GATCAGGGCAAGGGCTAGCC	61	15	yes
GATCAGGGCAAGAGGATTGT	127	19	yes
GATCAGGGCAAAGTGGCTTT	27	2	yes
GATCAGGGACTCTTCGGTGT	43	7	yes
GATCAGGGACCTCACAAGTC	10	9	yes
GATCAGGGACCACGAACAGA	572	238	yes
GATCAGGGAAGTTCATTGTG	366	94	yes
GATCAGGCTGAGCTGAATGT	57	0	yes
GATCAGGCTACTACAAAGTT	683	52	yes
GATCAGGCGACAGTGAAGAT	18	2	yes
GATCAGGCCTGAACCCGTCC	225	22	yes
GATCAGGCCCACAGCCGAGT	66	2	yes
GATCAGGCCATCAAGTCACA	36	4	yes
GATCAGGCCATACGTAGCCT	80	15	yes
GATCAGGCCAAACACTTGGG	838	49	yes
GATCAGGATGGGACAGTTCC	7	6	yes
GATCAGGATGGCTGGATTCA	125	15	yes
GATCAGGATAGACTGTCACA	8	8	yes
GATCAGGAGTTTAAGTGGTT	3	3	yes
GATCAGGAGTTCCAGGACAG	120	3	yes
GATCAGGAGTTACTATCCAG	16	3	yes
GATCAGGAGTCCTTTGAGTG	26	12	yes
GATCTTTGGAGAAATGGAAC	28	5	yes
GATCAGGAGGGTCTATTTCC	157	60	yes
GATCAGGAGGGTCAGCTGTG	3991	841	yes
GATCAGGAGGCTGTCCCTAA	7	7	yes
GATCAGGAGGCAGTGTGTGG	55	6	yes
GATCAGGAGGAGAAAGTGAG	26	10	yes
GATCAGGAGCTGGCATTGGC	383	43	yes
GATCAGGAGCCCATTGGTGA	9	9	yes
GATCTTTCTCAAGAGCAGTG	13	2	yes
GATCAGGAGCCAGGGAGCTA	134	14	yes
GATCAGGAGCACCTGTGGCT	280	35	yes
GATCAGGAGAGGTCCCTGGT	18	17	yes
GATCAGGACTTGGTGGAAGC	12	3	yes
GATCAGGACTCCTGTGACTC	33	5	yes
GATCAGGACAGCAAAGACAG	318	36	yes
GATCAGGACAAAGAAATACC	1	1	yes
GATCAGGAATTCAAGGTCAT	8	8	yes
GATCAGGAATGTGTGCAGCA	15	14	yes
GATCAGGAATGGGAATCGCA	1	1	yes
GATCAGGAATCCAGGCCAGG	77	8	yes
GATCAGGAAGATGGTAGCCT	7	7	yes
GATCAGGAAGATGACTGGCA	98	42	yes
GATCAGGAAGAGGACCAGCG	11	10	yes
GATCAGGAACTCCAGTTCAT	14	7	yes
GATCAGGAAAGAAATGGAGC	27	8	yes
GATCTTTATTGCTCAACCAT	3	3	yes
GATCAGCGGTGGGAATGACA	881	5	yes
GATCAGCGCTATTTCCTGAG	102	31	yes
GATCAGCGCCTCCAGTTCCT	338	53	yes
GATCAGCGATTTATTAGTAG	58	6	yes
GATCAGCCTTTTCTGTCTTG	150	20	yes
GATCAGCCTTCAGTTCATTT	13	4	yes
GATCAGCCTTATTAATTCAG	6	0	yes
GATCAGCCTGGGCCACCTTG	55	5	yes
GATCAGCCTGCTCCTGGGGC	57	12	yes
GATCAGCCTCCATCCGCTCA	12	4	yes
GATCAGCCGCTCAAGATTCT	518	42	yes
GATCAGCCCTACCTGAGACT	24	9	yes
GATCAGCCCTAATCCTCTGG	31	14	yes
GATCAGCCCGACTGTCTGCT	31	4	yes
GATCAGCCCATCGCAGCTTG	1	1	yes
GATCAGCCCATCCACTCTTT	10	2	yes
GATCAGCCCAGCCCATGTGA	252	25	yes
GATCAGCCCACTCAGCCTAA	6	7	yes
GATCAGCCCACAGAGAATGA	2	2	yes
GATCAGCCATTTCTTGGGGT	37	1	yes
GATCAGCCATGTGCCACCAA	5	4	yes
GATCAGCCAGTTGACTTGGA	9	1	yes
GATCTCTGACCTCCTCCCCA	32	7	yes
GATCAGCCAGTATCTTGAGT	23	1	yes
GATCAGCCAGGACCCTCAGA	1	1	yes
GATCAGCCACTTAGAATTCA	4	3	yes
GATCCTCAAGAGGGCTGTGA	13	3	yes
GATCAGCCACACTATTCTTA	17	16	yes
GATCAGCCACAAGATTTCAT	76	3	yes
GATCAGCCAAGGGTTCAGAG	40	2	yes
GATCAGCATTCTTGAGCTGG	88	14	yes
GATCAGCATTCACAAATTAC	6	6	yes
GATCAGCATGGTTGTTCTTC	119	13	yes
GATCAGCATGGGCACACAGC	26	5	yes
GATCAGCATGCCCTTCCATT	16	6	yes
GATCAGCATAGTTGTAGATT	53	0	yes
GATCAGCATAGCACATGAGT	37	6	yes
GATCAGCAGTGTCGGCCATT	331	28	yes
GATCAGCAGTGCCTTGTGTT	224	7	yes
GATCAGCAGGGATTATTCCA	1	1	yes
GATCAGCAGGAACCCCACCT	22	10	yes
GATCAGCAGCTTCACATCTT	2	0	yes
GATCAGCAGCCTACGACCTT	52	14	yes
GATCAGCAGAGTGGTTATGG	31	4	yes
GATCAGCAGACTACAACTGA	24	4	yes
GATCAGCACTTGCCTGGAAA	46	4	yes
GATCAGCACTCTGCCTCCAA	43	2	yes
GATCAGCACTCAACCATTCT	19	1	yes
GATCAGCACTAAGACTGCTA	46	9	yes
GATCAGCACCTTGAAGAAGT	11	1	yes
GATCAGCACCTCTCCAAGAA	18	2	yes
GATCAGCACAGGGTCAACTA	39	1	yes
GATCAGCACAGACACCATTT	68	15	yes
GATCAGCAAGTGACATTGAT	20	4	yes
GATCAGCAAGTCAGGAGTCA	140	1	yes
GATCAGCAAGACATTACCAA	4	4	yes
GATCAGCAAAGGGGCTAATC	12	11	yes
GATCAGCAAACCCCAGGAGG	7	7	yes
GATCAGATTTGTCCACAAGG	120	7	yes
GATCAGATTTGGTCTATCGG	16	1	yes
GATCAGATTTCACTGAATAC	82	0	yes
GATCAGATTGTCTCTGTTCT	100	6	yes
GATCAGATTATGGTATCCAG	1	1	yes
GATCTTGCATTAAGTAACCA	6	5	yes
GATCAGATTAGTCAGCCAGG	4	2	yes
GATCAGATGTGTGCCTTAAT	1	1	yes
GATCAGATGCATCTGACCAA	3	3	yes
GATCAGAGTTCTTTTGTACC	18	5	yes
GATCAGAGTGTGTCCTGCTT	18	6	yes
GATCAGAGTGTGGAAACTAA	19	5	yes
GATCAGAGTCGCCCTCCCAT	29	8	yes
GATCAGAGTCCACCTTTACC	12	6	yes
GATCAGAGTCATAGGCTGGC	71	0	yes
GATCAGAGTATTCCTGCCAG	2	0	yes
GATCAGAGGTTCAGAATATC	77	26	yes
GATCAGAGGTTAGGACGTGA	31	11	yes
GATCAGAGGTGTGTGCAATC	3	3	yes
GATCTCCACTCTTCATGACT	7	1	yes
GATCCCCAGAGACAGAACTT	16	6	yes
GATCCATTTATGGGACACTG	6	6	yes
GATCAGAGGCTCCCAACTGG	217	14	yes
GATCTCTGTGACTTCCAGAC	28	5	yes
GATCAGAGGATGCGGAGCTA	23	6	yes
GATCAGAGGAGACTTCCTCG	38	6	yes
GATCAGAGCCGAACCTACTT	38	3	yes
GATCAGAGCCAAGAAACGCC	94	3	yes
GATCAGAGATGGGCAGCCTA	14	9	yes
GATCAGAGAGTGTCAACTTA	240	11	yes
GATCAGAGAGTAGAAGGAAA	3	3	yes
GATCAGAGAGGGAGTTCTCG	16	5	yes
GATCAGAGAGAGAGAGTTTC	4	3	yes
GATCAGAGAGAAGATTTTTG	16	1	yes
GATCAGAGACAAGTTCATTA	58	4	yes
GATCTTCTCACAGAAAATGT	5	4	yes
GATCTTCTAGAATCTCCGAA	9	9	yes
GATCAGACTGGTGAGAAAGC	73	6	yes
GATCAGACCTGTGGCTGAGT	151	12	yes
GATCAGACCTGGGCGTGAAA	5	4	yes
GATCAGACCGTTGGGTGGAC	35	5	yes
GATCAGACCCAAAGAAAAGT	61	5	yes
GATCAGACCATTGAAACCAC	21	9	yes
GATCAGACACTGACTGGTGA	22	2	yes
GATCAGACACTCCCTCACCA	11	6	yes
GATCAGAATGTTCTCAACTT	24	9	yes
GATCAGAATGAACTTGCCAA	24	6	yes
GATCAGAATATTCCAAGTCA	21	7	yes
GATCATCCCACTCAGGTGAA	4	3	yes
GATCAGCTCCTCTCGTCTGA	4	4	yes
GATCCAAGGCCTCCACGTCT	75	11	yes
GATCCAAGGAAGAGCCCATG	15	7	yes
GATCCTGTACACAGTGCTGG	4	4	yes
GATCTAAGGAGGGGGTTCAA	5	5	yes
GATCATCCACACCGAGGATT	2	2	yes
GATCACAGGCTACCTGTTAA	2	2	yes
GATCTCTCCCTCATATAACT	28	1	yes
GATCAGCTGGGTGACGGTCT	55	10	yes
GATCCGTCGCCACTGGGGAG	2434	19	yes
GATCAGTAGTTGCATAGGGA	2	2	yes
GATCCCTTCCCCACCTAGCT	36	0	yes
GATCCTTTCAGCAGCAGAGG	3	1	yes
GATCCCGACGGGTTGGCTGC	22	2	yes
GATCAGAAGATGAATCAGTA	1	1	yes
GATCTGCAGCACGTAGACAG	126	18	yes
GATCTGGCCATCCCAGGGGG	9	2	yes
GATCACTGACTGTTGCCTTT	1	1	yes
GATCCCCCTCCCCCCAGTGA	109	58	yes
GATCGTAAACTACTTGAGCT	33	5	yes
GATCGGCGCCTCCGGAGTAC	99	26	yes
GATCACTCTTTCTCTCAGGT	11	3	yes
GATCTATGAGGCCACCATGA	10	9	yes
GATCCTTGAGAGGCAAGACG	3	3	yes
GATCAGGTGGAGTTGAAGGA	41	15	yes
GATCACCAGAGACACCTGGC	3	1	yes
GATCACTCTGAGGTCCATGG	8	8	yes
GATCACTCATTGTTCAGGTG	3	3	yes
GATCTGACGCCCTCTTCTGT	838	35	yes
GATCCAAATGCCTTTCTTTT	1	1	yes
GATCGGGAACAGAAAGGGCG	33	3	yes
GATCTGAAGTGACCTTATGG	24	4	yes
GATCGGCGCTTTCAGACTAA	14	8	yes
GATCCCAGAAGGGCAAATTG	3	1	yes
GATCCTGAGAAACCTTTGAC	35	7	yes
GATCGCTGTGGCCGAAACTT	40	8	yes
GATCGCTGGGGAGTCGGGTC	13	5	yes
GATCCAAAGAGCAGGGATGG	1	1	yes
GATCCAAACTAAAGGCAGAG	30	6	yes
GATCACAGTGTACCCCACAC	22	2	yes
GATCACAGTCTGCATCCTAG	43	4	yes
GATCTTCAGTGGGTTTCTCG	23	21	yes
GATCGCTCTCATTGCCCTTT	14	1	yes
GATCATTGGGGAACGGCAGC	7	7	yes
GATCATTGGGACTGAGTGAA	32	6	yes
GATCGCTACCAAGCAGTTCT	38	4	yes
GATCGCGGACGGGCTGTGCC	73	8	yes
GATCGCCTTCTCCACCAATT	76	45	yes
GATCCTCAGGGCCTGAGCCT	10	0	yes
GATCGCCTCCTCCCTCTCTT	125	6	yes
GATCACACTTCTCTTAGGCA	16	1	yes
GATCTGGTGCTGCGCGGATG	83	26	yes
GATCCCTTCTCAGCCTCCAT	27	1	yes
GATCCCTTCCAGGTCAGCTC	3	3	yes
GATCATGTCTTCCCCTCTTT	3	3	yes
GATCGCCATCGGCAGGACTG	80	16	yes
GATCATCTTTCTGAGGGCTG	74	4	yes
GATCCTCTGCAAGAATAGCA	9	3	yes
GATCGCCACCTACCGCACCC	2	2	yes
GATCATCTGGGAGGGGATGC	18	5	yes
GATCCTGGAACACTCAGACC	4	4	yes
GATCATTTGGTTCCTCTATA	25	13	yes
GATCCCTACTTGGGCTTGTC	1	1	yes
GATCATCTGCTTCAGCATAT	4	0	yes
GATCGCATTGGAAAGACCAA	16	3	yes
GATCGCATTGCCAAGGAGGT	59	55	yes
GATCGCATGAAGAAACCATG	189	17	yes
GATCGCAGTAGCCAGCGCAG	142	2	yes
GATCGCAGAGTCCGCCAACT	6	1	yes
GATCGCAGAGGAGGGTTTTG	55	9	yes
GATCATCGAGCCCACCAGTC	52	10	yes
GATCGACGAGAACTGGTATG	73	13	yes
GATCCTTTTGCAGTCCAGAA	14	9	yes
GATCTGTGATGAGACGAAAG	1	1	yes
GATCAATAGAGGTCTTGTGA	128	26	yes
GATCCTGAGAGAGTCCCTGA	32	5	yes
GATCAGGTCTGCTTCAAGTA	4	4	yes
GATCCTTTTCCACTCCCAGG	18	4	yes
GATCCTTTGCTCCTAGTGGA	95	2	yes
GATCCTTTCCTTGGACTCAC	5	5	yes
GATCCTTTCCATGCAAACTG	75	11	yes
GATCCTTTCATTTTCCAAGT	15	0	yes
GATCCTTGTTGTGCCTCTTC	48	3	yes
GATCCTTGTTCAATGCACGT	23	9	yes
GATCCTTGTGGCTGTGAAAA	16	1	yes
GATCCTTGTCCACCCCTCCC	11	12	yes
GATCCTTGGCTGCTGGGGAA	1	1	yes
GATCCTTGAGGTCACGTTGC	6	2	yes
GATCCTTGAATTCTAAGGAG	17	18	yes
GATCCTTCTCTGCTAGTTTA	81	0	yes
GATCGACCATACAGTAGAAC	8	8	yes
GATCCTGCCCCAGGCTCCCA	5	1	yes
GATCACCCTGCACCCCGTCA	72	9	yes
GATCCCAGACTCACCCACGT	21	3	yes
GATCCTTCTACCCACATACT	37	1	yes
GATCCTTCCTGCGGGCGGTG	30	3	yes
GATCCTTCCAGGAAGAGGAA	2	2	yes
GATCCTTCAGTCCTCTTAGT	27	5	yes
GATCCTTCAGAATCTCTGTT	57	2	yes
GATCAGTTTGCTCACTGAAA	15	14	yes
GATCAGTTTGCCTTCATTCA	54	7	yes
GATCCTTACCCTGTCCCTGT	187	6	yes
GATCAGTGTGTCTGTCTATG	44	9	yes
GATCAGTGCCTGGCGCCAGA	102	6	yes
GATCCTGTGTGGGAGGCTTC	70	23	yes
GATCCTGTGTGCGTTGATGA	6	2	yes
GATCAGTGAGCTCTGCAAAC	1	1	yes
GATCCTGTGGAAAGGATGCA	17	15	yes
GATCCTGTCCCAGGGGCTAG	202	32	yes
GATCAGGTCTCTCCAACTCA	18	1	yes
GATCCTGTCACTGGGGAGGC	58	19	yes
GATCCTGGTTTTATGCTTGT	4	2	yes
GATCCTGGTTGGGGGCAAGG	47	20	yes
GATCCTGGTGGTTCACCTCA	36	18	yes
GATCAGGCAGCAGAATCAGA	3	3	yes
GATCCTGGTGAATGAACCAT	15	1	yes
GATCCTGGTCCCCAGCACCT	62	0	yes
GATCCTGGTAGCTCACCAAG	65	9	yes
GATCCTGGGTCCCTCGTAAG	208	24	yes
GATCCTGGGTACTAAGGTCA	507	15	yes
GATCCTGGGGACCCAGAATG	37	7	yes
GATCCTGGGCTTCTTGCTAG	61	5	yes
GATCCTGGGAGCGAGGAAAC	28	0	yes
GATCCTGGGAAGTTGGATTA	1	1	yes
GATCCTGGCTGCCTACCAGC	4	4	yes
GATCCTGGCTGCCCACTTGG	5	5	yes
GATCCTGGCGCTGGCTGTCC	84	9	yes
GATCCTGGCAGTGGACCGCC	31	2	yes
GATCAGCTGGGTTTTCTACA	19	6	yes
GATCCTGGCAACAGCTGTTT	36	2	yes
GATCAGCTGATGTGGGTGCT	1	1	yes
GATCCTGGAGTTTTCTACAG	106	1	yes
GATCCTGGAGGAACCTTCGC	18	0	yes
GATCCTGGAGAACACTGGTT	4	0	yes
GATCCTGGACGAGGCCACCA	98	56	yes
GATCCTGGACCGCCACAATT	18	2	yes
GATCTTCCTCGGGCTTGGCC	34	4	yes
GATCCAGAAGACGAAAGAAG	27	3	yes
GATCTGCATGTCTTCATTGA	25	23	yes
GATCTGTCCTCCAACAAGCT	22	0	yes
GATCCAAGTGAACGACCTGC	4	0	yes
GATCCTGCTGACACGGTGCG	160	3	yes
GATCCTGCTCCAGGAGATTG	26	2	yes
GATCCTGCTAAGCACTGAGG	235	21	yes
GATCCTGCCCTGGGGTGAGG	24	5	yes
GATCCTGCAGCGGTTCCTAC	24	6	yes
GATCGCCAAGTTCAAAGCTG	20	4	yes
GATCTGCCTCTCTCTGATGC	2	0	yes
GATCTGCCCATGTTCACATA	1	1	yes
GATCAGAGACAAGAATCTTA	16	15	yes
GATCACTTTGGGAACTGGTA	2	2	yes
GATCCATTCGCAACTTGGCT	17	1	yes
GATCCCAACAATGCAGCCAT	363	251	yes
GATCCATCCTGCAGAAGCAC	7	1	yes
GATCACCATTTCCGACTCTG	8	9	yes
GATCTCTCCCCAGGGAAGGA	254	5	yes
GATCAAGGTGGGAGGGAAGA	68	14	yes
GATCAGCTCAGACTGTGAAC	2	2	yes
GATCAGAAGTTCAGGGTTAT	10	5	yes
GATCAGAAGTTCAATACAAT	5	4	yes
GATCAGAAGTTCAAGGCCAG	302	58	yes
GATCAGAAGTTCAAATCCAC	2	2	yes
GATCAGAAGTGCCTCCTTGT	50	5	yes
GATCAGAAGTCAGAGTCCTT	27	11	yes
GATCAGAAGTAGCCAAGTAG	27	6	yes
GATCAGAAGTACCAGAAACA	1250	88	yes
GATCAGAAGGAGATACTCTG	7	6	yes
GATCAGAAGGAAGAGAAACA	34	8	yes
GATCAGAAGCTGTGTGCGTT	93	17	yes
GATCAGAAGCTGGAGGGTGT	59	8	yes
GATCAGAAGCCACAGGCAGG	66	20	yes
GATCAGAAGAGAGCGGACTA	28	11	yes
GATCAGAAGACTTGCTCTGA	6	5	yes
GATCAGAACTGGGTGCCAGC	6	5	yes
GATCAGAACTGGACAGCTCC	71	39	yes
GATCAGAACCCAGCCGAGTG	273	17	yes
GATCTCTCTGAAGAGTATTT	1	1	yes
GATCTTGGGTTTTGAATTAC	12	11	yes
GATCTTGCTGCGATTCCGCC	1	1	yes
GATCTTCCAGACGCTGAATC	1	1	yes
GATCAGAACATTTGTTCCAA	3	3	yes
GATCAGAACATCTCTGGCTA	9	4	yes
GATCAGAACAGGTGTCCCTT	56	3	yes
GATCAGAACAGACAATAGGT	11	10	yes
GATCAGAACACTGTTAAATG	1	1	yes
GATCAGAACAACAGACAGTG	48	7	yes
GATCAGAAATGAGGTGTAAC	53	6	yes
GATCAGAAAGGAAGGGATGG	38	8	yes
GATCAGAAAGATGCAGTTCT	11	10	yes
GATCAGAAACTGTCCTCTGA	21	20	yes
GATCAGAAACCATGCTGCCT	6	6	yes
GATCAGAAACATGCCCAAGT	2	2	yes
GATCAGAAACAACTGTGTCT	129	11	yes
GATCAGAAAAGTCTCGACTA	10	11	yes
GATCACTTTTGTATTTGTTG	6	0	yes
GATCACTTTTGGTCAATATG	27	1	yes
GATCACTTTGTAGTCATGTA	14	2	yes
GATCACTTTGCCAAATAAAT	2	0	yes
GATCACTTTGAGGAAGCCAT	559	130	yes
GATCACTTTCTAGGTTCCTA	121	4	yes
GATCACTTGTTTGTGGTGAG	274	14	yes
GATCACTTGTGAATTTACTG	14	13	yes
GATCACTTGTCAGTGTTCAG	132	36	yes
GATCACTTGGGCCTCAGTTC	4	4	yes
GATCACTTGGCTTTTCTGGG	100	18	yes
GATCACTTGGCGGTGACTTT	95	13	yes
GATCACTTGCTGAAATGAAT	18	1	yes
GATCACTTGATTTCTTGTGC	9	8	yes
GATCACTTGAGTTCTGGTAG	10	9	yes
GATCACTTCTGAACCTGCTC	4	0	yes
GATCACTTCTCTGGTCTCCA	21	8	yes
GATCACTTCGGCCTGTACAC	100	2	yes
GATCACTTCGCCCTTTTTTG	68	5	yes
GATCACTTCCGTGCCTCCCT	39	2	yes
GATCACTTCCCAGGGCCTGT	34	6	yes
GATCACTTAGTGGGGGGTTT	18	17	yes
GATCACTTACTGCCTAATGC	34	8	yes
GATCACTTAAAATGGAAAAA	9	9	yes
GATCACTGTGTTGGACACTC	2854	22	yes
GATCACTGTGTACACATTGG	18	6	yes
GATCACTGTCTCAGGCCTTT	6	1	yes
GATCACTGTCCCCCTGGGAA	80	8	yes
GATCGTGTTGCCGGCCTGCC	4	4	yes
GATCGACCACATCCTGGATG	33	8	yes
GATCACTGTACTCTTCTTTT	2	2	yes
GATCACTGGTGTTTCCCATT	156	18	yes
GATCACTGGTGTGTGCCAGT	50	11	yes
GATCACTGGTGGCATCGCTG	97	1	yes
GATCACTGGTGGAGAAAAGA	39	5	yes
GATCACTGGTCTGTGACCTA	14	0	yes
GATCACTGGGTGTGTTTCAG	76	33	yes
GATCACTGGGGGCTCTTGTG	9	3	yes
GATCACTGGGAACAAACGGC	314	61	yes
GATCACTGGCACCAAAGAAG	23	1	yes
GATCACTGGAAACGATTGCT	102	2	yes
GATCACTGCTCAAGCCTGGG	38	13	yes
GATCACTGCTAAGTTTCAGC	27	5	yes
GATCACTGCGAAGTTTCGTT	27	11	yes
GATCACTGCCTTTCCCCCTC	43	15	yes
GATCACTGCCGAGAAAATCA	46	5	yes
GATCACTGCAGGGGGTGCCA	253	3	yes
GATCACTGCAGGCGCAGCGG	365	11	yes
GATCACTGCAACCTTGTGCT	208	28	yes
GATCACTGATTCAGAGCTCA	24	8	yes
GATCACTGATGGCCAGAATG	57	10	yes
GATCACTGAGGAGACATTTT	4	3	yes
GATCACTGACCTTGGAGCTT	82	8	yes
GATCACTGACCTCTGGAGTC	33	6	yes
GATCACTCTGGCCGCTCTTC	402	20	yes
GATCACTCTGGCCAAGTAAG	86	1	yes
GATCACTCTGGAGTTCAGCG	2300	70	yes
GATCACTCTGGAGCATTTTT	25	5	yes
GATCACTCTCTGCATCGCTG	89	4	yes
GATCACTCTAGTCCCCACCC	47	12	yes
GATCACTCTACCCTCGAAGA	62	12	yes
GATCACTCGGAAATTCAGGC	55	26	yes
GATCACTCCTTTTGAGGAAA	625	39	yes
GATCACTCCGTGCACCTGCT	25	1	yes
GATCGGGGCACAGAAACCCC	28	31	yes
GATCACTCCCTGCCTGAGCC	226	4	yes
GATCACTCCAGCCCAGGCCC	19	18	yes
GATCACTCCAAGTTGACATT	660	34	yes
GATCACTCAGTGAACAATCC	22	15	yes
GATCACTCAGCAGCCAGGAC	121	10	yes
GATCACTATGTCCAGGCTTC	64	14	yes
GATCACTAGTGACTGTTGGG	36	9	yes
GATCACTAGGTCATTTTGTT	35	3	yes