#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCATAGTGGACGTTGTTA	1	1	yes
GATCACCTCACATTCTCATG	18	18	yes
GATCACCGTCTAAGCCTCAG	17	17	yes
GATCATACCCTAGCCGGGCA	52	7	yes
GATCACCGCACACCACCCCT	4	2	yes
GATCAGTGTGTGCCAAGGAG	196	15	yes
GATCAAGAGTCTCAAACCCA	48	21	yes
GATCAGTCAGTGACAACCAA	77	9	yes
GATCAAGAGGAAGCACAATA	31	25	yes
GATCAAGAGAAAGAAGTGGG	8	6	yes
GATCAGTAGAGCTTGGACCC	356	48	yes
GATCAGTACACGGTGTATGT	10	5	yes
GATCAAGACGCAGGTCGAGG	239	16	yes
GATCAGGCTCTTTGTTTGTG	10	10	yes
GATCTGGCCACTTTGTGTTT	22	7	yes
GATCTGGCCAACGGCAACAT	77	1	yes
GATCTGGCAGTCATAGCTTG	156	15	yes
GATCTGGCACTAACAGAACC	5	4	yes
GATCTGGCAACTGTGCGGGG	55	2	yes
GATCTGGCAAAAACTACGGG	182	15	yes
GATCTGGATTTGGTTGAGAT	24	3	yes
GATCTGGAGTTGGCTTGTGC	3	2	yes
GATCTGGAGTGGGTGGGATA	10	8	yes
GATCTGGAGTCTGGTGTGGC	1423	48	yes
GATCTGGAGTCTCTTAAAGC	144	45	yes
GATCTGGAGTCCGCTTACAA	204	17	yes
GATCTGGAGTATGGTCTGCT	13	4	yes
GATCTGGAGGGAGGGGCGGG	67	66	yes
GATCTGGAGGATTCCAGCGA	41	3	yes
GATCTGGAGAGTTTGTTCAG	13	14	yes
GATCTGGAGAAGAATGGTCG	2	2	yes
GATCTGGACTTTGCTCAACC	228	25	yes
GATCTGGACTGGTGTTTCTT	104	5	yes
GATCTGGACTCACCTGGGAG	160	16	yes
GATCTGGACTCAAGGGGCAT	304	82	yes
GATCTGGACGGAAGTGGAGT	23	4	yes
GATCTGGACGATTCTGAGCC	577	7	yes
GATCTGAAGCAAGTCCCATG	20	16	yes
GATCCTGTGTTTGAATGACA	32	7	yes
GATCAGGCCCACTCCAGGAG	106	72	yes
GATCAGGATGACCGAAGGAG	5	4	yes
GATCACCATAATGCCTTTGG	16	15	yes
GATCAGGAGAACTCCTGGTC	4	3	yes
GATCAGGAAGACACGGACTC	7	5	yes
GATCAGCCTACGCTCACATT	228	45	yes
GATCAAGAATGGACCAAGAT	66	3	yes
GATCAGCCAGGTCTACACAC	7	5	yes
GATCAGACTGTTGCTTTCGC	90	57	yes
GATCAGCACCAAGTGACTTG	374	4	yes
GATCAAGAACACTGTCTCTC	21	5	yes
GATCAGAGCTGGAGGGAGCA	7	5	yes
GATCAGACAGATTTTGTTCC	8	6	yes
GATCAACTCCTGGGAGCTGT	1	1	yes
GATCACTACTGACTTGTTGG	7	5	yes
GATCTGCTTTTTGAAATGAA	4	0	yes
GATCTGCTTTGTGCTTGGCT	45	5	yes
GATCTGCTTTGCTGTCGGTG	2	2	yes
GATCTGCTTTCTCAGGACTC	223	26	yes
GATCTGCTTTCCCTTTGTAA	18	2	yes
GATCTGCTTGTGTTGTGTTG	54	6	yes
GATCTGCTTGGCTGCCATTA	91	41	yes
GATCTGCTTGCCCCAAACAA	729	1	yes
GATCTCTACCACCCAGGTAC	23	13	yes
GATCTCGGACGCTCAGTGGG	123	36	yes
GATCTCGCTTTCAGTCTGCT	5	4	yes
GATCTCGCTGGTTCGCACCT	144	31	yes
GATCTCGCTGCATTTACATA	19	2	yes
GATCTCGATTCTACAGTGGT	47	4	yes
GATCAACGTGATGGACGCAC	50	12	yes
GATCTCCAAGGACAAGAGGA	31	0	yes
GATCTCCTTCCTGGCTGTAT	4	5	yes
GATCACTGTTTGTGCCTCTG	615	4	yes
GATCACTGTGTCCCAGGCTG	84	8	yes
GATCACTGACATCTATACCC	33	3	yes
GATCAGAATGGCGGAGGCGG	98	11	yes
GATCACAAGTGGAAAGCAAT	20	5	yes
GATCACTCTTCCCGCTGCTG	126	5	yes
GATCACTCTGGTCGTGTGGG	26	6	yes
GATCAACCGCACACAGGCGG	3	2	yes
GATCACGAAGAAGGCAGCCT	19	8	yes
GATCACCTGTGGAGTTGTCA	35	5	yes
GATCACCTGACTCCTAACCG	9	2	yes
GATCTTTCTCAACATGCCCG	9	3	yes
GATCTCCTCTCTTCCCACGG	40	6	yes
GATCTCCTCTCCAGGGAGCT	28	28	yes
GATCTCCCTTCCCCGGGGAA	33	27	yes
GATCTCCCTGTGCCGGTGCC	159	75	yes
GATCACCAGAAAGTTTGTTA	2	2	yes
GATCACATGGGTCGAGGGTT	36	6	yes
GATCACAGGGGAACTAATTC	8	8	yes
GATCACAGCCGAACCTGGGT	22	4	yes
GATCACAGAGTGGGAATCTC	85	10	yes
GATCTTGAAGAAGATGAGGC	11	9	yes
GATCACACTGTCTGAGGCGT	72	8	yes
GATCACACGCAGAATGAAGT	2	2	yes
GATCAACAAGAAACTCAACA	8	6	yes
GATCTCCAGGACTTGTGTGG	35	28	yes
GATCAAGTGCTCAATCGAAG	28	0	yes
GATCAAATTGCTTGCTTGAG	30	4	yes
GATCAAGGACATCCATGTGC	279	44	yes
GATCAAATCCGACGACGAGG	35	9	yes
GATCAACGTCTGAAAACAAT	3	2	yes
GATCAAATATGTGCCCTATG	163	2	yes
GATCAAAGTTCCCAGAAATG	5	4	yes
GATCTCAGGGCAGAAATGAT	68	2	yes
GATCTCAGAGGCTCGGTATC	92	27	yes
GATCAAACCCAGGGCTTTGT	361	30	yes
GATCAAAGGGTCAAGAGTCC	36	29	yes
GATCACTTTATTTGCTAGGG	279	1	yes
GATCAAAGGAAATGGAGCCA	151	7	yes
GATCAAACTACGGCACAGCA	38	5	yes
GATCTCATCCAGTCTGCTGG	9	1	yes
GATCATGCAACAAAAGCAGA	11	5	yes
GATCAAAGCACTGGCGGGCT	8	1	yes
GATCAAAGACTGCGACACCA	75	4	yes
GATCAAAGAAGGCTGTTGAC	35	28	yes
GATCTTTTTCTCCATCTCTT	76	21	yes
GATCAAACGTGGCTGAGCGC	1587	92	yes
GATCGGTCAGTGTCCCATAC	3	2	yes
GATCAAACGCCCTGGCAGAA	6	5	yes
GATCAAGCAGGCCGACTACC	3	4	yes
GATCATCTTGTGAAAACCCA	263	1	yes
GATCAAACCTGAGGGCACAT	8	6	yes
GATCTTTTCCACCTTCAGAG	34	13	yes
GATCAAACCCGTGGAAGAGG	181	46	yes
GATCAAACAGGCTGTCAAGA	68	7	yes
GATCTTTTACTTCGTGGCTG	189	23	yes
GATCTTTGTGGTGTGGGCCA	113	38	yes
GATCAAAACCCATCAACACC	11	9	yes
GATCTTTGTCCAGTTCTGCA	6	5	yes
GATCGTGACCCCAAGGACTG	6	1	yes
GATCCAAGCCCGGGGCCCGC	14	18	yes
GATCGACCATTATCAGCCAG	20	7	yes
GATCTTTCTGGCAAGGAAAC	1406	34	yes
GATCAGTTTGCAGTGGGATT	5	2	yes
GATCAAAATCGCAGTTACTT	18	24	yes
GATCATCCAGAACACAGCCT	341	178	yes
GATCTGCTCCAAGAAATGTC	42	2	yes
GATCCAGAAACACAAAAAGG	25	7	yes
GATCCTGGCTGTCGTTTCAC	8	3	yes
GATCTGCGCTTCCAGAGTGC	4337	198	yes
GATCCGCTGAGCATTTACAA	4	4	yes
GATCCACTCAGCCGTGGTTT	1	1	yes
GATCCCCAGATGCTCAGTGT	3	3	yes
GATCTCGAGAGGCTTTGTGT	32	43	yes
GATCCTGAGCCAGATGTCAT	40	0	yes
GATCCTGAGATGCAGCTCAT	5	4	yes
GATCCTGAGAGAAAACAGCA	9	2	yes
GATCCTGACTTTGCCAGCTG	145	44	yes
GATCCTGACTCTGACACTAC	295	8	yes
GATCCTGACCTGGGCTTCCT	150	0	yes
GATCCTGACCACATGAACAA	98	1	yes
GATCCTGACCAATGACAATA	6	6	yes
GATCCTGACATAAACCCTTG	2	2	yes
GATCCTGACAGTGCACCTAA	253	5	yes
GATCCTGACAGAGCCTTGGT	505	20	yes
GATCCTGAATGAGCTGTACC	8	1	yes
GATCCTGAATGACGTTCAGG	208	11	yes
GATCCTGAAGTGGCCTCAGC	55	3	yes
GATCCTGAAGTAGACAAAAA	2	2	yes
GATCCTGAAGGTCATCCGCA	142	4	yes
GATCCGCATCCTCAACCCAT	16	2	yes
GATCCACGCGAAAAGCCGGG	3	1	yes
GATCCGCACCGGGTGGGGAA	5	2	yes
GATCCCTGGGATAGCGAGCA	46	11	yes
GATCCTGAACGAGAGCCTGC	2	2	yes
GATCCTGAAAGCCAAGTTAG	170	0	yes
GATCCTGAAACTGACTCGCT	8	1	yes
GATCCTCTTTGCCAACCCCA	109	48	yes
GATCCTCTTTGCACAGAAGA	42	9	yes
GATCCTCTTTCACGCTTCTT	6	6	yes
GATCCTCTTGTTCCACGATG	7	5	yes
GATCCTCTTGCTGCAGCTTC	41	4	yes
GATCCTCTTGCTGAAGAAAA	11	11	yes
GATCCTCTTGCGGGACAGTC	95	11	yes
GATCCTCTTGATTCCTTCTG	36	4	yes
GATCCTCTTGATGCAGAGAG	118	1	yes
GATCCTCTTCTTCCTCGTGA	42	4	yes
GATCCTCTTCTTCAGCACAC	374	12	yes
GATCCTCTTCTGCTGTTCTG	26	1	yes
GATCCTCTTCCTGCTCCAGC	370	5	yes
GATCCTCTTCCCATCCATCC	65	3	yes
GATCCTCTTCATCTTGGGCA	223	4	yes
GATCCTCTTCAGCCCTGTGA	17	6	yes
GATCCTCTGTTGGGGCCTCG	123	28	yes
GATCCTCTGTGTCCTTATTT	9	2	yes
GATCCTCTGTGGACTCATCT	68	5	yes
GATCCTCTGTGCCTCACTCC	323	50	yes
GATCCTCTGCAAGAGCAACA	36	3	yes
GATCCTCTGAGGCAGTATTG	178	44	yes
GATCCACCCCTTAAGAACCA	309	26	yes
GATCCAGCAAGACCCTGAGC	1	1	yes
GATCCGAGAGTGACAAATCC	2	2	yes
GATCCACCACCTAGAATCTA	32	3	yes
GATCCCCGCCCTGCCCCCGC	21	10	yes
GATCCTCTGAATGTTTTCCC	41	11	yes
GATCCTCTCTTGTGCTACCT	28	3	yes
GATCCTCTCTGAACCTCCTG	116	10	yes
GATCCTCTCTCGGTGTGGTT	67	8	yes
GATCCTCTCCTTCTGACCTC	67	8	yes
GATCCTCTCATTCAGTCTTC	9	2	yes
GATCCTCTCAGAGGATTTCA	2	2	yes
GATCCTCTAGGGGTTATGGG	161	18	yes
GATCCTCGTGCCTGTCTCCC	381	1	yes
GATCCTCGGGGTTCAGCCTC	3	3	yes
GATCCTCGGGCAAGCCAAGA	1706	240	yes
GATCCTCGGGAGACCACTGG	157	34	yes
GATCCTCGGGAATTTTTACC	26	1	yes
GATCCTCGGAGGCTACCGAG	70	0	yes
GATCCTCGCAGCTTCTATGA	322	29	yes
GATCCTCGAGTGAGGACGAC	23	1	yes
GATCCTCGACAGGAAGCCAC	73	0	yes
GATCCTCCTTGTCAAGTACA	3664	325	yes
GATCCTCCTGTGAAGTGCCA	6	6	yes
GATCCTCCTGCGTGCTGACA	136	4	yes
GATCCGCCTGCTTCTGCCTC	10	10	yes
GATCCCAGGCTTCCTGGACG	17	8	yes
GATCAACCTGTACAAGCAGC	7	3	yes
GATCCCTTTCCCCTAACTGG	14	11	yes
GATCCACACTGGAACTTGTC	4	4	yes
GATCCCTTGGAACTAGATTT	44	7	yes
GATCTGAGCTGAATTTGAAG	57	2	yes
GATCCTCCTGCCCCGACAAG	70	33	yes
GATCCTCCTGAGTGCTGGGA	27	27	yes
GATCCTCCTCCTGTGTTTCT	37	6	yes
GATCCTCCTCAGACTTGTCC	13	14	yes
GATCCTCCGTGAGTATGCCT	157	14	yes
GATCCTCCCCTTTACGGACA	205	3	yes
GATCCTCCCCCTCTCCCACC	36	7	yes
GATCCTCCCCAGGGATGGGG	80	14	yes
GATCCTCCCACAGGGACACT	18	18	yes
GATCCTCCCAAGTGAATGAC	188	25	yes
GATCCTCCAGTCAGTCTATT	3	0	yes
GATCCTCCAGGACAAGGGGT	123	10	yes
GATCCTCCAGCACCAGGCAT	14	3	yes
GATCCTCATGTTCAGTTTTT	1	1	yes
GATCCTCATCTTCATTCCTT	50	8	yes
GATCCTCATATGAGGACCAT	68	11	yes
GATCCTCAGTTACTCGCTGC	134	14	yes
GATCCTCAGTGCTACTTGCG	160	6	yes
GATCCTCAGGGTCTGCCCTT	13	2	yes
GATCCTCAGGAGTTGCAATG	151	4	yes
GATCCTCAGGAAACAGTCTC	102	7	yes
GATCCTCAGCTGGCTGGAGC	109	1	yes
GATCCTCAGCTGCCCTGCCT	106	16	yes
GATCCTCAGAGACGTGCTCG	113	11	yes
GATCCTCACCATCCACGTTT	85	21	yes
GATCCTCACCAGCCGCGGGC	1385	45	yes
GATCCTCAAGCGCCTCAACC	193	5	yes
GATCCCTGTGTTGGGCAAAG	16	2	yes
GATCCACAGCCTACCAAAAC	1	1	yes
GATCCAGTGCCTGTGTAGAA	165	4	yes
GATCCCTGCTCTGCAATGAG	66	6	yes
GATCCAGGCCCTGGGAGGCT	35	2	yes
GATCCTCAACTCCTCCAAGG	23	4	yes
GATCCTCAACATCCGCCTGC	327	3	yes
GATCCTCAACAAGATGCTAT	102	4	yes
GATCCTCAAATCAGGCAACC	5	4	yes
GATCCTCAAACAGACATTGT	29	3	yes
GATCCTATTCCAGCCAAATG	98	19	yes
GATCCTATTCAGTGGCACAA	22	17	yes
GATCCTATTAGCCAAACTTT	7	2	yes
GATCCTATGTGTTGGCCATT	117	15	yes
GATCCTATGTGGCTCTAAAA	60	3	yes
GATCCTATGTAGCCCAGGCT	7	4	yes
GATCCTATGGTGTCCACACT	38	7	yes
GATCCTATGGTGATTCCAGT	4	1	yes
GATCCTATGGCATATGCAAG	49	7	yes
GATCCTATGCAGGCTGGAGG	13	14	yes
GATCCTATCTCCCGGTTGGG	73	9	yes
GATCCTATCATTGCTGGTGG	142	4	yes
GATCCTATCACCAGCACTGA	40	0	yes
GATCCTACTGTGGATGACAC	1815	7	yes
GATCCTACTGATGAAGTGCC	163	6	yes
GATCCAGGTTTTGTGGTCTT	40	0	yes
GATCCCTCTTAACATCTGAT	4	1	yes
GATCCCTCTGCTGCTGCTTC	39	1	yes
GATCCCTCTCCCAGGAACAA	13	2	yes
GATCCAAGCTGTCAAGAAGG	1172	12	yes
GATCCAAGCTCCATTGTACC	109	7	yes
GATCCAAGCGGAAGACCTCA	55	11	yes
GATCCTACGGAGCAAGTCTA	49	5	yes
GATCCTACCTTCTGCTTTCG	173	10	yes
GATCCTACCTGAGTGGCAGC	948	68	yes
GATCCTACCATCCCTTTGAT	17	5	yes
GATCCTACCACAGAGCCTTA	55	6	yes
GATCCTACATCCATTCGGCT	20	5	yes
GATCCTACAGTGGCTGGCAA	435	28	yes
GATCCTACAGTCACTTCACA	25	3	yes
GATCCTACACATGGAGGCTG	73	9	yes
GATCCTACACACCTACCAGA	193	49	yes
GATCCTACACACAGTGGTGA	31	4	yes
GATCCTACAAGCCTGTCCGT	131	15	yes
GATCCTACAACTCAGAAGAC	7	0	yes
GATCCTACAAAGGTCTTGAA	6	6	yes
GATCCTAATGATTTCAGCCC	32	10	yes
GATCCTAAGCAGATTCTGGG	125	1	yes
GATCCTAACTCTGACCTTTC	152	9	yes
GATCCTAACCTAAGATGCCT	143	14	yes
GATCCTAACCCTGAACCCCA	113	31	yes
GATCCTAACCCAGTGGACTC	164	17	yes
GATCAGTCAGCAAAGATGTG	2	2	yes
GATCAGGGTCTGATTGACAC	12	1	yes
GATCCAAGACATGGGCGCTA	11	4	yes
GATCCAACTTGCCCCAAGAA	20	20	yes
GATCCCGTGTCCTGCAGACG	164	8	yes
GATCCCGTCTCAGCCACGTC	15	8	yes
GATCAAGGGGTCCAATCCAG	90	3	yes
GATCCTGTCCGAGAGGCGCG	25	24	yes
GATCCTGGTCACCAAAGAGC	2	1	yes
GATCCTAAATTTGACCCAGG	146	1	yes
GATCCTAAATGGCAGCCTTT	35	4	yes
GATCCTAAAGGCCGGTCACA	1141	37	yes
GATCCTAAACTCTGTTGCCA	26	6	yes
GATCCTAAACTCCAAGGGGA	23	3	yes
GATCCTAAAACTGAGGAAAG	50	3	yes
GATCCTAAAACCAAGGGAAT	7	7	yes
GATCCGTTTGGCCTCTCAAT	25	9	yes
GATCCGTTGGAAGGTTTACC	44	0	yes
GATCCGTTGCCAGTTACCTG	339	64	yes
GATCCGTTCCTAGGGTACCT	163	20	yes
GATCCGTGTGTGTGTGGGAG	453	35	yes
GATCCCAGGCTTCTGGGGAC	75	7	yes
GATCCGTGTGAAGGTCCCAT	69	9	yes
GATCCGTGTGAAACTGGATG	2147	157	yes
GATCCGTGTCAACCCCTTTT	2	2	yes
GATCCGTGTATGTCTAAACA	15	3	yes
GATCCGTGGCTGCAGCAGAA	114	10	yes
GATCCGTGGAGAAACTTGCC	109	87	yes
GATCAGTACCGCCTTACCCC	1	1	yes
GATCCAAAGGAGCTACTTAG	7	5	yes
GATCCCGAGCTTCAAATCCC	125	12	yes
GATCCGTGCTGAGCGTCGGC	474	24	yes
GATCCGTGCATCTCATTGGC	133	1	yes
GATCCGTGAAGAACAAAAAG	11	11	yes
GATCCGTCTGTGGGGGCCTC	33	10	yes
GATCCGTCGCCTGGAGGTGG	229	10	yes
GATCCGTCCGAGATGGCAGA	8	2	yes
GATCCGTCATCTCCAGGACA	26	26	yes
GATCCGTCAGGCTTGCTCGT	84	17	yes
GATCCGTCAAGCTAACTGGA	55	17	yes
GATCCGTATCAGGTTCATGT	63	1	yes
GATCCGTAGTCTGAGTGATG	22	2	yes
GATCCGTACCCTGGTGCTGA	99	16	yes
GATCCGTAAGAAAGAGAAGG	17	17	yes
GATCCGGTTCTGGGACAGCA	117	14	yes
GATCCGGTCCCAAGACCGCT	557	53	yes
GATCCGGTCCAAGGCTCTTG	211	8	yes
GATCCGGGTGTCCAGTGACA	1455	8	yes
GATCCGGGTGATGCGAATCG	30	1	yes
GATCCGGGTCCCCTTCCCTA	25	3	yes
GATCCGGGGGTTCAATTTAT	192	2	yes
GATCCGGGGCACACATTCTC	71	28	yes
GATCCGGGCAAAGCCTGCTC	472	4	yes
GATCCGGGAGTGCTGGACTT	17	17	yes
GATCCGGGAGGTGTGCGGCT	2406	45	yes
GATCCGGCTGGGCCTGGCTC	123	28	yes
GATCCCCTTCTACGTGACCA	42	11	yes
GATCCAAAATGTTCCATGGA	28	5	yes
GATCCCCTGGTCTCTCCCGT	17	17	yes
GATCCAAAAAGCAGTTCAAC	13	7	yes
GATCCGGCAGAAGGATGAGG	313	5	yes
GATCCGGACTCACCTGGGAG	493	80	yes
GATCCGCTTGGCAGCCATTC	432	54	yes
GATCCGCTTACAGAGACTTT	42	8	yes
GATCCGCTGTCAGGAGCTGA	32	3	yes
GATCCGCTGCTGGAAGAACC	7	7	yes
GATCCGCTGCAACCCGGTGC	84	7	yes
GATCCGCTCTGTGGTCGCCT	346	29	yes
GATCCGCTCTGAGGTTCTGT	42	3	yes
GATCCGCTCTCTGCATCTGT	35	5	yes
GATCCGCTCCTGGCGACTCC	297	52	yes
GATCCGCTCAGAGCCCAGCA	46	5	yes
GATCCGCTCACGCCCAGCAG	105	8	yes
GATCCGCCTTCTACTCGGAA	22	4	yes
GATCCGCCGCTAAGACCTGG	131	15	yes
GATCCGCCCTGTGAGTCACC	119	16	yes
GATCCGCCCGCTCACACAGG	65	4	yes
GATCCGCCCACACCCACGTG	656	35	yes
GATCCGCCAAGTTATTCAGG	2	2	yes
GATCCGCCAAAAAAATGCAC	61	34	yes
GATCCGCATGATGGGAGGAG	10	3	yes
GATCCGCATCCGCAAGCCCT	411	25	yes
GATCCGCAGGTCAGATGACA	115	20	yes
GATCCGCAGCTTTTCCAGCA	160	26	yes
GATCCGCAATTATGAAGAAC	2	2	yes
GATCCGCAAGGTGCTGGACG	355	2	yes
GATCCGCAAGGACTTCTTAT	74	10	yes
GATCATTTCGGGCCAGTAGG	143	24	yes
GATCCAGACAGCCATCAAGG	268	3	yes
GATCCCCGAAGTCTCTCTCC	37	6	yes
GATCTTGTTGGACGCATTGC	11	2	yes
GATCCCCCCGGAGTGTTCAG	6	3	yes
GATCCAGAAGTCATGGCAAA	12	12	yes
GATCCAGAACTTGCAGCAAC	8	1	yes
GATCTTGTGACAGTGTGTGT	13	0	yes
GATCCCCAGGACACTTTGCT	27	6	yes
GATCCGCAACTGTCCGGAAG	229	6	yes
GATCCGATTTCTGATTTTGC	96	6	yes
GATCCGATTGAAGCCTCAGG	21	21	yes
GATCCGATGGTGCTGAGACT	7	5	yes
GATCCGATGGGCCAGCCTTT	208	49	yes
GATCCGATGAGGAAGATGAC	323	327	yes
GATCCGTGCCTGCCCAGGCA	35	2	yes
GATCCGAGTGAAAGCCGGAG	144	83	yes
GATCCGAGGCTAGAGGGAGC	8	6	yes
GATCCGAGGCAGCCAATACA	61	0	yes
GATCCGAGGCAGATTTTCTT	17	1	yes
GATCCGAGCGACTGTCACCA	129	17	yes
GATCCGAGCCTCACTACCTG	11	11	yes
GATCCGAGCAGCCACATTCC	4	5	yes
GATCCGACAGGAGGGTGTAA	559	66	yes
GATCCGAATTGCAGAGCTGT	55	4	yes
GATCCGAAAGGACAATCAGT	7	5	yes
GATCTGCAAGGCCTAATTAC	11	9	yes
GATCCTGTGCCCCCTCCCAA	30	4	yes
GATCCCGCAGATTCAGAAAG	4	3	yes
GATCTGCTTCCTGAAGAGTG	29	0	yes
GATCTGCTTCCCATTGTGGT	309	11	yes
GATCTGCTTCCCAACTGTTA	67	3	yes
GATCTGCTTCCATCCATCTC	31	4	yes
GATCGAGCGGCAGCGGCTGG	224	3	yes
GATCCTAGCTCAGAGAGGCT	22	1	yes
GATCTGCTGTTCCTCACGAA	58	5	yes
GATCTGCTGTGGCACAGGGC	96	12	yes
GATCTGCTGTCTACTACCTA	40	0	yes
GATCTGCTGTAGCATCAAGC	28	1	yes
GATCTGCTGGTCATTAAGGG	452	0	yes
GATCTGCTGGCAGTAGTAGT	55	18	yes
GATCTGCTGGAAGATAATCT	40	7	yes
GATCTGCTGCCTGCTCCCAC	113	9	yes
GATCTGCTGCCAGGTTTTGC	50	7	yes
GATCTGCTGCAGGGTTCTGT	996	88	yes
GATCTGCTGCAGCTAAAGTA	236	2	yes
GATCTGCTGATGATGGAACA	11	4	yes
GATCTGCTGATATTCCGGGC	5	4	yes
GATCCGAGGGAGATGGACTA	11	11	yes
GATCTGCTCTGATGGTATGT	21	3	yes
GATCTGCTCTCCACCTGTCT	35	20	yes
GATCTCAATAACTTCAGCAC	6	5	yes
GATCCCAGGTTGGAGAAAGG	8	3	yes
GATCTGCTCTCAAAAATTCC	4	5	yes
GATCTGCTCTAACCAGGCGT	77	5	yes
GATCTGCTCCTTCTGTCCCA	231	12	yes
GATCTGCTCCTTAACGTTTT	40	6	yes
GATCTGCTCCTGGAGGTGGT	6	5	yes
GATCCCTACAAGACAAGCGC	3	0	yes
GATCTGCTCCCAAGTTATCT	30	5	yes
GATCTGCTCCAACTACAGGA	16	4	yes
GATCTGCTCAGTGACTTGTG	74	10	yes
GATCTGCTCACTCTATTACT	25	0	yes
GATCTGCTATGTACTCCAGG	439	11	yes
GATCTGCTAGCAGAACTTGT	17	13	yes
GATCTGCTAGAGCTGTAATA	315	10	yes
GATCTGCTAGACCAAAACAG	1	1	yes
GATCTGCTACTGGAGATGTT	143	9	yes
GATCTGCGTATGGCGGCCAT	2890	61	yes
GATCTGCGGTGACTTGATGT	2067	104	yes
GATCTGCGCTATAGAAAAAA	51	16	yes
GATCTGCGCCTGCCTTGTCT	141	21	yes
GATCTGCGCCTGAGCCAAAG	685	21	yes
GATCTGCGAAGCCAGGCTTC	6	6	yes
GATCTGCCTTGGATTTCCTC	13	10	yes
GATCTGCCTGTCACTGTGGC	6	5	yes
GATCTGCCTCAGGAAAAATA	11	9	yes
GATCTGCCGCAGTAAGCGAG	2	2	yes
GATCTGCCCTTTCTGGGTGA	156	6	yes
GATCTGCCCTTGCACCCGGC	115	15	yes
GATCTGCCCTTACATTCTTG	11	9	yes
GATCTGCCCGAAGCCATGAG	174	22	yes
GATCTGCCCCATGGTGTTTT	59	5	yes
GATCTGCCCAATCCTTCCTC	88	39	yes
GATCTGCCATTCCCATCTGT	8	2	yes
GATCTGCCATGGAGGAATCT	4	5	yes
GATCTGCCAGTTTTGGTGCC	221	40	yes
GATCTGCCAGTCCGAGGTTC	142	2	yes
GATCTGCCAGGACAAGCTGG	218	2	yes
GATCTGCCACTGCTTCTCTA	88	16	yes
GATCTGCCACAGCAAGAGTG	85	24	yes
GATCTGCCACACAGTAGACT	45	0	yes
GATCTGCCAATGGTGCCGTT	9	2	yes
GATCTGATTGCCTTCATGGA	58	8	yes
GATCTGATGTTCTGTGTTTT	28	1	yes
GATCTGATGTTCTCTTCTGG	12	12	yes
GATCTGATGTGGTAATCAGC	7	7	yes
GATCTGATGTCCACTTCTGG	21	21	yes
GATCGGTCTGAGATGACTCA	11	14	yes
GATCTGATGTCAGTCGTGGT	49	3	yes
GATCTGATGTATGCCAAGCG	793	1	yes
GATCTGATGGTGGGGTGGCA	45	6	yes
GATCTGATGGTCCACTCTGC	56	7	yes
GATCTGATGGGTTTCTGGCT	108	6	yes
GATCCTGGCAGGATGCAGTG	2	2	yes
GATCTGATGCCTGTTAAGCA	8	5	yes
GATCTGATGCCCTTTTGTGG	36	29	yes
GATCTGATGCCCTGTTCTGG	52	6	yes
GATCTGATGCCCTCTTGTGT	14	18	yes
GATCTGATGACTCCATATTT	58	2	yes
GATCTGATGAATAAAGGAGG	29	29	yes
GATCTGATAGTCAAGTGTAT	117	2	yes
GATCTATCTGATGTGGGCAA	6	5	yes
GATCGCCATGCTCCTCTTCT	74	1	yes
GATCGATACCGGCTGAAGCT	19	15	yes
GATCTATCGGCCTCTGCCTC	60	10	yes
GATCTATCCTAGCCGGGAGG	1157	86	yes
GATCTATCCCATCTAGTGGT	22	5	yes
GATCTATCCCAGAGTTCTAT	25	5	yes
GATCAGTCTCCATCAGACTT	62	37	yes
GATCTGAGTTCTGTGCCAGC	3	2	yes
GATCCTGCAGCGCTGTAAAG	29	0	yes
GATCTGAGTGGGTGGGGGGT	123	17	yes
GATCTGAGTCTGCTACACTG	2	2	yes
GATCTGAGTCCTCACACTGG	38	38	yes
GATCTGAGGGTGATTTCTCT	23	4	yes
GATCTGAGCTGCCCTCTGCT	9	7	yes
GATCTGAGCCTCCACCTGTG	102	60	yes
GATCTGAGCCTACTAAATGT	3	2	yes
GATCTACTCCCGGGCCCAGC	41	33	yes
GATCTTTGCCAAAATGTGTG	19	2	yes
GATCTTTGAGGTGCTAAGTT	18	18	yes
GATCTTTCTACATCCCTGGG	12	9	yes
GATCTTTCGGAGGAGATGTC	213	103	yes
GATCTATACAGTCGGGAAAC	385	40	yes
GATCCTGACTTTGTTGGGGT	10	5	yes
GATCTGAGCATAGCGTCAGA	11	11	yes
GATCTGAGCAGGTGAAAAGT	97	12	yes
GATCTGAGAGCCGTGGTGCC	96	12	yes
GATCTGAGAGAGGAAACCTT	56	9	yes
GATCTGAGACCCTCCCTGAT	65	2	yes
GATCTGAGAAGATGTGGATG	105	25	yes
GATCTGACTGTAGCCTTTTC	5	4	yes
GATCTGACCTGTCCCAGCAA	28	6	yes
GATCTGACCTCGGAGTGTGC	88	37	yes
GATCTGACCGCTTTGGCCAA	18	18	yes
GATCTGACCCTCCAGACTTT	15	8	yes
GATCTGACCCCATGGCTTCC	8	3	yes
GATCTGACCAACAAGACCAC	46	3	yes
GATCTACCTGGATGGGGCGC	88	3	yes
GATCTACCGTGCAGGGACTG	57	8	yes
GATCTACCGTAATGGCTCCA	28	12	yes
GATCTACCCTTGCTTAAAAC	44	3	yes
GATCTACCACCCTAACATCG	85	64	yes
GATCCTGTCATTACTGAAAA	7	5	yes
GATCTTTCCAGAAGGTCTTC	3	2	yes
GATCTACACATGGGGCAACC	1000	71	yes
GATCACTGACTGCCCCAAAC	21	0	yes
GATCTAGCTTCCTGGGAGAC	16	4	yes
GATCCTGAAGCGCGCCTGAC	3	3	yes
GATCTTTACAAGTCTGGCAC	15	8	yes
GATCTTGTTTGTGTCTCTGC	3	3	yes
GATCTTGTTCCCTTACACGA	5	4	yes
GATCTGAATTTCTTCCTCTT	27	5	yes
GATCTGAATGTCCGAGAGAG	218	14	yes
GATCTGAATGCTGCCGAGTC	119	121	yes
GATCTGAATGCTCTGGGGGC	205	9	yes
GATCTGAAGTTCTGTGTTCA	17	17	yes
GATCTGAAGTCTGAATGGCA	65	3	yes
GATCTGAAGTATCTGTACAG	57	0	yes
GATCTGAAGCTGCTGATGAA	236	18	yes
GATCTGAACTCCAGAGAACA	237	1	yes
GATCTGAACCTGCCTGGAAA	19	9	yes
GATCTGAACACCCAGCGAGG	32	33	yes
GATCTCTTTTGCCAAGAAGT	25	4	yes
GATCTCTTTGTGTTCAAGAC	8	6	yes
GATCTAATTGCAGTGGTTAA	25	6	yes
GATCTACGCACGCATCAGCA	124	3	yes
GATCTTGTGGGTAGGAGGTG	6	6	yes
GATCTACCTCTTTTTCTGGG	1	1	yes
GATCTACCGTGCACACCCAG	34	27	yes
GATCTACCCTGACTCAGGTT	48	4	yes
GATCTTGTCCAGAGCTTCCT	81	19	yes
GATCTTGTATTCTCTGGCTT	106	10	yes
GATCTTGTACAAACCGGTTT	25	20	yes
GATCTTGGTTTTGAGTTCTT	31	4	yes
GATCTCTTTGTCCTCCCAAT	4	1	yes
GATCTCTTTGCTTTGAAACT	39	6	yes
GATCTCTTTGAGTTTGAGGG	12	16	yes
GATCTCTTTCTTGTTCCCCC	74	3	yes
GATCTCTTTCTGAGACCTTT	97	4	yes
GATCTCTTTCCTGGACATTT	23	8	yes
GATCTCTTGTGAAACGAAAC	27	13	yes
GATCTCTTGAATGACAGACA	30	3	yes
GATCTCTTCTTCCGCCCTAT	87	3	yes
GATCTCTTCTCGCGCTCTCC	79	5	yes
GATCTCTTCCATGTTACAAG	2	2	yes
GATCTCTTCAGCTCTGCCAA	6	5	yes
GATCTCTTCAGAAGGGCACT	9	9	yes
GATCTCTTCACTGTTTTTCT	65	4	yes
GATCCTGCAGGCCCTGCACC	12	3	yes
GATCTTGGGGTCCTTCTCAA	28	23	yes
GATCTTGGGGGAGAGAGGGA	75	27	yes
GATCAGAACAGTAGAGTGGG	1	1	yes
GATCTTGGGGAGTTTGACTG	22	2	yes
GATCTTGGCTCTGTGGAATG	510	5	yes
GATCTTGGATGCAGACTCGG	44	35	yes
GATCTTGCTTTGTGACTTTT	79	0	yes
GATCTCTTAGACCCCTGCTT	49	14	yes
GATCTCTGTGTTCAGGCTCT	22	3	yes
GATCTCTGTGGGCCTTTGGG	30	5	yes
GATCTCTGTGCTGGCGCCTG	10	10	yes
GATCTCTGTGCTCTTACTTT	9	0	yes
GATCTCTGTGAGCCTAGGAG	27	27	yes
GATCACTTGCTGCTAGGGCA	24	3	yes
GATCTAACTCCTGTTGCTCT	29	14	yes
GATCTTGCTTCAGCCAACGC	312	15	yes
GATCGTGATTGTGCTGGGCG	15	20	yes
GATCACGTCTTAGCAGTATC	2	2	yes
GATCTTGCGTGTTCTGTCCG	13	13	yes
GATCTTGCCCCTGCCAGTGG	116	15	yes
GATCTAAAAGACCTGGGACT	18	14	yes
GATCACCTTTTTTGACGAGT	37	10	yes
GATCTTGCATCCGCCAGCCA	29	13	yes
GATCTTGCAGGACGTTCTCT	48	4	yes
GATCGTCTGCTGTGAAACGT	142	4	yes
GATCGTCCCCAAAATTGCCT	22	18	yes
GATCACCGTACAGCTGGACA	21	12	yes
GATCGTCAGTGCAGGAGCAT	12	8	yes
GATCGTACGGGGCTGGAAAC	188	18	yes
GATCTTGACCTTATCCAGTC	51	13	yes
GATCGGTGGGACCCGGGCGA	504	281	yes
GATCGTGGGCTTCAGCACCC	267	34	yes
GATCTTGAAGAACTGCACTA	16	12	yes
GATCTTGAAATGGGCACAGC	21	16	yes
GATCTTGAAAACCTGTCAGT	6	5	yes
GATCCACATGGGACCAGCTG	1	1	yes
GATCGGTCTGAGATGACTCC	27	13	yes
GATCACACTGAAGATGCCTC	71	3	yes
GATCACCGGTTTCCGACTGA	38	8	yes
GATCGGCCAGTTCCAAGTTT	5	4	yes
GATCTTCTCTGGAGGGGAGG	12	9	yes
GATCTTCTCCCTGGGTTACT	18	7	yes
GATCTTCGTCCCCGACCATC	18	5	yes
GATCTTCGGCCCCAAAAAAA	156	3	yes
GATCTTCGAGGAGGGCGAGT	99	2	yes
GATCTTCGAGACTTTGTTAG	70	23	yes
GATCATCTCTACCACAGCTG	2	0	yes
GATCACTGTGAATCCAGTTC	22	4	yes
GATCGGCAAGCTGGAAGGCT	293	38	yes
GATCGGAATCGGAAGGAGAC	13	10	yes
GATCAGTTGACAGTGGCAAT	737	91	yes
GATCTTCCTACAGAAAGTAG	5	4	yes
GATCACCAGCCTTTTGCAAA	11	0	yes
GATCGGCGGGAAATGGCGGA	291	25	yes
GATCGGCGCCGTGAGATTCG	56	1	yes
GATCGCTCATTGGAACAGCT	1649	145	yes
GATCCGCTGCCGCCCCCTGC	3	3	yes
GATCGCCGCTGGCTAGTTCC	6	6	yes
GATCGGCAGCCAGAGTAGCT	48	47	yes
GATCGCCCTTGCTGGTCTGC	28	14	yes
GATCAACCATTCTGGGTCCT	3	2	yes
GATCCTGGTGATGGTGGTAT	29	6	yes
GATCTTCAGTAGTCTCTCCT	69	24	yes
GATCGTGACGGGGATGGAGA	3	3	yes
GATCAGGATGGCGAGGACAA	4	3	yes
GATCTTCAGCCTCTTGGGGA	85	17	yes
GATCTTCACTCACGTCCGGC	150	20	yes
GATCTTCACCTCTTCTTCCG	1	1	yes
GATCGCCTGCTAGTGCGGGA	48	1	yes
GATCTTCACAGTGCATGGCT	4	4	yes
GATCAGAGAATAAAGCCCTA	4	3	yes
GATCAGCCTGTTTCTGCCTT	6	1	yes
GATCAAACTTGAGGCCCTTC	9	7	yes
GATCTGTTGGTGCTGCTACT	13	4	yes
GATCTCTTTTCAGAAGTGTC	230	8	yes
GATCCCTGTGGGTCGGCTGT	3	0	yes
GATCACTGGTTTGTTGGCAT	11	5	yes
GATCAGGGATGCAGTACCAC	41	33	yes
GATCCCTCCGTTTCACCTCT	2	1	yes
GATCTTGGGAGGAGGCCAGC	1	1	yes
GATCATGTTCACAACGCAGG	93	7	yes
GATCTCTGTGCTGTAAACTA	21	4	yes
GATCCCAAGGGGGAGGGCTC	4	3	yes
GATCCCTTTTCCATTCTGGA	154	20	yes
GATCCCTTTGGGGTGTGGAA	239	22	yes
GATCTACAGGAGTGGTGATA	12	9	yes
GATCCCTTTGAAATGTATGT	4	5	yes
GATCCCTTTCTCTGGCCCAG	226	67	yes
GATCCCTTTCCACCTAAAAC	56	1	yes
GATCCCTTGTGAGCCCTAGT	195	2	yes
GATCCCTTGTAGCCAGAGTT	240	3	yes
GATCCCTTGGGCAAGTATCA	65	5	yes
GATCCCTTGCTTGCCTCTTG	211	24	yes
GATCCCTTGCTTCAACCTCC	21	4	yes
GATCCCTTGCTACATCTCCT	38	4	yes
GATCCCTTGCCTCCTGAGTT	31	12	yes
GATCCCTTGCATTTGCAACA	133	1	yes
GATCCCTTGCAGTTCTGTGC	176	7	yes
GATCCCTTGCACACAGCCCA	520	192	yes
GATCCCTTCTGCTCTACCTC	36	16	yes
GATCCCTTCCTTTGAAGTGA	61	5	yes
GATCCCTTCCTGCCCTCTTT	424	17	yes
GATCCCTTCCCCAGCGGTTC	153	24	yes
GATCCCTTCCAGCTGAGCCC	210	5	yes
GATCCCTTCCAAATCTGCTC	205	4	yes
GATCCCTTCATTGGGGACCC	22	6	yes
GATCCCTTCAATCCTGTAAC	20	0	yes
GATCCCTTAGGTGTAGGTCC	55	14	yes
GATCCCTTACTGTTGTGTCT	2	1	yes
GATCCCTGTTCCCCTGAGAA	51	6	yes
GATCCCTGTGTTCTACATGG	8	1	yes
GATCCCTGTGGTCACTTAGC	207	1	yes
GATCCCTGTGGATTTTGAAA	35	4	yes
GATCCCTGTGAGTTCAAGGC	74	26	yes
GATCCCTGTCTCGGGAGGTC	15	1	yes
GATCCCTGTCTAGTCCCTGT	100	1	yes
GATCCCTGTCCTTTCTGTTT	80	5	yes
GATCCCTGTCCCCCTACCCC	5	4	yes
GATCCCATGGAGTCCAAGGT	19	4	yes
GATCTTGCTGCTGTAGGAAG	58	1	yes
GATCCAGACAGCCATTTCAT	3	3	yes
GATCATGGGTTGGGAGCTCA	185	11	yes
GATCATGGGGTACTCAATGC	8	1	yes
GATCATGGGCAAAAAGCCCG	76	17	yes
GATCACATGAAGGAAGCTCC	9	7	yes
GATCCCTGTACACTATGTCT	8	1	yes
GATCCCTGGTTGCATCTTCG	42	3	yes
GATCCCTGGTGGCTGCCCTT	852	67	yes
GATCCCTGGGTGCCAGTTTT	126	22	yes
GATCCCTGGGGGCTGTGATG	30	12	yes
GATCCCTGGGGCTGCCTGTC	242	29	yes
GATCCCTGGGGCCCCGTGAG	40	8	yes
GATCCCTGGGGCATGTTGTA	69	6	yes
GATCCCTGGGGAGCCTGCGG	6	6	yes
GATCCCTGGGAGGATATGAG	28	1	yes
GATCCCTGGGAACGAAGCTG	63	10	yes
GATCCCTGGCTCAGTGAACA	102	18	yes
GATCCCTGGCGTCCCTATCA	183	0	yes
GATCCCTGGCCCCTGTGCCA	127	33	yes
GATCCCTGGCCAGAAGTACA	142	2	yes
GATCCCTGGCACTGCTGCCT	114	22	yes
GATCCCTGGCACCCAGCATC	137	9	yes
GATCCCTGGAGTGACCAGAG	3701	190	yes
GATCCCTGGAGTCTCTGAAG	39	13	yes
GATCCCTGGAGGCTGGAGAG	78	12	yes
GATCCCTGGAAGCTGTGATG	63	1	yes
GATCCCTGGAAGCAGGGACA	167	9	yes
GATCCCTGCTTTTGTGGCCT	353	11	yes
GATCCCTGCTTCCTGCCCAG	141	3	yes
GATCCCTGCTCTTAGGTGCT	7	2	yes
GATCCCTGCTCTGGACCCTC	381	28	yes
GATCCCTGCTCCCCTCTGGG	226	6	yes
GATCCCTGCTCCAGGTCCTC	364	29	yes
GATCCCTGCTAATGGAAGAA	30	7	yes
GATCCCTGCCTGTGGGGGGT	75	13	yes
GATCCCTGCCTGTCCTGAAA	32	10	yes
GATCCCTGCCTCGTCTGCCT	89	6	yes
GATCCCTGCCGAGGTGCTCA	238	11	yes
GATCATGGGAGCAGGGCTCT	25	24	yes
GATCCCAGGGACTCTGTTTT	50	9	yes
GATCATGGCTTTGAGGCCAG	9	4	yes
GATCATGGCGGTCAGCAGAA	25	9	yes
GATCATGGCCTGGTGCAGTA	4	0	yes
GATCATGGCAGTGGGAGACC	28	6	yes
GATCATGGCAGGGATACGCA	55	0	yes
GATCATGGCAGGCCTTTAAC	170	24	yes
GATCTTGATGCGGGTGGAAC	34	8	yes
GATCCCTGCCCTTTGGCCTG	46	7	yes
GATCCCTGCCACCTCATTGG	29	29	yes
GATCCCTGCATTTCCTCAAG	348	2	yes
GATCCCTGCATAGGACTGTT	39	4	yes
GATCCCTGCAGTACCATCTG	50	9	yes
GATCCCTGCAGGTCGCTCAG	42	2	yes
GATCCCTGCAGCGCTGTTTG	808	28	yes
GATCCCTGCAGAGGCTTCCA	40	8	yes
GATCCCTGCAGAAGGGGGGT	31	0	yes
GATCCCTGCACAAGGTGTTT	109	5	yes
GATCCCTGCAACAGCAAGGG	73	2	yes
GATCCCTGAGTTTACCAGCG	49	6	yes
GATCCCTGAGTTCAAGGCTA	106	7	yes
GATCCCTGAGTTCAAGGCCA	26	7	yes
GATCCCTGAGTAAACTTCTT	17	3	yes
GATCCCTGAGGTCTCCTGCC	57	14	yes
GATCCCTGACATAGCAGGAC	26	3	yes
GATCCCTGAATCCCCTACTC	7	5	yes
GATCCCTGAATAGAAATTGG	2	2	yes
GATCCCTGAACAGAGGTTCT	10	10	yes
GATCCCTCTTCTGGTGTGTC	39	4	yes
GATCCCTCTTACCTGCAACG	241	15	yes
GATCCCTCTGTACAGCATCC	44	6	yes
GATCCCTCTGGTGACTCCAC	461	27	yes
GATCCCTCTGGGTCATGTCT	415	30	yes
GATCCCTCTGAACTGTGGAG	13	5	yes
GATCCCTCTGAACCGCCGAG	27	3	yes
GATCCCTCTCTTTTCCTTCT	6	5	yes
GATCCCTCTCTTCAATGATG	29	29	yes
GATCCCTCTCTCTGGGGAAT	22	8	yes
GATCCCTCTAAGCCCCCTCC	57	1	yes
GATCTTCTGGTCCAGAAGGA	4	3	yes
GATCCCAGAACTGCAAGACG	28	5	yes
GATCCCACTTCTGCGTCTTA	154	58	yes
GATCATGCAACTGATGGAGA	4	5	yes
GATCCCTCGGTGACCACATT	108	21	yes
GATCCCTCCTTGTGAGCAGC	272	12	yes
GATCCCTCCTGTCACTGCAG	49	3	yes
GATCCCTCCTGGGCATTGCT	123	19	yes
GATCCCTCCTCAGGCATCTG	1451	51	yes
GATCCCTCCCTTGGGCCTCC	12	1	yes
GATCCCTCCCTCCGAGGCCA	81	9	yes
GATCCCTCCCCTCCCTGGCT	100	1	yes
GATCCCTCCCCACCCTGCTC	140	45	yes
GATCCCTCCCAGAAACCTGC	3364	353	yes
GATCCCTCCAGCCTCTACTG	59	0	yes
GATCCCTCCAGACACCAAGG	326	0	yes
GATCCCTCCACAAGATTCTG	30	1	yes
GATCCCTCAGGGTGTGTGCC	33	1	yes
GATCCCTCAGGAACAGAGGG	294	27	yes
GATCCCTCACCTCCTTCATC	58	2	yes
GATCCCTATGAAGTGTCTTA	1	1	yes
GATCCCTAGTGGCCCATCAT	33	11	yes
GATCCCTAGGGAGAAGGTGG	386	7	yes
GATCCCTAGCCCCATCCCAA	48	6	yes
GATCCCTAGCATTCTGTACT	802	24	yes
GATCCCTAGAGCCAGCACAT	184	1	yes
GATCCCTAGAAACTCTCTGG	8	3	yes
GATCCCTACTGCACCACCTT	159	20	yes
GATCCCTACTCGTTTCAACA	4	3	yes
GATCCCTACTATTGATTCTG	9	2	yes
GATCCCTACTACGTGCTGGA	1792	48	yes
GATCCCTACCTACAACCCTA	483	17	yes
GATCCCTACCCCACATGCTG	107	1	yes
GATCCCTACCCATGGGAATG	182	15	yes
GATCATGAGCTGGAGGCACC	50	16	yes
GATCATGAGAAAGCTCAGGT	29	5	yes
GATCATGACATTGTAGCCAG	4	4	yes
GATCATGACAGTCCCCCCAC	37	1	yes
GATCCCAAGTGGCACTGTTT	3	1	yes
GATCTATCACCTGTAACCAT	6	8	yes
GATCCCTACCCATGGACCCT	2531	117	yes
GATCCCTACCACCTGCCCGA	258	14	yes
GATCCCTACAACCAGAGATT	2	3	yes
GATCCCTAATGAGAGCAGAG	86	9	yes
GATCCCTAAACTACCTCTTG	111	7	yes
GATCCCGTGTCCCATAGTTG	3	2	yes
GATCCCGTGGCTTGTGGAAG	41	2	yes
GATCCCGTGGACTGTTTGCT	128	8	yes
GATCCCGTCCAAGGAGCATC	656	4	yes
GATCCCGCGAGGCCCGGAAG	2072	17	yes
GATCCCGCCTGCCCAGCTGA	469	17	yes
GATCCCGCCGTTCCACCCTC	267	7	yes
GATCCCGCCCACCCAAAGCT	205	5	yes
GATCCCGCCAAAAGAATTAC	266	10	yes
GATCCCGCACATCCACAAGT	134	19	yes
GATCCCGAGATTGCCAGCCT	1080	3	yes
GATCATCTGCTAGGGTGTGG	18	6	yes
GATCCACAAACTTCCTGACA	54	15	yes
GATCCCAAACCGGCTCCCGA	22	7	yes
GATCCTGAGAACTTCAGGCT	8	6	yes
GATCATCTAGTACGGGTACT	38	5	yes
GATCCATTGCGTAGCTGTCC	6	5	yes
GATCCGGTCAGTGGGCAGAC	10	1	yes
GATCCCGACACCAAGGAGAT	2241	110	yes
GATCCCGAAAACCAGAACTT	23	1	yes
GATCCCCTTTTTGAACAGGT	148	2	yes
GATCCCCTTTCTTTACCTTC	81	7	yes
GATCCCCTTTACCTTCTGGG	1227	4	yes
GATCCCCTTGGTTGCTGGAT	144	3	yes
GATCCCCTTCTCAGGGTCTA	472	16	yes
GATCACAAGGCGACTGAGTA	2	2	yes
GATCCCCTGTTGACTTACAA	426	16	yes
GATCCCCTGGGTTGAGAGAT	20	5	yes
GATCCCCTGGGGCAAGCTGC	536	60	yes
GATCCCCTGGGAGGAGACAG	384	20	yes
GATCCCCTGGCAAGAAGGAA	21	1	yes
GATCCCCTGGATACATGGTC	211	7	yes
GATCCCCTGCTACACTGATG	105	14	yes
GATCCCCTGCCTCCACCTCC	67	1	yes
GATCCCCTGCCTCAGCTCCT	345	12	yes
GATCCCCTGCCCCCCAACCA	47	1	yes
GATCCCCTGCAACAGACATT	54	4	yes
GATCCCCTGAGATGGAATTA	35	4	yes
GATCCCCTCTTCCCAAATAA	75	16	yes
GATCCCCTCTGGGCCTCCGA	58	1	yes
GATCCCCTCTCCTGCCCACA	191	12	yes
GATCCCCTCGGACCCCCTTG	2735	22	yes
GATCCCCTCCTTTCTGCCTG	13	0	yes
GATCCCCTCCTCCAGGCAGT	250	6	yes
GATCCCCTCCCTTGCTTTCT	117	15	yes
GATCCCCTCCCAGGCTGTCC	20	4	yes
GATCCCCTCCCACAGAATAG	6794	260	yes
GATCCCCTCACATGTGCTAT	296	22	yes
GATCCCCTATGGGGAGGAGG	307	32	yes
GATCCCCTATGCAAGCTGTG	5	4	yes
GATCCCCGTTGTACCTGGTG	17	3	yes
GATCCCCGTGTGTTTGCAGG	60	1	yes
GATCCCCGTGCCCCTGCCTA	294	9	yes
GATCATCCCCTGGCAAAGGC	3	2	yes
GATCTTCACTGCAGATGTGG	46	7	yes
GATCATCACGTACAGGAACC	6	6	yes
GATCCCCGTCTGTGTCTGTG	183	2	yes
GATCCCCGGTGCTCTTCGTG	497	18	yes
GATCCCCGGGAAAGTGTAGT	30	4	yes
GATCATGGCCTCTCCTGGGT	8	1	yes
GATCCCCGCAGAATCAGGAA	49	7	yes
GATCCCCGCAAAGTGAGCGA	132	1	yes
GATCCTGAAAACGCCACCCA	43	58	yes
GATCCCCCTTTGCTGCCTCC	61	13	yes
GATCCCCCTGATGGAGAGAA	9	2	yes
GATCCCCCTCCCTGCTCTCA	1	1	yes
GATCCCCCTCCCCCGCTGGC	45	60	yes
GATCCCCCTCCCCCCAGTGG	221	30	yes
GATCCCCCCCTTTTTTTGTC	22	2	yes
GATCCCCCCCAGCACACTCT	33	14	yes
GATCCCCCCACCCCACCACC	1267	21	yes
GATCCCCCCAACTGTGTGCC	33	5	yes
GATCTTGTTGGCCCATCTAT	19	15	yes
GATCCCCCAGGTCTCAGAGG	557	19	yes
GATCCCCCAGGGAAAGACTT	52	10	yes
GATCCCCCACCTCCTCGGCC	17	3	yes
GATCCCCCACATCCTGGGGC	266	12	yes
GATCCCCATTTGCAGTAAGA	78	1	yes
GATCTTATCTTCCCAGACTG	9	1	yes
GATCATATGGGTGATTCAGT	8	6	yes
GATCATTTTGGGGGTAAATT	9	7	yes
GATCCCCATGTTGAGCTCTG	486	11	yes
GATCCCCATCTGCAGTACAA	2	2	yes
GATCCCCATCTGACTCAGTA	8	3	yes
GATCCCCAGTCTTTAGTCCC	457	18	yes
GATCCCCAGGTCCCCTTCAA	51	10	yes
GATCCCCAGGGGCTCCCGGT	441	15	yes
GATCCCCAGGAGATGAGGTC	2	2	yes
GATCCCCAGCTCCTTTCAAA	55	2	yes
GATCCCCAGCCTTGGATAGT	145	8	yes
GATCCCCAGCCCAATCTTTC	26	7	yes
GATCCCCAGCATTAGGCCAT	109	1	yes
GATCCCCAGCAGTAACACTT	55	0	yes
GATCCCCAGCACAGGAAGGC	123	4	yes
GATCCCCAGAGTCCCCTGTG	328	55	yes
GATCCCCAGAGCCTTGGGGA	10	1	yes
GATCCCCAGAATCCCCAATA	6	6	yes
GATCCCCACTGTGCCTTTTT	100	6	yes
GATCCCCACCAGCCACCCCC	915	87	yes
GATCCCCACAGCTGCGTATG	966	32	yes
GATCCCCAAGTCTGTGACAC	1278	37	yes
GATCCCCAACAATGTGAAGA	1139	13	yes
GATCCCCAAAGCCTGGAGCC	681	31	yes
GATCCAGTGTGGGGCAGCGC	36	4	yes
GATCATAAGAGGCACGTGAT	92	4	yes
GATCCAGTCCAAGCTGGGTC	22	4	yes
GATCAAAACAAGACCCAGCT	59	16	yes
GATCCCATTTTTGACAGCAA	64	3	yes
GATCCCATTGGAGCTCTGTT	19	4	yes
GATCCCATGTTCAAGCTGGT	239	7	yes
GATCCCATGTGTTTAGTAAT	6	6	yes
GATCCCATGTGTCTTTTTGC	7	2	yes
GATCCCATGTGTCTCCCCCA	176	5	yes
GATCCCATGTGCGAATGAAC	3	3	yes
GATCCCATGTGCCACCATCA	167	29	yes
GATCCCATGTCCTGCTTTCT	52	16	yes
GATCCCATGTCCTGCTAAAA	27	3	yes
GATCCCATGCTTTGAAAAAT	32	5	yes
GATCCCATGCTAGCCTCTTG	522	18	yes
GATCCCATGCCTGGAATTTG	118	7	yes
GATCCCATGCAGAGCGGCCT	463	18	yes
GATCCCATGAAATCCCCAAA	37	4	yes
GATCCCATCTTCAGAGCTTA	73	2	yes
GATCCCATCTCCTGGAAGGA	143	0	yes
GATCAGGGCAAGAGTGTGCG	39	2	yes
GATCCCATCCTGGGCGTTAC	1	1	yes
GATCCCATATCCCTGTGAAA	122	25	yes
GATCCCATACCTGACATGAC	42	6	yes
GATCCCATACAATGCCGCCC	202	8	yes
GATCCCAGTTTGCTTCATGA	103	17	yes
GATCAGTTACTTACCCACTC	28	0	yes
GATCAGTTACACTGGGTCTG	14	0	yes
GATCCAAACTTCTACAGCAA	36	3	yes
GATCCAGGTGTGAGATGATG	1	1	yes
GATCCAGGTGCTATGTCTCG	7	0	yes
GATCAGTGGGTGCCCGTGAT	32	26	yes
GATCAGGCCATAATGTCTCC	22	18	yes
GATCAAGGCCACGGGGAGGA	117	9	yes
GATCCCAGTTCAAGAGGGGT	22	4	yes
GATCCCAGTGTTGCTACGTG	624	42	yes
GATCCCAGTGTGAATCATGG	21	1	yes
GATCCCAGTGGTATTCCGCC	46	1	yes
GATCCCAGTGGATGAAGTGT	99	9	yes
GATCCCAGTGCTGTGGAAGT	207	25	yes
GATCCCAGTGCTGGTCAGTT	325	15	yes
GATCCCAGTGAGATGCTGGT	18	8	yes
GATCCCAGTGAAGGGTTTCT	118	1	yes
GATCCCAGTCTGAGTGATTA	46	4	yes
GATCCCAGTCCTCCTGGGCA	57	3	yes
GATCCCAGGTGTCCCCATTT	222	5	yes
GATCCCAGGTGGAGCAACCC	330	24	yes
GATCCCAGGTCCCTCTGGGA	163	20	yes
GATCCCAGGGTTTTCTTGGT	16	2	yes
GATCCCAGGGGTCCTAGGGG	385	30	yes
GATCCCAGGGGGCTGGATGT	12	3	yes
GATCCCAGGGGCTCTTCTGC	88	11	yes
GATCCCAGGGAAAGTGCTAT	524	30	yes
GATCCCAGGCTAGCAAGCAA	366	18	yes
GATCCCAGGCGTCAAGCTCG	103	1	yes
GATCCCAGGCAAGGGATGGT	117	11	yes
GATCCCAGGAGTCAAGCTCT	186	14	yes
GATCCCAGGAGAGAGGCTTC	30	12	yes
GATCCCAGGAAGGACCATCA	59	9	yes
GATCCCAGGAAAGTTCTAAT	31	11	yes
GATCAGCACCGTGGTGAGCC	3	2	yes
GATCCCAGCTGGAGAAGCCC	15	15	yes
GATCCCAGCTATGATGTAGC	35	4	yes
GATCCCAGCGCTTAGCCACC	78	10	yes
GATCCTCTTTGACTTCACGT	2	1	yes
GATCCTACTATGAGCAAAAA	200	1	yes
GATCGTGCTCAAGGTTAACT	3	2	yes
GATCCTAGAAGGACAGCTTT	22	18	yes
GATCACTGTCAAAATACAGG	15	3	yes
GATCGAGAAGCCCGCAAAGA	17	3	yes
GATCCTATGCGGTGGAGCGT	45	11	yes
GATCTCTGTCTTTCCCTGGT	267	7	yes
GATCTCTGTCACATCCGATG	177	74	yes
GATCTCTGTATGTTCGAGCC	24	5	yes
GATCTCTGTAAACAGTTTGG	51	6	yes
GATCTCTGGTTGCTTTCAAG	19	6	yes
GATCAAGAGGTGAGGAGAGG	1	1	yes
GATCTCTGGCTCTTCATCCT	52	52	yes
GATCTCTGGCCTGTGGAGTA	391	53	yes
GATCTCTGGATGGAAATGTA	45	11	yes
GATCTCTGGAGGTCCCGGTG	62	5	yes
GATCTCTGGAAGGTGAGCCT	189	25	yes
GATCTCTGGAAAATTGCCAT	17	17	yes
GATCTCTGCTGTGGGAAAGG	391	0	yes
GATCTCTGCTGTCGGTTTCT	7	7	yes
GATCTCTGCCCCAAATCCAA	12	12	yes
GATCTCTGCCCAAACCAGGC	621	30	yes
GATCTCTGCCACCCACCCAC	163	4	yes
GATCCCTGGGGGTGGGGAGG	30	9	yes
GATCTCTGCAAGCAGTTGTC	102	7	yes
GATCTCTGCAAAATAGACTT	7	2	yes
GATCTCTGATGGCTGGGGAG	249	4	yes
GATCAAAAGGAGTATCAAAG	4	3	yes
GATCTCTGAGGAGGTGGCTC	92	3	yes
GATCTCTCTTGTTGGAAGGA	88	11	yes
GATCTCTCTTCCCAGAGGAA	808	72	yes
GATCTCTCTGGAACTGTAAG	30	7	yes
GATCTCTCTGGAACTATCTA	75	9	yes
GATCTCTCTGATGAAGAAAG	14	2	yes
GATCTCTCTCCTTGGCCTTC	85	28	yes
GATCTCTCTCATCGAGAGCA	49	13	yes
GATCGCACAAAAGAAGCAAT	4	4	yes
GATCTCTCCCGTTCTCAGCA	22	18	yes
GATCTCTCCCCAGAGCAACG	113	1	yes
GATCTCTCCATATCAAGCGA	902	85	yes
GATCTCTCAGGCCAGGATTT	33	27	yes
GATCTCTCACTGGACCAGCG	24	9	yes
GATCTCTCAAATCTTGGATT	3	0	yes
GATCTCTATCCTAACGTCCA	61	13	yes
GATCTCTAGCTGCTGTGTAT	6	6	yes
GATCTCTCCAAGAAGGCCAA	2	2	yes
GATCAAGATAACGGTGGCTT	71	1	yes
GATCTCTAGAAAAGTCGTTT	4	3	yes
GATCTCTACTTTGGAGTCCT	31	2	yes
GATCTCTACTGGCAGGCCAT	439	7	yes
GATCTCTACTGCTGTTAGGT	67	6	yes
GATCTCTACTCCCAGGAGAT	97	2	yes
GATCTCTACCCAACTGTCCA	144	13	yes
GATCTCTACCACCCAGGTAG	163	9	yes
GATCTCTACAGACAAAATCT	22	0	yes
GATCTCTAAACTGTGACACA	25	24	yes
GATCTCGTTTTTCAAAAGCA	36	4	yes
GATCTCGTTCATTGGCAAAA	19	19	yes
GATCTCGTGCAACTGTTGTC	271	0	yes
GATCTCGGTGTCATCAGAGG	23	8	yes
GATCTCGGTCTGTGCCGGGG	172	9	yes
GATCTCGGGTGCGTGGCTGG	3	4	yes
GATCTCGGCCTCACAAATCC	32	6	yes
GATCTCGGAGTCCTGGCCCC	16	12	yes
GATCTCGCCGTGTCCCTGGG	48	6	yes
GATCTCCTTTGTGAATGGTG	29	4	yes
GATCTCCTTTCCGGAAGCAA	227	1	yes
GATCCCACTGTCACCCTCGC	4	5	yes
GATCCCCAAGGAGAACCGGC	16	2	yes
GATCCAGAAGAGCATGAGGG	14	18	yes
GATCTCCTTGGAGTCTCAAG	745	222	yes
GATCCCTTCCTCCTTTAGTT	10	5	yes
GATCTCCTGTTGTCTGGGCT	4	4	yes
GATCTCCTGTCTATGTGGGC	75	9	yes
GATCTCCTGGGCTGTTTCTC	41	18	yes
GATCTCCTGGAAGCTAGCAG	94	6	yes
GATCTCCTCTTCGGGGTTCT	39	4	yes
GATCTCCTCGCTGGAAAAAG	345	37	yes
GATCTCCTCCTTGCTTTCCT	20	6	yes
GATCTCCTCCTTATTCCCCA	214	22	yes
GATCTCCTCAGAGAAGTCTG	18	18	yes
GATCTCCTCAGAAGAAATCA	33	6	yes
GATCTCCTCACATACAGCAT	2	2	yes
GATCTCCTCAACCAGTGTGT	18	5	yes
GATCTCCGTCCCTCAGCTCC	499	234	yes
GATCTCCGCGGCCCGAGTGC	7	7	yes
GATCTCCGCCTGGCACCCAG	39	6	yes
GATCGCAGAGAGGCGAGAGC	207	25	yes
GATCTTACTTAGCATGCACA	14	11	yes
GATCGCAACACCTGCAAGCT	2	3	yes
GATCCGCCGGCGAAAATTCT	9	3	yes
GATCTCCGCACTGTGTGTAC	29	29	yes
GATCTCCCTTTGTACTGTCT	10	10	yes
GATCTCCCTCTTGGAGGCCA	47	13	yes
GATCTCCCTCGTGCAGTGGC	19	19	yes
GATCTCCCGTGTTACCAATG	29	23	yes
GATCTCCCCTTTGTAGGACT	3	3	yes
GATCCTTTCTCCAAATGTTC	23	10	yes
GATCCTTTCAACTCAAAAGC	81	6	yes
GATCCACTGCGTTCGAAGCG	10	3	yes
GATCTTAGGCAAGTTCTTGG	15	12	yes
GATCTTAGCAGTCGTTCTTT	4	0	yes
GATCTTAGAGAAGGAGACAG	17	13	yes
GATCTTAGAGAAAGGCCAAC	339	45	yes
GATCTTAGACAGGCGATGTG	6	5	yes
GATCGCAGCACTGAAAACAA	27	3	yes
GATCCTCAAGTTCCTGTCCG	4	5	yes
GATCCTGGAGGAATGGGTGT	13	0	yes
GATCTCCATCGTGCAGGGAT	129	1	yes
GATCTCCATAGTTTAGCTCT	26	4	yes
GATCTCCAGTCCAAGGCTTC	176	36	yes
GATCTCCAGTAACCTTTGTC	19	1	yes
GATCTCCAGCTTCTCTGCCT	74	1	yes
GATCTCCAGCACAGCAGAGG	27	2	yes
GATCTCCAGAGTCGCTTGGA	18	13	yes
GATCTCCAGAGGAACACCAG	17	17	yes
GATCTCCACTTTCTACAACA	51	15	yes
GATCTCCACTCTCCCTCTGG	30	4	yes
GATCTCCACGGGTGCTTAGT	154	9	yes
GATCTCCACATCTCCAAGGA	11	2	yes
GATCTCCACAGGCCAGCCTT	80	1	yes
GATCTCCACACAACAGGTGA	647	30	yes
GATCTCCAATGTTGTGCTAA	31	3	yes
GATCTCCAACTTTGAAAGGC	140	15	yes
GATCTCCAACATTTTGGAGG	94	28	yes
GATCACAGCCAGTTCAAAGC	51	15	yes
GATCACAGCAGTAAATGTGA	85	12	yes
GATCACAGCAGCTGAGCTGT	255	4	yes
GATCACAGATTTAAGGGGAG	60	17	yes
GATCACAGATTGCTTCTCTG	16	2	yes
GATCACAGAGGTAGGAACTG	1	1	yes
GATCACAGAGGGACACACTA	24	19	yes
GATCACAGACTTCGGCCTTG	1	1	yes
GATCACAGACTGTTGGCCCC	50	9	yes
GATCACAGACACCTGCACTG	52	7	yes
GATCACAGAAGTGAGCGGAT	38	5	yes
GATCCTTCTGCAGACACCGA	137	16	yes
GATCCTTCTGACTTGGCTTT	5	7	yes
GATCCTTCTCAGAAGAGTCT	78	2	yes
GATCACACTTCCCACAACCC	71	4	yes
GATCACAGGGAGCCTGTGTT	44	0	yes
GATCTTAAGGCGGAGCTCTT	7	5	yes
GATCTTAAATGGCGTAGTAT	6	5	yes
GATCACAGCAGAGATGGCCA	80	3	yes
GATCTTAAACCCAAAGTATG	31	25	yes
GATCTCATTGTTCTTGGAGA	3	3	yes
GATCTCATTCCCGAGAGAGG	130	12	yes
GATCTCATGTGTGGGAACCA	11	5	yes
GATCTCATCCTCTCACCTCC	20	1	yes
GATCTCATCCATTGAATTTG	200	28	yes
GATCTCATCCAGTCTGCTGT	15	5	yes
GATCTCATCACAGGAGCATC	51	14	yes
GATCTCAGTTTTCATCAAGT	17	1	yes
GATCTCAGTTTGAGTGGATG	25	4	yes
GATCTCAGTTTGAGGTCAGC	7	5	yes
GATCTCAGTTTCGCTGATGT	19	2	yes
GATCTCAGTTCTGTGTTTAC	71	1	yes
GATCTCAGTTCACGGGGTGG	253	118	yes
GATCTCAGTTCAACAGCTCC	180	33	yes
GATCTCAGTGTGGAGAGCAT	4	3	yes
GATCTCAGTGGGGGTGGGAG	196	4	yes
GATCTCAGTGCTGGGGAGGT	37	37	yes
GATCTGCAAACATGATGAAT	2	2	yes
GATCACACTGATGGAGCTGT	6	1	yes
GATCACACTGAGCAACACCC	79	14	yes
GATCACACGGCAAAACAGTA	25	1	yes
GATCACACCTTGCTGTTCCC	15	4	yes
GATCACACCTGTCCCTACAC	1658	17	yes
GATCACACCTGCAGTTTGGG	98	5	yes
GATCACACCGTTTCTTCCTA	6	1	yes
GATCACACCGAGATTCTTTT	14	3	yes
GATCACACCGAGACCAGTGG	56	13	yes
GATCACACCCCTGGTCACCA	124	74	yes
GATCACACCATTGAGTTCCG	36	5	yes
GATCACACCACCGTGTCAAA	17	13	yes
GATCACACCAAGCCCCAGGA	40	2	yes
GATCACACATTTGCAAGGGA	99	7	yes
GATCAGGAGAAGGGCCTGCC	19	15	yes
GATCACACAGAGCTGAGGGC	6	1	yes
GATCACACACTCAGTCCTTG	18	7	yes
GATCACACACGGCAACCGAC	113	27	yes
GATCACACAAGTGTGGGTTT	27	2	yes
GATCACACAAAACTGTCAGC	47	3	yes
GATCACAATCAGGAACTCAC	87	0	yes
GATCACAAGTTTGCATTCAG	29	0	yes
GATCACAAGTTTGAGACCAG	49	11	yes
GATCACAAGTTGTTTCCTGT	2	2	yes
GATCACAAGTTAAGGTCAGC	3	3	yes
GATCACAAGTGCAGCATTCT	18	0	yes
GATCACAAGGTTTACATCTG	9	0	yes
GATCCTTCATGTTGAGCCAG	340	48	yes
GATCACAAGGGGGTAATCAA	1	1	yes
GATCACAAGAGTTACTAGTT	32	16	yes
GATCTGTTGTTTGCGTTGAA	29	9	yes
GATCTGCACCTAACGTTCAC	12	9	yes
GATCCTTGACTCTCAAGCCC	74	45	yes
GATCCTTCTGTCGGCTTCCT	106	5	yes
GATCTGTTCAGCACACCTGA	125	54	yes
GATCTGTTACTTTGGCGAGG	719	7	yes
GATCTGTGTGTCATCAGATG	59	5	yes
GATCCTTCTCTGCCCTTCCC	10	10	yes
GATCTGTGTGGGACCAAGGC	63	13	yes
GATCTGTGTGGCTCCTCTGC	92	19	yes
GATCTGTGTGGATGTCCTGA	24	8	yes
GATCCTTCCTTTCCCTTGGC	133	8	yes
GATCCTTCCTTCTTCTCTTC	27	9	yes
GATCTCAGTAACTGTCGAGC	56	9	yes
GATCTCAGGGTTCCCATGGT	2	2	yes
GATCTCAGCTTGCATAGCAT	271	9	yes
GATCTCAGCTGATGGATGGT	2	2	yes
GATCTCAGCTCCACTGTGAA	52	5	yes
GATCTCAGCCCCTACTCCCA	57	2	yes
GATCTCAGCCATAGTCGTTG	180	8	yes
GATCTCAGCACTGTGGCTGT	435	24	yes
GATCTCAGCACTAGAGGAAT	3	3	yes
GATCTCACTGTTTCATGCTG	6	6	yes
GATCTCACTGCCTCCCTCTC	245	70	yes
GATCTCACTCAGCAACAAGT	61	2	yes
GATCTCACGGGCCGACCGAG	60	43	yes
GATCACAAGAGGCCCGTTTG	127	12	yes
GATCACAAGAGAGTTGCAAC	11	9	yes
GATCGGGGGGATGACCAGCT	167	78	yes
GATCACAACTTTAATCCCAG	16	5	yes
GATCACAACTTCTGAAACAC	39	10	yes
GATCACAACTGTAGGGAATA	75	7	yes
GATCACAACGGCTTGCGTGT	245	8	yes
GATCACAACCCTGATGGCAG	1220	1	yes
GATCACAACCCCCAAGTCAG	422	19	yes
GATCACAAATACAGATTCTG	19	15	yes
GATCACAAATAAATGGTGCT	2	2	yes
GATCACAAAGTTTGAGAATG	719	10	yes
GATCCTGTTGTGTGTTTGCA	2	2	yes
GATCACAAAGGTGGAATGTT	23	1	yes
GATCACAAACTTCTGCAAAA	69	10	yes
GATCACAAACATCACAGAAG	31	11	yes
GATCACAAAATGAGTCACTC	1	1	yes
GATCCTGTGCCTGGCCTTTG	15	20	yes
GATCAATGGGCAGCAGCAAT	170	29	yes
GATCTGTGTCCCAGCGAAGC	164	22	yes
GATCTGTGTATACCCCACTC	125	2	yes
GATCTGTGGTCCCTGCCTCC	30	3	yes
GATCTGTGGGGAAGGGGGCT	25	6	yes
GATCCGTTTGCCAGAATTTA	3	3	yes
GATCTGTGGACGACGAGAAC	65	8	yes
GATCCTGTGGCTAAGTAAGA	8	8	yes
GATCTGTGCGATGTTGTGGC	41	3	yes
GATCTGTGCCATCCCATACA	441	15	yes
GATCCTGTCTCCCGTGGACA	31	4	yes
GATCTCACACGAACTAGAAA	20	16	yes
GATCTCAATGCTTGTCTTGG	29	4	yes
GATCTCAATGAAGTAGCTAA	7	5	yes
GATCTCAATGAAAGAGGACT	171	39	yes
GATCTCAAGAAAGTTAGAGA	5	4	yes
GATCTCAACTGACTCCTCTT	522	32	yes
GATCTCAACTCTGCTCTAGT	10	1	yes
GATCTCAAACTCAGAGGTTT	1	1	yes
GATCCCTCCCAAGTATGAGG	2	2	yes
GATCAATGCAATGACGTGGG	221	50	yes
GATCAATGATGAGGACAAAC	1467	51	yes
GATCAAGTCCGGGAACTCTC	76	6	yes
GATCAATGACAACCAGAAAG	3	0	yes
GATCCTGGTAGGAGCACTTG	23	8	yes
GATCCTGGGTACTGCACAGT	1543	139	yes
GATCCTGGGGGTGGACTGCA	55	2	yes
GATCTTCAGCCTGGTTTACA	9	2	yes
GATCAATCACATGGACACTA	44	35	yes
GATCCTGGTGGGCACGGGGT	11	4	yes
GATCCACAGGTCCACTGACA	3	3	yes
GATCCTGGGGTTGGACCCCA	114	48	yes
GATCCTGGGAGTGGGCCCTG	9	9	yes
GATCCTGGGACATAATCACC	41	10	yes
GATCCTGGGAAGCCTCCTCA	89	1	yes
GATCCTGGCTGATGTCCTCC	22	29	yes
GATCACCTTCATCCTTGGGC	19	3	yes
GATCTGTCTCAACAGTCTGG	45	23	yes
GATCTGATTCTAGAGCACTT	7	5	yes
GATCCTGCCCTTCCATCCTC	30	1	yes
GATCCTGCGGGTGGGAGGAA	148	3	yes
GATCCTGCCTTGAATTCCTG	9	3	yes
GATCAAGTTTGTGGTGTGTT	56	8	yes
GATCAAGTTTCAGGAAGGCT	157	8	yes
GATCAAGTTTCACATCCTTC	68	20	yes
GATCCTGCATATCTCAAAGA	13	4	yes
GATCTGTCTACAGGGAAATG	3	2	yes
GATCCTGCAGCAGGAGTGCA	71	21	yes
GATCTGTCCTGATGAAGGCT	241	21	yes
GATCCTGCAAACTTCCCTGG	27	22	yes
GATCCTGATTTAGGAAGTGT	1	1	yes
GATCTGTCCATCTTGGAGTT	84	14	yes
GATCTGTCCAGGGTGCAACA	15	1	yes
GATCCTGCTTGTATGTATCT	12	1	yes
GATCTGTCAGCTGTGCTCTC	8	2	yes
GATCCTGCTCAGACCATACC	50	15	yes
GATCCTGCCAGCCAGACCAA	153	7	yes
GATCTGTAGGCGAGGGAATC	37	30	yes
GATCCTGCAGACACTCAGAG	18	10	yes
GATCTCTCGCTCCGCCACTA	1	1	yes
GATCAAGTTGCCAGCATTTG	3	2	yes
GATCAAGTTGAAAGAGTGTG	36	36	yes
GATCAAGTTCAGTGCGCAGG	30	7	yes
GATCAAGTTACTGTGGAGAG	1	1	yes
GATCAAGTGTTTGCAGGACG	10	1	yes
GATCAAGTGTGACCCAGAAA	9	7	yes
GATCAAGTGTCGGATGGAAT	18	2	yes
GATCAAGTGTAAATGTGCTG	6	6	yes
GATCAAGTGGTCAAGGTACT	30	30	yes
GATCAAGTGGATTCGGCGGT	458	38	yes
GATCAAGTGCTTTGCCAAGT	16	0	yes
GATCAAGTGAGCTGTATCAG	37	30	yes
GATCAAGTCTTGTCAGTTTG	63	14	yes
GATCCTGAGTGGCTTGCTAG	5	2	yes
GATCAAGTCGTGCTTCTGGC	1998	153	yes
GATCCTGAGTGCATTGATGC	2	2	yes
GATCAAGTCCTTTGTGAAAG	658	15	yes
GATCAAGTCCGAGGTCCCCC	14	0	yes
GATCCTGAGGGCTGCATACC	32	4	yes
GATCAAGTCATTTGCTAGTT	17	3	yes
GATCCTGAGGAGTCAAATAT	14	2	yes
GATCCTGAGGAAGGCCAGGC	135	18	yes
GATCCTGAGAGCATCTTCGA	20	7	yes
GATCAAGGTGTTGCCTGGTG	87	14	yes
GATCAAGGTCCTAAAATTTC	612	28	yes
GATCAAGGTCCAGGTGGAAG	10	2	yes
GATCTGTACCTGCGGCTCCA	58	33	yes
GATCCTGAATGGGCAAGAGT	10	3	yes
GATCTGGTTTCGCCCCAGCC	2	1	yes
GATCCTGAAGCTCTGGCTGA	121	37	yes
GATCTGGTGTACAGAGAGTT	5	4	yes
GATCTGGTGCTGATAGGAAG	95	34	yes
GATCTGGTGATGTGTGAGAC	10	8	yes
GATCTGGTCTCCCCGGCAGA	5	4	yes
GATCCTGACTCCTTGAAGCC	4	3	yes
GATCTGGTCACTGGTCAGAG	27	4	yes
GATCTGGTATGAACATCGGC	173	19	yes
GATCTGGGTTTGTCAACAGG	7	7	yes
GATCTGGGTTGTGAGGAGGT	50	4	yes
GATCTCTGTGAAAGTAGTAC	7	5	yes
GATCAAGGTCCACTTAGTGG	75	2	yes
GATCAAGGGTTCCCTTCCAA	19	15	yes
GATCAAGGCTTTCCTCGGGC	31	9	yes
GATCAAGGCTCTGGAGATAA	9	1	yes
GATCAAGGCTCCCGGTTTTG	1149	33	yes
GATCAAGGCCTTTCTGTCCT	429	4	yes
GATCAAGGCCCACTGTGGAG	87	1	yes
GATCAAGGCCACTGTGTAAC	54	5	yes
GATCCTGAAAGACCGGGAAA	94	15	yes
GATCAAGGCAAAAGGAGGAT	65	13	yes
GATCAAGGAGGTAGATATGG	326	18	yes
GATCAAGGAGGCTGTTGCTG	75	43	yes
GATCAAGGAGGAAGTGTTGT	14	11	yes
GATCAAGGAGAGAAGCAGGA	79	0	yes
GATCAAGGAAGAGGAACCTG	5	4	yes
GATCCTCTGGCAGATGTTTG	170	4	yes
GATCAAGCTTAGCAGTCAAG	134	17	yes
GATCAAGCGGGCTTTCCTTA	440	23	yes
GATCAAGCCTGTTAGCCCTG	36	20	yes
GATCTGGGTGGGACAGTCAC	18	14	yes
GATCCTGAACTCCCCAGAGA	23	24	yes
GATCCTGAAAGTGACTGGGG	1	1	yes
GATCTGGGGCTTTTTGTGTG	49	12	yes
GATCCCTTTGGTGCCCCTGA	93	7	yes
GATCTGGGCTTCCAGAGTGC	3	3	yes
GATCTGGGCTGAGCTTGGTT	23	5	yes
GATCTGGGCAGTTGTTTTGC	3	1	yes
GATCTGGGCACTGCTGTGCT	6	1	yes
GATCTGGGCACCGAGGCTGG	223	24	yes
GATCTGGGCACCCACTGCCT	25	2	yes
GATCTGGGATAAGGAGAGCG	52	4	yes
GATCAGGCTTGTCTGGAACT	1	1	yes
GATCAAGCCCTTCTTCCATT	425	3	yes
GATCAAGCCCATGTGAACCA	4	1	yes
GATCAAGCCATCCATCAACT	1000	12	yes
GATCAAGCATCATGATGCTC	12	9	yes
GATCAAGCAGTTTCTGGAGT	33	15	yes
GATCAAGCAGTAGAGTTTTT	14	0	yes
GATCAAGCAGCGAGAGGCTG	676	96	yes
GATCAAGCAGCAGCACGGGG	72	51	yes
GATCAAGCAGAACCTGGAGA	226	1	yes
GATCAAGAGTGTTGGCTGCT	20	9	yes
GATCCTCCTGCACCATGCCT	24	10	yes
GATCCTCCTCACTTAGCACC	85	14	yes
GATCAAGACTGTGACTTTTG	144	16	yes
GATCAAGACTCTCCTGGAGA	157	1	yes
GATCAAGACGCCTGTCATTT	9	1	yes
GATCAAGACCCTCCAGAGGT	65	21	yes
GATCAAGACCACCACTGCAT	37	2	yes
GATCCTCCCAAAAGCCATCT	45	5	yes
GATCAAGACAACCAAGGCTA	43	7	yes
GATCAAGAACAGAATGGGCT	16	12	yes
GATCCTCAGGTTTGTGTTGC	3	1	yes
GATCCTCACTGGCAGCAGCT	87	9	yes
GATCCTCACCCACCTGCTGG	425	38	yes
GATCTGGGACATAGCATCAC	37	1	yes
GATCTGGGAAGGACCCTTTC	18	14	yes
GATCTGGGAAGACTTCTCTA	139	33	yes
GATCTGGGAAAATGGCAGTT	64	9	yes
GATCTGGCTTTTGTTTTCCA	83	66	yes
GATCTGGCTTTACTTCTCTG	12	9	yes
GATCTGGCCCTTTTGTCCTT	117	15	yes
GATCAACTTTTTTCCCCCAA	11	11	yes
GATCAACTTTCAGCTGGGAA	37	22	yes
GATCAACTTGCTGGGACCTA	404	409	yes
GATCAACTGTGCAGACAACA	1712	93	yes
GATCAACTGCTACGATGTGT	23	4	yes
GATCAACTGAGGTCTTTCTT	10	3	yes
GATCAACTCTTTGTTTTGGC	2	2	yes
GATCAACTCTTGGCTTTGAC	65	66	yes
GATCAACTACCTGCAGGAAG	736	137	yes
GATCCGAGCCGCACGCTGTG	2	3	yes
GATCAACGGAGGACTATCAT	29	5	yes
GATCTGGCCAGGGTGCCTTT	3	3	yes
GATCTGGCCAACACAAGAAC	108	21	yes
GATCCTCCCTGTTCTCATCT	8	8	yes
GATCTGGCAGATGTGAGGTT	57	7	yes
GATCCTCAGACTCAAGTGTC	28	3	yes
GATCTGGAGTAAGGGCTGTT	85	28	yes
GATCTGGAGGTGGACGGACA	76	12	yes
GATCTGGAGGTGGAAGTGGT	31	8	yes
GATCAACGCGATTTAGCTGA	8	1	yes
GATCAACCTGAGAGGGAGAT	8	6	yes
GATCAACCTGAACTTGGGAC	89	8	yes
GATCAACCTCCTGGGCTTCA	2	2	yes
GATCAACCCGAGTTGCTGTC	9	3	yes
GATCCCAGCATCATCTTTGC	23	1	yes
GATCAACCATTCCTGTGTCA	2	2	yes
GATCAACCACTGCAAATTCG	185	87	yes
GATCAACCACTGACCTGCCT	292	39	yes
GATCAACATGTTCGTGATGT	16	2	yes
GATCAACATCCTCCACCAAG	1	1	yes
GATCAACAGTGAGGCAAGCA	80	11	yes
GATCAACAGCTGCCCTGCCT	492	72	yes
GATCAACAGCGTTGCCTTCC	39	31	yes
GATCAACACTTACGTTAGGA	20	2	yes
GATCAACACGAATCGTTTTT	145	12	yes
GATCCCCAGGTCTGGCATAG	2	2	yes
GATCCCCAGAAACTGAGTGT	4	2	yes
GATCCCACTCTGCAACTACT	5	2	yes
GATCTTGTGCCATCTTTGGT	2	2	yes
GATCGGCTCTTCCCACCTAC	41	4	yes
GATCTCCCCGTCACAGAACC	78	25	yes
GATCAGTGCAAATGTTTTTG	29	29	yes
GATCCAGGCTATCTCCTCTG	48	2	yes
GATCAGTCCTTCCCTCGAGA	51	1	yes
GATCCAGGAGGCTCTGCACG	62	1	yes
GATCTGTGTCTCTTCTCACA	2	2	yes
GATCCCAGCATTTCTCAATT	1	1	yes
GATCCCAGCATCGGCAAGCG	359	16	yes
GATCCCAGCAGCTGTTACCT	428	47	yes
GATCCCAGCACACACCGTGA	276	11	yes
GATCCCAGATGGACATGGCA	4	0	yes
GATCCCAGATGATACCCACT	52	4	yes
GATCCCAGAGGAAAGGGTTT	123	23	yes
GATCCCAGAGACAATCTCAT	124	28	yes
GATCCCAGACGCCTCAAATG	16	9	yes
GATCCCAGAAGCCGCACAGG	44	7	yes
GATCCCAGAAGCACACTGGC	89	15	yes
GATCCACAGCCTCCTCTGCC	8	8	yes
GATCCCAGAACCATTGCCTG	14	3	yes
GATCCCACTTCACCTGTTAT	29	10	yes
GATCCCACTGCTCATTTGAC	76	19	yes
GATCCCACTAACCTGCAGTG	13	0	yes
GATCCCACGGTAGAACCTGA	70	0	yes
GATCCCACGAGCCAGAGAAC	262	31	yes
GATCCAGGAAATGCTGGAGA	2	2	yes
GATCCAGGAAAAAGTGTTTC	2	2	yes
GATCCTAGCGGACCTCAACC	51	3	yes
GATCCAGCTGGGCTGCCACA	13	13	yes
GATCTGTCTCTTTCACGGAA	3	2	yes
GATCAGGTTTCTTCTTTTCC	13	0	yes
GATCTGTCCAGGGGACATTA	17	9	yes
GATCCAAGTCAGGGAGAAAG	23	8	yes
GATCATCAGCTGGACTTTGT	2	2	yes
GATCCCACCTCACGTGTGAT	107	6	yes
GATCCCACCGGTCCAGTGGA	21	1	yes
GATCCCACCGCAGCTACCAG	601	3	yes
GATCCCACCCCAGTAGGAAG	51	8	yes
GATCCCACCATTCTCCTTGG	263	19	yes
GATCCCACCATCCTACCTAC	4	3	yes
GATCCCACATTTCCCTTGCC	13	10	yes
GATCCCACAGTGTGACTGAT	87	17	yes
GATCCCACAGGCCGGTGGAG	37	4	yes
GATCCCACAGCCAGGCTCAC	34	14	yes
GATCCCACACTTAAGACTTC	28	1	yes
GATCAGGTGGATGTGCAGGA	79	9	yes
GATCAGGTCCTAAACATGGC	54	4	yes
GATCCAGCAGCCGAGACTGA	32	4	yes
GATCACTTTACCTCTCTGCT	4	1	yes
GATCAAGAGTTGGAGATGGG	12	9	yes
GATCCCACACAGCAGACAGA	99	11	yes
GATCCCAATTGGTGGAAAGG	173	8	yes
GATCCCAATTCTGTCCCAAT	84	18	yes
GATCCCAATTACAACCCACT	44	43	yes
GATCCCAATGGTCACACACC	46	2	yes
GATCCCAATGCTGCCCCATC	76	1	yes
GATCCCAATGAGCCCACCTA	28	1	yes
GATCCCAAGTTCAAAGCCAG	70	0	yes
GATCCCAAGTGCTGGGAAAG	148	2	yes
GATCCCAAGTCCAACACCCA	180	26	yes
GATCCCAAGGGTCAGCACTG	3	3	yes
GATCCCAAGCCTCACCGGCT	386	20	yes
GATCCCAAGCCAAGAAACAC	109	13	yes
GATCCCAAGAGGAAGGGTAT	8	8	yes
GATCCCAAGAAAGGATGGAA	8	1	yes
GATCCCAAGAAACTACTTGA	157	1	yes
GATCCCAACTGTCAGTGCCA	165	2	yes
GATCCCAACTGTAACAGCAA	4	4	yes
GATCCCAACTCTGCAAGAGC	27	2	yes
GATCCCAACGTGACCATCAT	21	8	yes
GATCCCAACATTGTTGGCAA	35	4	yes
GATCCCAACACAGCGATATG	467	50	yes
GATCCCAAATTGGGTTGTCA	46	1	yes
GATCCCAAATCTGTGGTGTG	68	3	yes
GATCCCAAATACTCAGTGCT	10	1	yes
GATCCCAAAGGCTCCAGGGT	2	2	yes
GATCCCAAAGCACAATGGTG	9	2	yes
GATCAGGGGCCAAGGTCCTT	60	4	yes
GATCTCATCCAAGCAAATGG	22	18	yes
GATCAGGGCTCCAGTGGTCC	110	40	yes
GATCAGGGCCTGGACTCTGG	17	17	yes
GATCCGGCCCACCTATGCTG	13	14	yes
GATCCCAAACTGTATCCTTG	41	7	yes
GATCCCAAACTGCTTTCTCA	17	5	yes
GATCCCAAACTGAGGCAGCA	192	9	yes
GATCCACGTGCCTTTGTCTC	17	13	yes
GATCCCAAACAACTAAGAAT	71	8	yes
GATCCCAAAATGCTGCGGAG	387	6	yes
GATCCCAAAATAGGTGTTGA	1	1	yes
GATCCCAAAAACCGTGCAGC	109	6	yes
GATCCCAAAAAATCTGTGCC	373	43	yes
GATCCATTTTTCTGTGACAT	4	0	yes
GATCCATTTGCTTACACTGT	38	13	yes
GATCCATTTGCTCCCAAGAC	2	2	yes
GATCCATTTGATGCTTCCAG	2	2	yes
GATCCATTTCTTCTGCATGA	88	7	yes
GATCCATTGTGTGGTTTAAC	4	4	yes
GATCCATTGTATGGCTTTAT	6	1	yes
GATCCATTGGTTTCTCAGTC	92	19	yes
GATCCATTCTCCCGCCACAG	66	9	yes
GATCCATTAGTGTTTGCTGG	5	4	yes
GATCCATCTTCAGCTGACTG	143	4	yes
GATCCATCTCTTTCCTTCTG	27	9	yes
GATCCATCTCCTCTGGCTCT	33	3	yes
GATCCATCTCCAGCACATGC	36	29	yes
GATCCCAGAGATGTGCCAGG	2	2	yes
GATCTGGTGTGTCTGAAGAC	15	1	yes
GATCTGGGTGGCCAGTACTT	319	64	yes
GATCTGGGTAGGGGACCAGG	70	6	yes
GATCCAGAATGTCAGCTGGA	97	0	yes
GATCCAGAAGGGTCTCTCTC	38	3	yes
GATCAGGCCCTAAAGCATTG	65	8	yes
GATCTGGAACACCAACAGCT	3	4	yes
GATCCATCGACTGTGATAGG	73	4	yes
GATCCATCCTTACTTGGTTT	12	6	yes
GATCCATCCTGTAACCCTTC	16	2	yes
GATCCATCCTATCCATCCGT	83	8	yes
GATCCATCCCCGGCAAAGAG	287	27	yes
GATCCATCCCAGAGGGACTG	320	17	yes
GATCCATCCAGCAAAGAGGA	30	1	yes
GATCCATCCACCAGCAGGAG	25	6	yes
GATCCATCCAATGGCTTACC	378	19	yes
GATCCATCAGGGCTGAGCCT	55	14	yes
GATCCATCACAGGACTATGT	72	3	yes
GATCCATCACAGCTGCCAAG	17	1	yes
GATCCATCACAAGGCAAAAC	28	3	yes
GATCCATCAAGTGGGTAAGT	13	5	yes
GATCCATATCACTGGATGTA	6	4	yes
GATCCATAGCACAAAGCCAC	3	2	yes
GATCCAGAAACAGCAAGGCC	4	3	yes
GATCAGGAGCAGGCAACACC	352	20	yes
GATCCACTCACAGCACCTCC	15	3	yes
GATCCACTCCCTGTTCCCTT	9	7	yes
GATCCATACTCCCCAGTATG	2	2	yes
GATCCATACCCACCACTGTG	20	11	yes
GATCCATACAGCATTTTGCG	20	16	yes
GATCCATACAATTTGTGCCA	451	8	yes
GATCCATAATGGCTCAGTAT	28	3	yes
GATCCATAAGTTTGCCCAGT	112	13	yes
GATCCAGTTTTGGGAAAGGA	28	5	yes
GATCCAGTTTCTGACTCGGG	50	6	yes
GATCCAGTTGTTTGAAGATT	17	1	yes
GATCCAGTTGTGCAGTAGAG	19	4	yes
GATCCAGTTGTCAAGACAAA	30	6	yes
GATCCAGTTGGAGAGATTTG	102	14	yes
GATCCAGTTCTGCTCAACTA	54	4	yes
GATCCAGTTCTACGAGCGGC	118	7	yes
GATCCAGTTCTAAAACTTGT	76	0	yes
GATCCAGTTACCAGAAGATG	300	72	yes
GATCCAGTGTGTTGCTGGCA	240	0	yes
GATCCAGTGTGCTGGTCTTT	13	6	yes
GATCCAGTGGCAGCCTCAGC	247	33	yes
GATCCAGTGCCTCATTGTTG	157	19	yes
GATCAGGAGAAGGAATTCCT	9	7	yes
GATCAGGAACCCCCTCCAGA	6	5	yes
GATCTCAACTGACTCCTCTA	4	5	yes
GATCTATCAGTACGGCAACT	25	4	yes
GATCCAGTGAGAGCCAGACA	140	8	yes
GATCCAGTGACGTCAGACGC	64	31	yes
GATCCAGTCCTGGAGGACAG	1000	14	yes
GATCCAGTCCATTCAGCAGT	204	17	yes
GATCCAGTCAGGACATATGA	40	13	yes
GATCCAGTCAGCCCCTGGGG	412	156	yes
GATCCAGTATCTGAAAGACC	144	16	yes
GATCCAGTACTTGGTTTGTG	10	5	yes
GATCCAGTACTACCAGAATG	16	9	yes
GATCCAGGTTCAGTAAATTA	3	3	yes
GATCCAGGTTCACCACCGGG	1	1	yes
GATCCAGGTTCAATTTCCAG	118	5	yes
GATCCAGGTGTGCTGAGTGG	173	10	yes
GATCCAGGTCCGTGAACCCC	175	6	yes
GATCCAGGGTGTGCAGTGGG	522	24	yes
GATCCAGGGTGCCCCTCCAA	68	0	yes
GATCCAGGGTCCTCTGCCTG	135	2	yes
GATCCAGGGGGGACACCTGC	105	19	yes
GATCCAGGGCTCAGGAGCAC	6	6	yes
GATCCAGGGCGATGTTGGGG	106	13	yes
GATCAAAGTATGACCACTAG	28	23	yes
GATCCAGGGCCTGTGAATCA	203	2	yes
GATCCAGGGCCTGGTGGAGG	476	8	yes
GATCCAGGGCCTCTGCGCCT	33	4	yes
GATCCAGGGCCACTTTGTCT	39	1	yes
GATCAGCGGCCGAATGTCCC	93	16	yes
GATCAGCGCAGGCCCCAGCC	25	6	yes
GATCTGGCACTGCTTTAGCC	2	2	yes
GATCCACCAGGCTCAACAGG	21	17	yes
GATCCACCAGGATTGAAGGA	3	2	yes
GATCAGCCTGTCCTATTCCC	2	3	yes
GATCCACCACAGCAGGCAGG	12	4	yes
GATCAGCCTCTTCCTTTTGT	27	3	yes
GATCAGCCTCAGTCTTCAGG	7	7	yes
GATCAGCCGGGGCTTTGAGG	152	5	yes
GATCCACAGTGCAAAGAAAA	3	3	yes
GATCTTTGGAAGGAGAAGAT	9	7	yes
GATCTTTGCCTCTCTGTAGA	31	6	yes
GATCCAGGGAATCAAGGAAT	17	1	yes
GATCCAGGGAAGCCTGTGCT	5	0	yes
GATCCAGGCTCTGATGTTTC	16	2	yes
GATCCAGGCTCGGGAGCTAA	4	2	yes
GATCCAGGCTCACAGTGTGA	7	2	yes
GATCCAGGCTAAAATCCCCG	16	2	yes
GATCCAGGCGGCCCTGCCAG	15	15	yes
GATCCAGGCGGCCAAGAACT	377	11	yes
GATCCAGGCGGAGGATGACG	6	3	yes
GATCCAGGCCTCCCTTCTTG	51	7	yes
GATCCAGGCCTACTTCGCGT	54	3	yes
GATCCAGGCAGCTGTGTACA	28	8	yes
GATCCAGGCAGAGCTCTTCA	16	7	yes
GATCCAGGAGTTCAAAGAGG	960	75	yes
GATCCAGGAGGGGTTTGCTC	16	2	yes
GATCCAGGACTTCTTCATCC	40	11	yes
GATCCAGGACCTGGAAGTAT	8	3	yes
GATCCAGGACCATCCTCTCA	1	1	yes
GATCCAGGAAGTTTTGTTGT	41	4	yes
GATCCAGGAACTACTCCACA	22	2	yes
GATCCAGGAAAGCAGCCTGT	364	38	yes
GATCCAGCTGGGCGAGGATG	208	15	yes
GATCCAGCTCCTAAACTGTT	7	9	yes
GATCCAGCTCAGGCGGTGTC	29	3	yes
GATCCAGCGCTCTCGGGACT	50	6	yes
GATCCAGCGAGAAAGAAGAA	194	22	yes
GATCCCCGCAAAGTGAGCAA	1	1	yes
GATCCACAAGGTGGCAGTGT	6	3	yes
GATCAGCAGTCCGCGAGCTT	22	4	yes
GATCAGCAGTAGTGTTAACT	12	6	yes
GATCGATTCCGATTTGTGCT	9	1	yes
GATCCAGCCTGACCTGCACA	185	5	yes
GATCCAGCCAGTCTTCAAAG	19	8	yes
GATCCAGCCAGTCTCTCATT	12	1	yes
GATCCAGCAGTTAAAGCAGT	92	12	yes
GATCCAGCAGAGAGGGCAGG	119	18	yes
GATCCAGCAGAAATGTGGCT	2	2	yes
GATCCAGCACCGTGTGTACC	63	1	yes
GATCCAGCAAACTTGGTTGG	118	27	yes
GATCCAGCAAAAGTATCTGA	1	1	yes
GATCCAGCAAAACTACTGCT	44	2	yes
GATCCAGATGCCGGCTTTCA	9	2	yes
GATCCAGATGATGGTTCTTT	97	0	yes
GATCCAGATACAACGCTCAC	46	6	yes
GATCCAGAGTGGCACAGGGT	256	7	yes
GATCCAGAGTGGAACTGTCC	138	11	yes
GATCCAGAGGTGTTAGCTAC	1	1	yes
GATCCAGAGGTAACTGTGGA	6	2	yes
GATCCAGAGGGGGTGCCTTT	3	2	yes
GATCAGCAGATGCAAAAGAT	12	1	yes
GATCAGAAGCCGCTTGCAGA	6	5	yes
GATCCAATCCTCCTGCCTTC	22	0	yes
GATCAGCAACTCCTGCTTCA	125	32	yes
GATCCAAGTTTATCCCACAG	1	1	yes
GATCCAGAGCTGGGCTCAGG	9	2	yes
GATCCAGAGCTGGAATAGCA	4	4	yes
GATCCAGAGCGTGTTAACAG	12	4	yes
GATCCAGAGAGATGGGTCAG	15	3	yes
GATCCAGAGAGACTTGGTTG	27	11	yes
GATCCAGAGAACTCAGCTGT	16	4	yes
GATCCAGAGAAAGCAAAGGC	29	2	yes
GATCCAGACTTTCTTGAAGA	4	5	yes
GATCCAGACTTGCCTTATAA	61	3	yes
GATCCAGACGCCAAGGCTGC	47	7	yes
GATCCAGACGAATCTTGTCA	52	6	yes
GATCCAGACCTGCCACAGAC	2	2	yes
GATCCAGACCCGGGAAGGGA	508	22	yes
GATCCAGAATTGCTTTCCCA	240	11	yes
GATCCAGAAGCAGTGGAATC	566	4	yes
GATCCAGAAGAACCTACCAC	5	4	yes
GATCCAGAACCTCTCAGCCA	74	4	yes
GATCCAGAACATTCTAGAAA	12	1	yes
GATCCAGAACAGTACAGCGT	306	41	yes
GATCCAGAACAGCGACGATG	25	9	yes
GATCCAGAACACATTAACCT	76	6	yes
GATCCAGAACAACACTGTTT	2	2	yes
GATCCAGAAAGAACGATTTG	75	2	yes
GATCCAGAAAGAAAATGTCA	8	1	yes
GATCGCCCCAGTTGGCTCTC	1	1	yes
GATCCACTTGGGCTCTGTCA	195	14	yes
GATCCTCTTTGGTGTTTTGG	2	2	yes
GATCAAGGCCCTTCAAGAAA	17	8	yes
GATCAAGTTTGCCGTCCATG	34	6	yes
GATCCAAACCCTGCCAGTGA	28	38	yes
GATCGAGACCGGGAGAGGCG	1	1	yes
GATCTTGCTGTTGTGGATGT	38	15	yes
GATCAGTAGTAGAGGCCTTG	1	1	yes
GATCAAGCTGCTGGACACAC	4	3	yes
GATCAGATGCGGTAGAAAGC	1	1	yes
GATCAACACTACGGTGCCAG	89	2	yes
GATCAAATTCCCACTGCCCG	29	39	yes
GATCTTGACCTTCTCTTTGG	20	5	yes
GATCCGTGCTTCCTGCACCC	32	1	yes
GATCACATGGCCTCCTCCAT	7	9	yes
GATCTGCTGGATGTCTGCCG	4	0	yes
GATCAAACATCTGTCTGTCT	6	8	yes
GATCCTGTTTGTGCTGCAGC	3	2	yes
GATCCCACCCCTGTAGTCTT	21	0	yes
GATCATCATTGGCTGCTTTG	5	4	yes
GATCTTTCTGAAAGGCTTTT	8	6	yes
GATCCATACCCTCCCTAGGA	1	1	yes
GATCCCAACCACTATGGCAG	1	1	yes
GATCGACTTGGATTACAGAA	37	2	yes
GATCCTCACATGGAAAGTAC	23	19	yes
GATCCTCAACGAGGATGGCA	270	6	yes
GATCCTATGTTGCTGGAGCT	146	20	yes
GATCTTACTTGGGAAAGTTG	3	2	yes
GATCCTAGTGGGTCTACCAG	565	51	yes
GATCAACAAAACTGACCCCC	3	0	yes
GATCCTAGTGCTGCTCTGGC	127	26	yes
GATCTGTTGCTGTTAGTGGC	11	4	yes
GATCTGTCCCAGTCATTGCT	4	3	yes
GATCCATTCAAGCTTGCAGA	2	2	yes
GATCCTGCACAATTTAACTC	3	2	yes
GATCTCTCATACAGACACAC	3	2	yes
GATCCTACCGCCTTTAACAA	170	25	yes
GATCCTACAGAAGGCCCACT	271	3	yes
GATCTGGCTGCGGTCCGTGA	15	12	yes
GATCTGGAGGCCGCTGTGAG	101	9	yes
GATCTGGCGCACGGAGAGAA	2	2	yes
GATCCTCAACCAAGTGGAGC	7	0	yes
GATCTGGAGCTCCTGGGATG	4	4	yes
GATCTGGAGCCTCCACGATG	128	23	yes
GATCTGCTTCTACAGGGGGT	2	2	yes
GATCTGGAGCCCACAGACCA	16	12	yes
GATCTGTGCTCCGGGGTGAT	51	1	yes
GATCTGGAGAAGCGACGTAT	10	3	yes
GATCTGGACTTGTTTTCTGG	1	1	yes
GATCTGGACTTCTGAATCTG	26	1	yes
GATCTGGACTGTAGGGAGAG	22	6	yes
GATCTGGACCTCACCTCTGA	276	9	yes
GATCCACTTGTGCATGTAGT	9	3	yes
GATCTGGACAGAATCCAGGC	28	5	yes
GATCTGGAAGTTGGCAGATG	69	21	yes
GATCGTGACTGGGTGCCCAT	2	2	yes
GATCAACACATTCTGGTTCC	4	3	yes
GATCAACAAATCTCCTAGGC	20069	2714	yes
GATCAACAAAACTGTACCTG	4	3	yes
GATCAAATTGGTCTTCACCT	3	2	yes
GATCAAATGTGCCATAGCAC	126	6	yes
GATCCGTGTCCCTGCGTGCA	375	4	yes
GATCCTCATGGTCAGAACTG	8	3	yes
GATCCGTGGGCCTGGCCTCC	227	11	yes
GATCCGTGGACAGTCTTCAC	21	21	yes
GATCAAATGAGAACACTGCT	50	40	yes
GATCAAATCCAAACTGAGGG	17	3	yes
GATCTGGAAGAGACTTTGGC	60	48	yes
GATCTGGAACCTGGTGTGCG	195	198	yes
GATCTGGAACAGTTTTTGGC	16	2	yes
GATCTGGAAAGCTCTGGGGA	64	28	yes
GATCCGGGTGTTGTGCCTAA	65	8	yes
GATCTGGAAAACGCTGGAGA	28	5	yes
GATCTGCTTGCCAGGCCACT	108	9	yes
GATCAAGAATTTGGTGTGGA	133	4	yes
GATCTGCTTCGCCGGGACGT	20	20	yes
GATCTGCTTCCAGGTCCTCA	87	8	yes
GATCTGCTGTCCAGAGCAAG	492	33	yes
GATCTGCTGCTGGTGCTTGC	8	6	yes
GATCCTAGAATGTTTGTAAG	12	3	yes
GATCCCCTTTCTCTATGTCT	223	161	yes
GATCAAATCACTGGCAGACA	126	6	yes
GATCAAAGTGCCAACAGCGG	7	5	yes
GATCAAAGTGAGGGAAGCGG	5	4	yes
GATCAAAGTCTCCATAGTTG	213	16	yes
GATCCGGGCAGCCCAGGAAA	536	60	yes
GATCAAAGGGGGCAAAGTCT	20	2	yes
GATCAAAGGGGCCATTTCTC	9	7	yes
GATCAAAGGCCTGCATCACT	6	6	yes
GATCCATCTGCACAGTCTGT	1	1	yes
GATCAAAGGAGACTGGCAGC	22	17	yes
GATCCGGCCCTACTGTGTGT	116	5	yes
GATCAAAGGAAAGGGGAGGG	939	88	yes
GATCAAAGCTGGCAAGGTAC	622	45	yes
GATCAAAGCCCGGAAAGGCA	1880	74	yes
GATCAAAGCCACGGGGTCAG	147	6	yes
GATCAAAGCCAAGTATCCTG	74	6	yes
GATCAAAGCAGCTGCCTTAC	20	16	yes
GATCAAAGCACGCCTGCATG	10	8	yes
GATCCGCTGTACTCTCCTCC	116	12	yes
GATCTGCTGCAGGACCTGGG	27	9	yes
GATCCGCGAATGCTCGGAGG	924	170	yes
GATCTGCTGAAGGAGAAAGC	156	14	yes
GATCTGCTCTTCAATGTTGT	3	3	yes
GATCTGCTCTCGGGCCTCGC	71	12	yes
GATCCGCAGTGGCATGTTCT	135	41	yes
GATCCGCAGCGCCTCTTCTT	151	18	yes
GATCCTAACTTACTCCATTT	9	4	yes
GATCCTAAAGCTGTGTCCCT	40	6	yes
GATCCGTTGCTGACCTTGCG	94	17	yes
GATCCCAGCCCACAGGATGT	9	0	yes
GATCAAAGAGTTCAGCAAGA	65	10	yes
GATCAAAGAGGCTGCTGTCT	13	10	yes
GATCAAACTGAGTCTGAAGG	355	28	yes
GATCAAACTAATCAGGCATC	1	1	yes
GATCAAACGAGTTGTGTGTC	7	5	yes
GATCAAACCAGCCTGTTTTT	13	0	yes
GATCAAACAGTAAAGGTGTG	44	2	yes
GATCAAACAGCAGCCAAGTG	10	8	yes
GATCCGAATGGGTCGACTGA	71	5	yes
GATCAAAATGTGGTGCCAGA	128	25	yes
GATCCCTTGGCATAGGGCCC	365	1	yes
GATCCGTGTGTGAACTAAAA	4	5	yes
GATCTGCCTTAAGGACCTGG	5	4	yes
GATCCCTGTGCCTAGCTGCT	22	18	yes
GATCTAATAGTGGCAGTGAC	2	2	yes
GATCAACTCAGATTTGGCTC	9	7	yes
GATCTGCCTGAAACCAGGGG	31	15	yes
GATCTGCCTCAGTCCACAAG	256	44	yes
GATCCGTCACAGAGAGCAGG	18	5	yes
GATCTGCCGAAGCGGGCTTG	6	5	yes
GATCTGCCCTGTATTGTTAA	7	5	yes
GATCCGGGTTCCTGACCCCA	8	8	yes
GATCTGCCCCTGACCCTCCA	87	23	yes
GATCCAGAGGCTGGGCCTCT	8	8	yes
GATCACGGCAGTGTGCAATT	8	8	yes
GATCAAAATGAGGCAGAGGA	226	7	yes
GATCAAAATCGCAGTTACTG	39	31	yes
GATCAAAATATGCTGCAGAC	17	17	yes
GATCCCTGGTGGGAAGGCGG	6	6	yes
GATCAAAACTCTTAGTGATT	1	1	yes
GATCAAAACTCAAGAAAAGG	25	11	yes
GATCCCTGGTCCTTAGGTGG	141	9	yes
GATCAAAACCTTCTCTGAGG	9	5	yes
GATCAAAACCTGTGACGGAG	22	17	yes
GATCGTTGGAGTCTTCTTAC	12	9	yes
GATCAAAACACGATGTCCAA	3	2	yes
GATCGTGTTTCCAGCTGGAA	7	5	yes
GATCCGGGGCCTCTGGAAAG	52	5	yes
GATCCGGGCGTCGGCAGAGC	4	4	yes
GATCTGCCAGGAACATGAGA	190	7	yes
GATCTGCCAGCTTGGGAACT	31	15	yes
GATCTGCCAGCCGTACATCC	155	24	yes
GATCCCTGATTGCCTCCATG	1567	204	yes
GATCCCTGATGCAAAAGAGA	136	4	yes
GATCGGGTCCGGAGTCGGGT	3	2	yes
GATCTGCATTCGCTCACTGG	3	2	yes
GATCTGCAGTTGCTCCAGCA	6	5	yes
GATCTGCAGTTCCTGGAAGG	17	13	yes
GATCCCAGCAGACCTATCAC	1	1	yes
GATCTGCAGGTGCCTGGGAA	137	9	yes
GATCCTTTCTACTTGAGGGA	64	4	yes
GATCGAACCCAGGATTATTC	1	1	yes
GATCATAGCCAAAGAATTTG	46	7	yes
GATCCCTCTGCAAACCAAAC	61	9	yes
GATCCCTCTCCCAGCTCTTC	105	29	yes
GATCCCACAGGAAGTCAAGA	14	5	yes
GATCTGCAGGAGGATGTTGA	12	9	yes
GATCTGCAGGAGGATGGTAA	17	13	yes
GATCTGCAGGAGGATGCCTG	965	32	yes
GATCTGCAGGAGCCGTTTGC	12	9	yes
GATCTGCACAGAGATGCTTC	19	15	yes
GATCTGCACAACTGTGGCCC	46	37	yes
GATCCGCCGCAACTCCACAG	7	5	yes
GATCACTACTGGCACTTTTT	13	5	yes
GATCACCACTCAGGTGACTA	322	23	yes
GATCCCTCAGTGTAGCATAG	56	14	yes
GATCCCTCAGCTTTCTCCAA	88	64	yes
GATCCCTATTAAAGGCCTGC	6	5	yes
GATCTGCAAACGGGAAGGAG	6	5	yes
GATCTGATTTTGACCAAGAT	27	7	yes
GATCCCGTCAACTTCAAGCT	1723	263	yes
GATCCCGGGGGCTCCAGGAA	94	21	yes
GATCCGCAGACGTCACTCTG	218	31	yes
GATCCCGGGGCAGTCCAGCC	126	16	yes
GATCCGAGTTGGGGAGCCTG	5	2	yes
GATCAAATTCCCACTGCCCC	1200	83	yes
GATCTGATTCCCGCAGGTTC	92	0	yes
GATCTGATGCTTCTTCTGTG	4	0	yes
GATCCCGGGCAATGCTTTCA	24	7	yes
GATCTTCTGTTCCCGCTGCT	6	2	yes
GATCGGCCCCAACGATGGCT	13	7	yes
GATCCCCTTGGGATTAAAGG	31	2	yes
GATCTGTGCATGTTATTTTT	3	2	yes
GATCCTTGGATGAGAAGCTC	117	16	yes
GATCTGAGTTCCCGAAGCAA	8	6	yes
GATCCCTTTCCTTTAGCAGT	6	6	yes
GATCTGAGTCCCCTGCTGGG	111	22	yes
GATCTGTCAAGGAGAGGGTT	3	2	yes
GATCCCCTGAGAAGCTGTAT	7	5	yes
GATCATAAAGTGAGACTCCT	4	3	yes
GATCCCCTCCCCCAGCTAAA	7	5	yes
GATCCCCTAAAACGAGTTGC	6	1	yes
GATCCCCGGCGTCTGTTTGA	3350	598	yes
GATCACCGTGAGTCCTAGAC	2	2	yes
GATCCCCCAGCCAGGCCAAA	59	11	yes
GATCCCCATTGGAGCAAAGC	32	26	yes
GATCTGAGCCCCCTGAGGTT	209	8	yes
GATCTGAGCACGTCCCGCTG	17	13	yes
GATCCCTGGAGCCACCAGCT	14	11	yes
GATCTGAGATGAGCAGTGAC	3	2	yes
GATCCCTGCTTTCATGGAAG	79	18	yes
GATCTGAGGGTGAGTGCCCT	8	2	yes
GATCTGAGAAGCTGTGATGG	20	3	yes
GATCCTAACCGTGTTACAGA	7	2	yes
GATCTGAGAAACGGGGAAGC	107	20	yes
GATCAGCTGAGCTCCTGTTT	5	2	yes
GATCAGCTCTGGAACATGTA	5	7	yes
GATCCCAAGGAATGGGCAGC	57	6	yes
GATCTGACTCCACTGCCCAG	54	12	yes
GATCTGACGCCGAGGAGGTA	220	8	yes
GATCTGACCTTGAAGAAGCT	3	2	yes
GATCTGACCTGTTAACCCAT	2	2	yes
GATCTGACCTGGGTCCTGAC	195	7	yes
GATCTGACCCTAGATTTCTC	8	4	yes
GATCCCTATGGACACTGACA	529	22	yes
GATCATAAGGAGGCAGGGGC	4	1	yes
GATCAGACTGGTCTTGTGAC	2	2	yes
GATCAGCACCTGCATCCTGC	19	1	yes
GATCTATTTTTGCACTGGAA	70	22	yes
GATCCAGATGGGCTCTGTGG	35	5	yes
GATCCACAGAATGCTGACTT	13	4	yes
GATCGAGGTAGAGAGAAGCC	37	6	yes
GATCCAAGGCACTTATGTAA	22	4	yes
GATCCAAGATGGAGGAGGAG	10	1	yes
GATCTGCTGCGTTGTTTGCC	9	0	yes
GATCCACTTGAAACCGGGAG	28	10	yes
GATCCACTTCAGAAGCAGCC	109	23	yes
GATCCACTGTTGTCCAGAGG	84	20	yes
GATCCACTGTGTGTCTGGTA	16	7	yes
GATCCACTGTCTTCCTAGAG	98	3	yes
GATCCACTGGTGGAGACAGA	7	2	yes
GATCCACTGGGCCAAGGAGC	81	11	yes
GATCCACTGGCTGGATATAG	104	5	yes
GATCCACTGCTGGAAGTACC	639	1	yes
GATCCACTCTTTTCATACCC	17	1	yes
GATCCACTCGGGGGCTGTGA	54	3	yes
GATCCACTCCTGCAGAGCAC	86	7	yes
GATCCACTCCAGGCTGCGAG	328	6	yes
GATCCACTCAGACGAACAGT	25	2	yes
GATCCACTACTACCAGGGAC	1	1	yes
GATCCACTAATGCAGCTGGT	262	36	yes
GATCCACGTCTCGTCGTCAG	297	15	yes
GATCCACGGGGCACCCGCAC	18	7	yes
GATCCACGGGCTGGAATCTG	13	2	yes
GATCCACGGACACCAAGTTA	365	1	yes
GATCCACGACTACTTGGACA	9	4	yes
GATCCACCTGTGGTGCTAGT	166	3	yes
GATCCAACTGGCCTTGTCAG	3	2	yes
GATCCAACTGCCTTTGCCTC	149	68	yes
GATCAGAGCTACACAATGGC	66	18	yes
GATCAGAGCCGCCTGACTTC	160	65	yes
GATCTGCTCTGTAGGTTTAC	3	1	yes
GATCAGAGCATAGCCTATGT	32	5	yes
GATCAGAGCAGGAAGTTTTC	55	22	yes
GATCAGAGCAATGCTGGAGC	52	31	yes
GATCCCTTTGCACAGCCAGA	9	1	yes
GATCATGTTCCGCCAGCGGT	59	4	yes
GATCCACCTGCTGCTGCCTC	28	23	yes
GATCCACCTGCCTGTGCCTC	63	5	yes
GATCCACCTACTTTTTCAGC	26	9	yes
GATCCACCCTGAAAGTGTCT	44	8	yes
GATCCACCCCTATCTGAGAA	4	4	yes
GATCCACCCACCCTGGGCAT	26	1	yes
GATCCACCATCTGTAATGTC	11	9	yes
GATCCACCAGTGCTTCTGCT	489	45	yes
GATCCACCAGTCCTTGAAGC	140	31	yes
GATCCACCAGGATGTTTGAT	16	4	yes
GATCCACCACATGTGCCAAA	593	56	yes
GATCCACATTTGCTGGTTTG	22	2	yes
GATCCACATTGCTGTCCTAT	33	3	yes
GATCCACATTACCATCAAGC	13	2	yes
GATCTGAAAGTAGACTCTGT	18	24	yes
GATCCACATGTGCTCGCAAA	61	14	yes
GATCCACATGTACCATCAAC	39	8	yes
GATCCACATGCGTGTAGCAG	451	26	yes
GATCCACATGAGGAGATACT	179	31	yes
GATCCACATCTCCCTCCCCT	61	12	yes
GATCAGACAGTTAAACTGTG	28	23	yes
GATCTGCCTCCGGAACTTGT	4	1	yes
GATCCACAGTCCCTATGTGT	26	8	yes
GATCCACAGGGTACCTCCCT	167	7	yes
GATCCACAGGCAGTTGTGCC	61	7	yes
GATCCACAGGAGGGTTCCAA	25	0	yes
GATCCACAGCAAATTGAACA	2	0	yes
GATCCACAGATTCTGCCTGT	123	7	yes
GATCCACAGACAGCAGGAGG	46	9	yes
GATCCACAGAAGCACTGCAG	29	4	yes
GATCCACAGAAGACCTGATT	7	5	yes
GATCCACACTTGGATTCTCT	10	8	yes
GATCCACACTTCTGAAGACT	1	1	yes
GATCCACACTGCCACTAAAA	8	1	yes
GATCCACACGGAAGGGGAAA	3	3	yes
GATCCACACCTGATGGCTCC	16	4	yes
GATCCACACCTGAAATGCTA	36	2	yes
GATCCACACCCTAACTCCCA	71	1	yes
GATCCACACACGACTCTCCA	1397	49	yes
GATCCACATCTTCAAATGCC	1	1	yes
GATCCACAAGTCTTAGCTGT	563	18	yes
GATCCACAAGGCCCTCATCA	6	6	yes
GATCCACAAGCGACTCATTG	1268	13	yes
GATCCACAAGCAATCCAGGA	4	2	yes
GATCCACAACCTGATTCCCG	497	33	yes
GATCCACAACAAGTCACTTT	4	2	yes
GATCCACAAAGGCAGAGCCC	20	2	yes
GATCAGAAGGCTGAGCACTG	14	11	yes
GATCAGAACAGAACAGGTGA	42	4	yes
GATCTGCCATCCCCTTCAGA	10	13	yes
GATCTGCCACTGAAGTAGAC	12	9	yes
GATCATTGCCAAGCCAGGCT	19	6	yes
GATCCAATGCTCTATCAAAC	96	1	yes
GATCCAATGCCCTCTTCTGT	65	86	yes
GATCCAGAGGCAGGTGCAGA	1016	25	yes
GATCCAATCTTTGTCTTAGG	83	5	yes
GATCCAATCGACTGGGTTTC	252	46	yes
GATCCAATCCCTGTGCAGCA	74	10	yes
GATCCAATCAGGGCAAGAAC	90	18	yes
GATCCAATACTGTCTGGAAA	4	3	yes
GATCCAAGTTGTACATGAAT	8	1	yes
GATCCAAGTGTTTAACCATA	33	2	yes
GATCCAAGTGCCCTTCTGCT	36	3	yes
GATCCAAGTCCAGGAACCCT	528	44	yes
GATCCCGGTCTTCTTCGCCT	3	2	yes
GATCCAAGTCATGATTTGAA	49	5	yes
GATCCAAGTCACCCCCCGAA	72	39	yes
GATCCAAGTATTGGCACCCA	10	1	yes
GATCCAAGTACTACCATAGG	3	3	yes
GATCCAAGTACACCTAAGGG	335	0	yes
GATCCAAGGTCAAGGCAGAG	500	1	yes
GATCCAAGGCCTCAGGTCAC	262	38	yes
GATCCAAGGAGTGGTACCCA	94	3	yes
GATCCAAGCTTTGGATGATG	2	2	yes
GATCCAAGCTCTGGGAAGCA	6	1	yes
GATCTGCCAAACGCTATGGC	5	4	yes
GATCATGTGCCTACCCTGAC	7	0	yes
GATCCAAGCGTGAGCCAGTC	263	8	yes
GATCCAAGCAGGTGCTTCCT	7	3	yes
GATCCAAGCAGGCTTGAATA	2	2	yes
GATCCAAGCAGGCCCCTTAT	111	18	yes
GATCCAAGAGGAGGAGCACA	28	1	yes
GATCCAAGAGACCACCTTTG	21	5	yes
GATCCAAGACCAGGGTGGCT	375	20	yes
GATCCAAGACACTTTGCAAA	7	5	yes
GATCCAAGAAGTCAGTCGGC	63	13	yes
GATCCAAGAAGAAAAGCAAG	42	8	yes
GATCCAACGTGTTAGCCTTG	82	61	yes
GATCCAACGTGGTCTTTAAG	19	19	yes
GATCCAACGAGTAGGAGTGT	38	6	yes
GATCCAACGAAAGGCTGGTT	3	0	yes
GATCCAACGAAAAACACTTG	12	4	yes
GATCCAACCCCACCTCAAGT	44	17	yes
GATCCAACCCAATTCAGTAT	5	2	yes
GATCCAACCAACCTGAAGAA	32	6	yes
GATCCAACATGGAAGGTGTA	7	7	yes
GATCCAACAAAGGTTGTGAG	1873	5	yes
GATCCAACAAAACACGCAGG	44	14	yes
GATCACTTCCTTCTGGAATC	54	3	yes
GATCACTGTGGCGTCTTGAA	2	2	yes
GATCACTGTCGTGTTTGGTA	19	1	yes
GATCCTTCTTTGTCTTCAGA	2	2	yes
GATCACTGGGGTCAATGGCA	23	8	yes
GATCACTGGCCCCGATGGTG	15	3	yes
GATCACTGGAGGCCAGAGAA	11	9	yes
GATCACTGGAGCAGGCCTCC	14	0	yes
GATCCAATACTGTCAATCCA	13	2	yes
GATCATGCTTACCCTGGACT	13	13	yes
GATCATGCTCTGGCTGAGTT	109	3	yes
GATCCAACTACAAGCAAGGA	13	2	yes
GATCATTCCTTGCAACAGGA	3	2	yes
GATCCAAATCTTCCAGGCCC	2	2	yes
GATCCAAATATTGTCATAGC	52	3	yes
GATCCAAAGTTGGCCAGCAT	181	16	yes
GATCCAAAGTCACACCTCCA	140	24	yes
GATCCAAAGGCAGCAAGAAG	52	16	yes
GATCCAAAGCTTTCCCATTT	76	8	yes
GATCCAAAGCTGCTTAAATC	106	11	yes
GATCCAAAGCTCAGGAGACA	96	19	yes
GATCCAAAGCCCCAGTAGAA	30	1	yes
GATCCAAAGCAGTGCTCCCA	581	13	yes
GATCCAAAGAGAGAAAGAGC	118	1	yes
GATCCAAAGACTCAGGTGTT	60	4	yes
GATCCAAAGACACAGTCTGT	189	17	yes
GATCCAAAGACAAGAAGGAA	8	1	yes
GATCCAAAGAAGACAAAATG	28	4	yes
GATCCAAACTTAACGAGCCC	87	23	yes
GATCCAAACCTTCCTGACAT	5	2	yes
GATCCAAACCCCAGTGTACC	373	5	yes
GATCCAAACCCAGAGACCAA	21	4	yes
GATCCAAACAAGAAGACTGA	2	0	yes
GATCCAAACAAAGACACAAG	114	34	yes
GATCCAAAATGTGGCATTTT	13	2	yes
GATCCAAAAGGAGACTTCTA	190	20	yes
GATCACTGCAGCCCCAAACT	23	12	yes
GATCCCGCCAAAAGAATTAA	25	34	yes
GATCATGACTCTTTGAGATT	10	5	yes
GATCCTGCACGCGGGCTTTA	14	11	yes
GATCAGTTACCAGTTACCCT	5	0	yes
GATCACTCTCTCACACCACC	9	3	yes
GATCTTCTTGCTGGTCTTGC	30	10	yes
GATCCAAAAGCCTGCTCGGT	38	3	yes
GATCCAAAAGCAGCGTTTGC	89	23	yes
GATCCAAAAGAGCCTGATGG	26	1	yes
GATCCAAAACAGCAAATAGG	185	18	yes
GATCCAAAAATGGGGATGTT	18	5	yes
GATCCAAAAATGCTGGACTT	32	12	yes
GATCCAAAAATACAGCCTGC	10	2	yes
GATCAGAGAGCAGTCAGAGG	9	7	yes
GATCATTTTGTCGAGTGAGT	100	2	yes
GATCATTTTCTGCCGTACCA	12	1	yes
GATCATTTTCCCAACGTTAC	51	5	yes
GATCATTTTCAAGTTACCCA	1	1	yes
GATCACTCCTTGCTTTGCCA	64	22	yes
GATCATCTGTCCAGACGGCA	7	7	yes
GATCATCTGCTACCCAGCAG	3	3	yes
GATCACTCAGGGTGGGCAGT	106	16	yes
GATCACTCAGGACGGTACCC	70	46	yes
GATCACTCACGAGAACATCT	44	10	yes
GATCATCGATGTGGACCTCG	7	0	yes
GATCAGCCAGAGTCTCCACA	17	10	yes
GATCACTAAAGGGTTTCCTG	13	7	yes
GATCACGGTCACTTTCAACA	184	30	yes
GATCATTTGTCCAGGAGTGT	1	1	yes
GATCATTTGCGTTTGGAGGT	50	6	yes
GATCATTTGATTCCCCTCCC	35	3	yes
GATCATTTCTTTCTGGCCTG	126	9	yes
GATCATTTCTCGCTCAGATT	65	6	yes
GATCATTTCACTGGTGGCTG	87	6	yes
GATCATTTAACTGGCATTTT	6	6	yes
GATCACGGCATCGAAAGGAA	5	4	yes
GATCACTTTGCTCGCAAGCA	38	9	yes
GATCACGATGCCACACCCTG	8	6	yes
GATCACGATAAGCTCATCAG	10	6	yes
GATCCTAACCAGGCTAAGCT	1	1	yes
GATCCAGTTCTTCCAGTATC	11	0	yes
GATCAATGGGACTTCCGGGC	27	1	yes
GATCCTACCTGAGTGGCAGG	13	17	yes
GATCCGGGTCAGCTAACCCG	75	2	yes
GATCATTGTGGCCCCGCCCC	203	24	yes
GATCATTGTGAACACCTCGT	66	1	yes
GATCATTGGTTGAATCGGTT	41	8	yes
GATCATTGGAGAGGGGTCTG	64	5	yes
GATCATTGCCACGGAAAACA	42	15	yes
GATCATTGCATTTGTTGTCT	7	0	yes
GATCATTGCAGTCTGAGGCT	6	1	yes
GATCATTGATGTTGTCTACA	1	1	yes
GATCATTGAGAGCAAGCGAG	89	10	yes
GATCATATTGCCCTGCATCT	68	11	yes
GATCACCGCCTGCACCGCAG	247	23	yes
GATCATACCCGTCCCTCTCT	28	1	yes
GATCACCCTGGGCCTGGTCA	63	1	yes
GATCACCCTCAGCTGAAGAC	22	3	yes
GATCATTCTCCAAAGGCAAC	178	13	yes
GATCATTCAGGACAAAGGAG	75	52	yes
GATCATTAGGGGTTTGGTCT	69	11	yes
GATCATTAGCCCACATACCC	29	2	yes
GATCATTAGCATGCCAGGAA	79	0	yes
GATCATTACTGTGTGAGTGT	8	5	yes
GATCATTACTGCAGTCTTGG	2	3	yes
GATCATTACACGGAGAACAC	26	1	yes
GATCGCTCGAACTTAACCAG	9	7	yes
GATCCAGCAGTACCTGAAGG	33	7	yes
GATCCCGAAACTCAAGCTAC	18	2	yes
GATCCTTCTGAATGCCTGCT	160	5	yes
GATCAAGGCTCCCGGTTTGC	10	10	yes
GATCGAGGTGTCTCCCATTA	5	4	yes
GATCGACTCTCCCTCACCGG	4	3	yes
GATCTGTGGATGGGAAGGCA	7	9	yes
GATCTGGATTTTAGGTGGTA	34	27	yes
GATCCTGAGGGAGCAGGGCC	10	1	yes
GATCCCGGCCCGGCGGCGGG	2	1	yes
GATCTGTTTACAAGGTTTGT	3	2	yes
GATCCTATGTTTTGGCCATT	7	7	yes
GATCCGTATAACTTCACTCT	2	2	yes
GATCCTCACGTCCTTTGTGG	55	7	yes
GATCCTAACCCTGAACCCCC	7	9	yes
GATCCCCAATATGCTGTTGA	125	0	yes
GATCTGGGGGGTCCTCACCT	23	24	yes
GATCTGGAAGGGCCTAAATG	5	4	yes
GATCCCAATGGGGAAAAACC	3	2	yes
GATCCCAATCCCTCCAGAGC	13	4	yes
GATCCCGGATTTGCTCCTGT	39	6	yes
GATCCCAGTGGATGAGCATG	72	9	yes
GATCTGACCCACCACGGAGA	17	13	yes
GATCTGACAGGACCGCAGAG	18	14	yes
GATCCCAGCAGCAGAGCATG	2	2	yes
GATCCCGTTCCTATAGTCCA	18	2	yes
GATCTGACACTCTTCTGGAG	7	5	yes
GATCCCAGCACTTGGGAGGG	29	39	yes
GATCCCAGCACCGAGGGGAA	221	44	yes
GATCCCCAAGCATCATGAAT	3	1	yes
GATCTGACAAAGAAAGTTTA	2	2	yes
GATCCCGGCACTGTCTTCGT	12	7	yes
GATCCCGGACGCGAACCCGG	689	441	yes
GATCTGAATCTGAAATCCCA	8	3	yes
GATCTGAAGTTCAAATTCCG	1	1	yes
GATCCCAGAATCCAAGAAGT	10	8	yes
GATCCCACTGCACATAGGAC	54243	964	yes
GATCCCACGGGGTGCAGTGA	429	73	yes
GATCCCACGAAGAATTCTTC	47	37	yes
GATCCCACCTAGCAGCCACC	1089	101	yes
GATCTGAAGGGGTGCCCTAT	4	3	yes
GATCCCACCCTCATCCACAG	27	22	yes
GATCTGAAGGAGTCCAGGGT	82	3	yes
GATCATATCGCGACAGACCC	3	2	yes
GATCTGAACTTTGTACAGGA	38	18	yes
GATCTGAACTGTGAGCCTAA	9	9	yes
GATCCCCTCCCTCATGTTAA	2	2	yes
GATCAAACAACCCAACAGGA	8860	3711	yes
GATCCCCGTGTCTGTGGAAA	11	2	yes
GATCTGAAAGTAGACTCTGC	165	54	yes
GATCATTCCCAGTTCTCCGA	1	1	yes
GATCCCACAAGGTGGCTTGT	20	5	yes
GATCTGCATGAAACAGCATA	5	4	yes
GATCACTTTCTGAGCTGTAA	2	2	yes
GATCTGCAAAATTCTATAGT	21	2	yes
GATCCCAAGTTTTTCCTTAA	10	1	yes
GATCTGAAAATGTGTCTAAG	25	10	yes
GATCCCAAGACCACCCACCT	54	2	yes
GATCAGGTACCCACCCAAGC	5	2	yes
GATCTCTTTTCCTGACCCTC	671	77	yes
GATCCCAAAGCCTCGTATGC	102	41	yes
GATCTCTTTCCCCGAGTTGC	27	0	yes
GATCCCCAGTCCAGGATGTG	11	2	yes
GATCCACAACACCCGAGTAT	2	2	yes
GATCCCCACGTGAGTATCGG	7	7	yes
GATCCATTCTTCACCCTTGA	2	2	yes
GATCCATTCGCTGTAACATG	1	1	yes
GATCCATTCCAGAGGGACAT	11	0	yes
GATCCATGTTTTCCAGGTAT	6	4	yes
GATCCATGTTGGGGGTTGGG	4	3	yes
GATCCATGTTGACCAAATGC	61	15	yes
GATCCATGTGTTGGTTGAGA	47	14	yes
GATCCATGTGATGGACTGCA	85	3	yes
GATCCATGTCCTTTGGCTCC	129	82	yes
GATCTCTATCCTGTTGACAG	9	9	yes
GATCACGTACTGTGCCTTGT	6	2	yes
GATCCATGGTGGGGCCATTT	74	22	yes
GATCCATGGTAGTCAGATAG	30	7	yes
GATCAGAAGGTGGTTATCAA	12	5	yes
GATCTCTGTCCGAACTGTGA	85	1	yes
GATCTCTGTCCACTGTATGC	38	14	yes
GATCATGAGCGGAAGGGTTT	221	31	yes
GATCCATGGGCCTTAGGGCT	138	11	yes
GATCCATGCTCTGATGAGCG	57	30	yes
GATCCATGCCTGTAATCCAG	6	5	yes
GATCCATGATATTGTCTTGG	23	6	yes
GATCCATGAAGTTTTCAGTC	56	6	yes
GATCCATCTGCATTTGCGGC	2432	166	yes
GATCCATCTGCACATGGCTC	27	1	yes
GATCTGTCTTCCCAGAAGAG	20	16	yes
GATCTCTGGGAAGGGCTGCG	48	12	yes
GATCTCTGCTCCCTACCCTT	10	10	yes
GATCACAGACATTGCTGGGT	1	1	yes
GATCTCTGCTATGAGGCTAC	252	10	yes
GATCCCAGGAAGTCCCACGA	6	5	yes
GATCTCTCTGTTCTCCTGTG	22	7	yes
GATCCCCAGATGGCTTTCCC	3	3	yes
GATCTCTCTCGCTGAAGGCG	16	12	yes
GATCCATAGGGAAATTGTCC	1	1	yes
GATCAAGTTTCAGGGCAGCC	3	4	yes
GATCTCTCGCCTGGACCCCT	22	6	yes
GATCTCTCCCAGATGGTAAA	8	0	yes
GATCTCTCCAAAGCACACGC	60	10	yes
GATCTCTCAGGCCATGGGTC	196	15	yes
GATCTCTCACGCAGACAGAA	2	2	yes
GATCCCAGAGGCTGAACTAA	2	2	yes
GATCCACGCCCGCTACATCC	38	6	yes
GATCCAGTTTCCTCACAAAT	11	0	yes
GATCTCCACACCATCCAGGA	1	1	yes
GATCCAGTGTGGAAGAGGTG	19	2	yes
GATCTCGGGAATCAGAGTTC	22	18	yes
GATCCAGTATCTGAAAGACT	21	27	yes
GATCTCGCTTACAAGAAACC	32	8	yes
GATCCCACCTCCCCCCAGTC	213	45	yes
GATCTCGCCTTATGTTGTCC	29	0	yes
GATCTCGCCCTGTCAAGCAT	393	24	yes
GATCTCGCAGCCTTCCCCTC	419	79	yes
GATCTCGCAAGCACAAAGCC	138	1	yes
GATCTCGACCAGTTATACCT	2	2	yes
GATCAAAGCATGCACCTGTA	1	1	yes
GATCTCGAATCAGGTCTTTT	32	26	yes
GATCTCCTTGGAAAGCGACT	22	22	yes
GATCAAACTGTCTCCAACGT	5	4	yes
GATCCAGGGTGGGAAGGAAG	191	6	yes
GATCCAGGGGCACTGCCCCT	7	7	yes
GATCCAGGAGACTCGAAGAT	197	8	yes
GATCCAGGACTGTGACTTAA	2	2	yes
GATCTCCTGTCTCTATGAGG	9	0	yes
GATCTCCTGTCTCCACCCAC	37	7	yes
GATCCAGCTTCCCTCCGAGA	535	25	yes
GATCTATTCCTCAACCCTGT	3	4	yes
GATCCAGCGAGGGAGCTGCC	175	5	yes
GATCTCCGTTGATGTAGTGA	28	1	yes
GATCTCCGCCCGAGCCTACG	55	9	yes
GATCGTGATTGTGCTGGACC	1	1	yes
GATCCAGCATGGGTGTCCCG	4	5	yes
GATCCAGCATCACCCAGACA	196	21	yes
GATCCAGCAGACCCAGCACA	93	22	yes
GATCCAGATTACTATGGGGA	29	6	yes
GATCCATTTTGTTCGTGGAC	38	0	yes
GATCTCCCCTCTTCCTGGAT	112	1	yes
GATCCAGAGTAAAGACAGCT	16	2	yes
GATCAGCTGGAAAACAGGCT	21	2	yes
GATCAAGCTCAAACTCTGGC	1	1	yes
GATCTCCATAATTCCAACTT	13	7	yes
GATCTCCAGTTCAAGTTCAT	32	7	yes
GATCTCCAGGGTGGATTTCT	78	1	yes
GATCCTTCTCTGTGTCAGCT	2	1	yes
GATCCTGCTCACCTTGGGCT	54	7	yes
GATCCTGGAGTGGTGCGGAG	8	8	yes
GATCTCCAGCCTCGCCGTGA	13	0	yes
GATCTCCACCCTATGCGAGT	195	46	yes
GATCTCCACACAGCACACAG	426	35	yes
GATCTCCAAGTCTCTCAGTC	25	4	yes
GATCTCCAACTGTGCTTTCA	3	3	yes
GATCCATATCCTGCTCCACC	156	7	yes
GATCTCGCTGTGGATTGGAT	47	2	yes
GATCGCTACTGTGACAAGGA	2	2	yes
GATCGCTAAGTACATGGAGT	14	8	yes
GATCAAGTTTCTGGCCTTGC	4	5	yes
GATCAAGCCAAAGAACTCCA	3	2	yes
GATCAGTTCTCACATCCTTG	4	3	yes
GATCACCAGAAGCCATGCTC	63	50	yes
GATCAGTGGTACAGTGTTTG	12	1	yes
GATCATTAATGCCCTTGAAG	55	54	yes
GATCATGTTTCAGGAAGGAA	6	1	yes
GATCATGTTGATTCTGAAAT	7	2	yes
GATCATGTTCTTTCCGCAGG	621	26	yes
GATCATGTTCGCCTGGACAC	55	2	yes
GATCATGTTCCTGGAGGTCA	63	6	yes
GATCATGTTACACTTGCCAG	95	25	yes
GATCATGTGTCAAAAGCAAA	8	8	yes
GATCATGTGGCGTTCTCTCT	42	15	yes
GATCATGTGGATTCCAGGAA	49	2	yes
GATCATGTGGATGCCTTCCC	6266	591	yes
GATCATGTGGAAGGTGAGAT	9	2	yes
GATCATGTGCTCACCTGCAT	42	5	yes
GATCACATTCCTTCCGAGGT	1	1	yes
GATCACATGGTGACTCTAGC	65	51	yes
GATCACATGACCCCTGAAAT	15	5	yes
GATCCTCCTGTCTCTACCTC	88	16	yes
GATCATGTGATGCTAAACTC	67	10	yes
GATCATGTGAGCATCGTGGA	279	32	yes
GATCATGTGACAAGTGAGAG	4	5	yes
GATCATGTCTTCTCCATGTT	425	3	yes
GATCATGTCTGTGAAATGAC	30	1	yes
GATCATGTCTGAAAAATCCA	39	14	yes
GATCATGTCTCAAGGTGGCA	121	19	yes
GATCATGTCTATCTCAGGGG	170	22	yes
GATCATGTCCTTGAACAAAC	6	6	yes
GATCATGTCCCACAGGCATT	55	5	yes
GATCATGTCATTGCCTGTTA	61	14	yes
GATCATGTCAGAGGGAGATG	3	1	yes
GATCATGTACTGGCTGCAGG	40	16	yes
GATCATGTACAGAGGTCTTT	64	5	yes
GATCATGTACAAGCTGATGG	71	8	yes
GATCATGTAAAGACGCTGGG	111	5	yes
GATCATGGTTCTGATGAAGC	8	1	yes
GATCATGGTTCAAGTGACAA	220	27	yes
GATCATGGTGTGGCTTGTGG	32	1	yes
GATCATGGTGTCTTGTGGTT	38	12	yes
GATCATGGTCTTCGGAAAAC	22	4	yes
GATCAAGCTTCGTGGCTTTT	2	2	yes
GATCATGGGTGTTGCTACCA	89	12	yes
GATCATGGGTGTGCCAGGGG	133	1	yes
GATCATGGGGTTCAGTCTTC	9	0	yes
GATCATGGGGATGGACGGGG	589	53	yes
GATCATGGGGAAATGTTTAC	4	4	yes
GATCATGGGCTTTCTGCTTC	4	2	yes
GATCACAGTTCATGTAATGC	81	9	yes
GATCACAGGTGTGATAGCCT	1	1	yes
GATCTCAGCAGGAGTCAGAT	7	5	yes
GATCATGGCCTTTACGATGC	7	7	yes
GATCATGGCCTTCAGATATG	205	3	yes
GATCATGGCCCAGACCTGAG	119	4	yes
GATCATGGCAAAGGATGACC	353	24	yes
GATCATGGATGTGTGGGGAA	11	0	yes
GATCATGGACATGAAGGAAG	118	3	yes
GATCATGCTTTCTTCTCTAT	12	5	yes
GATCATGCTGTGTTCGTGAT	12	1	yes
GATCATGCTCCTGCAGCTGA	507	94	yes
GATCATGCTCCTGAGTGGCA	58	4	yes
GATCATGCTCATCTTCACTG	21	5	yes
GATCATTGGGGGAGGGTAGT	50	6	yes
GATCATGCTACGTTTTGTCT	17	5	yes
GATCATGCGCCTTTCTAAGC	105	14	yes
GATCATGCCTTCTGTAAAGC	68	9	yes
GATCACAGTGGCTATATCTC	68	7	yes
GATCACAGCTATGCCCTTTC	52	9	yes
GATCACAGCCCTAGCACCTA	19	5	yes
GATCGTGTGTTGCCATTTTG	51	11	yes
GATCACAGCAGCCCAAGCTC	69	14	yes
GATCACAGCAGCCAAGGGAC	19	5	yes
GATCTCAAGAAAGAGTTGCG	15	3	yes
GATCATGCCGTGCTACGCTC	92	19	yes
GATCATGCCGCCCCTTAGTG	152	51	yes
GATCATGCCCCAGGACACAA	16	4	yes
GATCATGCCCAAAACAACCA	59	6	yes
GATCATGCAGTAGTTCACAG	29	11	yes
GATCATGCAGACTGTTCCTT	570	57	yes
GATCATGCAGAAGAACGGTG	388	18	yes
GATCATGCACTGTATTCACA	61	3	yes
GATCATGATACTGTTTGTTC	21	4	yes
GATCATGAGTTCAGTGTTAC	10	3	yes
GATCATGAGTGTCCCACTAC	12	1	yes
GATCATGAGGGAGTTCCGGT	970	49	yes
GATCATGAGGCTGTCTGCAG	21	4	yes
GATCATGAGCCATTTTTAAC	4	0	yes
GATCATGACTCAGTATCAAC	4	0	yes
GATCATGACGCTGGTAGATG	31	4	yes
GATCATGACCCTTAGACTCA	7	2	yes
GATCATGACATTCCTCAGAT	37	3	yes
GATCAGCTGAGCGTCAGGGT	6	5	yes
GATCACAGACCATGGTCTCA	228	17	yes
GATCAGCTAAGCCTCTTGTT	6	5	yes
GATCACACTATGTAGCCCTA	2	2	yes
GATCACACCCTCATCAGAGT	1	1	yes
GATCATGAAGGTCACGGTGA	3	1	yes
GATCATGAACATCATCCAGG	161	11	yes
GATCATCTTTTCTCATTTCG	9	7	yes
GATCATCTTGTTGCGTTTCT	8	1	yes
GATCATCTTGGTGTGAGGCT	9	0	yes
GATCCTTTCGGCTGAGCCTC	64	2	yes
GATCATCTGGTGCTGTGTCG	18	4	yes
GATCATCTGCTACCAATGTG	14	11	yes
GATCATCTGCCCTTTCTATC	45	3	yes
GATCTTTGGTGACTGTGCTC	3	2	yes
GATCATCTCCCCCTTCAGTG	7	9	yes
GATCATCTCACAGGACAGGG	178	1	yes
GATCACACATCTGGGCAGTG	4	3	yes
GATCAGCCTGGTCTGCAGAG	10	8	yes
GATCTCTGTAACAGAGCCTC	12	9	yes
GATCAGTTCTTCAGCATGGT	3	0	yes
GATCATCTACGACAGAAAGT	3	2	yes
GATCATCGTGTCGGGATGAT	52	2	yes
GATCATCGTGCTTTCAGACT	38	0	yes
GATCATCGTCAGTGACGTTT	121	12	yes
GATCATCGGCATGGCATACG	416	7	yes
GATCATCGGACGGCCAGTTG	56	4	yes
GATCATCGAGTTGTGGATGG	3	3	yes
GATCATCGAGGACAAAACTT	17	1	yes
GATCATCCTTGTGTTGTGAA	143	21	yes
GATCATCCTTCAAAGGGGAT	14	11	yes
GATCATCCTATTCAGTGAGG	4	5	yes
GATCATCCGCAAAGTTGTGA	22	10	yes
GATCATCCAGGGCTGCCCCT	42	4	yes
GATCATCCACCTGCTCACTG	901	660	yes
GATCATCCAAGTGTTTGAGC	14	11	yes
GATCATCCAAGCTGTTGTAA	45	28	yes
GATCATCATTCGTGTGCAGA	41	11	yes
GATCATCATGGAGCTGGTGA	9	9	yes
GATCATCATGCTTCCAGATG	231	27	yes
GATCACAAGCCAGAACTTCC	14	3	yes
GATCACAAGATGGCGTTATC	2	2	yes
GATCAGCACGAGGGGTCCTA	56	2	yes
GATCAGGTCATCGCCTCCTT	539	73	yes
GATCAGGGTTAAGGAGGAGC	38	10	yes
GATCAGGGATATGAGGTTGC	19	15	yes
GATCAGGGAAGCAGACATTG	423	227	yes
GATCAGGCTGTCTGGAGACT	40	13	yes
GATCAGGCGAGACATGTTCT	42	11	yes
GATCAGGAACCTGGCCTTCT	5	4	yes
GATCAGGAAATCCTAACTAC	1	1	yes
GATCAGCTGTGGGCTCTGGG	383	28	yes
GATCAGCTGCTTCTAATGAT	9	3	yes
GATCATCATCTTGACAGCTT	2	2	yes
GATCATCAGTTAGAGTTCTG	30	10	yes
GATCATCAGCTGAGGCAAGG	4	4	yes
GATCATCACTGCTGCCCTAT	11	11	yes
GATCATCACTCACGGACATA	16	2	yes
GATCATCAAGTGTCCTGGCG	78	4	yes
GATCATCAACACAATGACGC	1	1	yes
GATCATAGCTTCCTGTCCCC	1	1	yes
GATCCTGACATGAGACGGGA	24	1	yes
GATCACAAACATAGCCAATG	115	16	yes
GATCAATGCCTGGACGGCTC	445	273	yes
GATCAATGCCTCCAGCAAGG	2	3	yes
GATCAGCGTGCGCCTAGCGG	674	34	yes
GATCAGCGACCTTCCAGCAG	23	3	yes
GATCAGCCTCTTTCCCATCA	5	4	yes
GATCAGCCCTGGCAAGGAAG	46	11	yes
GATCAGCCCTCTGGCTCAGC	6	6	yes
GATCAGCCCCATTGCGGTGC	29	29	yes
GATCAGCCATCCTGGATGGA	30	1	yes
GATCCCAGCTGTTTGGGGCT	112	1	yes
GATCAGCCAAGCCAGACTTG	3	2	yes
GATCATAGCTGATGGCCTTC	18	2	yes
GATCATAGCTCTAGCAGAAC	89	12	yes
GATCATAGCTACTTTGTGCT	56	2	yes
GATCATAGCAAAGATGGACG	35	7	yes
GATCATAGATTGGGCTACAT	189	3	yes
GATCATAGATGACTTTGCCT	97	11	yes
GATCATAGAGGTGTGGCTTT	11	5	yes
GATCATACGCCCAGGGAGAG	73	0	yes
GATCATACCCTCTCTGGCTT	6	2	yes
GATCATACCAAGAGGTGAGG	217	11	yes
GATCATAATGGACTGAACCT	4	4	yes
GATCTGGCCAGAGACACTGA	1	1	yes
GATCATAAGGTATTCGGGAG	15	12	yes
GATCATAAGCTCCTGTGGGC	17	1	yes
GATCATAACAGTTCTGTGAA	6	1	yes
GATCAATCAGAGGGATTACC	7	5	yes
GATCAGCAGGTGGTTATCAA	48	22	yes
GATCAGCAGCTGCTTTTGCA	35	34	yes
GATCAGCAGATGTTGGTGGC	10	8	yes
GATCAGCACTTGGTACATGG	37	30	yes
GATCAGCACTGGGGTCAACG	42	15	yes
GATCAGCACTCTCGGTATGC	123	1	yes
GATCAGCACCACACTGGACT	27	1	yes
GATCAGCAAATTCAGAGATA	2	2	yes
GATCAGAGTGTCACGGTAGG	5	2	yes
GATCAGAGCCCTGTCGATGG	135	28	yes
GATCAGAGAAACTGGGTAGA	94	21	yes
GATCAGACGAGGTTCTCTCT	39	2	yes
GATCAGACCATGGTACTGGC	262	25	yes
GATCAGTTTTTGGTGTCATT	299	10	yes
GATCAGTTTTGGTCTTGATG	19	2	yes
GATCAGTTTTGGAGTGCAGC	19	15	yes
GATCAGTTTTGACCTCTTAT	71	5	yes
GATCAGTTTTCTGAGGAGGG	2	3	yes
GATCAGTTTTCATGTCCTCT	4	1	yes
GATCAGTTTGTTTTCACTGT	18	1	yes
GATCAGTTTCATGTTTTTTC	7	5	yes
GATCAGTTTCAGCCAGGAGT	10	8	yes
GATCATTTAGCGACAAGCAT	43	3	yes
GATCAGTTTATCAGTCCGTT	20	1	yes
GATCAGTTGGTTGATTCCTA	1	1	yes
GATCAGTTGCCAAATGATTG	75	2	yes
GATCAGTTGATATCTGGGGG	121	14	yes
GATCAGTTGAAACTTGGAAA	104	7	yes
GATCAGTTCTGAGCCGAGGA	63	2	yes
GATCAGTTCCTGGTATACAG	20	16	yes
GATCAAGTGCTGTGACAGTG	13	10	yes
GATCAGGCACTGGAAGAGGC	3	2	yes
GATCAAGGTGGCGGAGGACG	14	3	yes
GATCAAGGTCGGAAAGAAAT	634	111	yes
GATCAGACAGTATCAGGGCT	14	3	yes
GATCAGACACATTTCGACAG	20	5	yes
GATCAGAATGAGGGACCTCC	264	11	yes
GATCTGTGCAGGGTATTAAC	825	704	yes
GATCACTTTGACTTCATCCT	18	7	yes
GATCTGTGCAAAAGCAGTGA	585	7	yes
GATCACTGCTGTAGGAAAGC	33	3	yes
GATCACTGCTCTGGACCTAA	50	9	yes
GATCACTGAGATTGGGTTGC	8	2	yes
GATCACTCGCCGAGGTGTGG	7	5	yes
GATCTCTCCCTCTCTTTCAT	2	2	yes
GATCAGTTCCATGTTACACA	20	7	yes
GATCAGTTCAGTGTGCATCG	35	28	yes
GATCCGGGCAGAGGTGCAAG	2	0	yes
GATCAGTGTTTCTGCGAAGG	10	5	yes
GATCAGTGGCTTCAGTCACA	67	19	yes
GATCGGCGTGACTACCCCTT	20	1	yes
GATCAGTGCTGTACTTCACT	39	6	yes
GATCAGTGCTCTGCTAACGC	548	367	yes
GATCAGTGCCTTTGTTGGCA	607	139	yes
GATCAGTGCATTTCAGAGTT	50	6	yes
GATCAGTGCACACAGCTCTC	18	11	yes
GATCAGTGAGTGTGAGTGTG	9	6	yes
GATCACTCAGTAACTGCTGG	96	13	yes
GATCACTCAGGATTTGTTCC	22	17	yes
GATCACTCAGCCCTTGAGCA	15	7	yes
GATCACTACTCCTTAGACGT	128	10	yes
GATCACGTTCTGATTGAGCT	57	13	yes
GATCACGTGTTTACCAATCC	1	1	yes
GATCACGTGTATGTGTCGTG	60	5	yes
GATCACGTGGGCTGCGTTTC	37	19	yes
GATCACGTGGCTGTTCTTGT	99	7	yes
GATCACGTGCCTGAGGTATG	34	29	yes
GATCACGTGACCACCCTTTC	37	2	yes
GATCACGGTGCCTGGTTACA	147	12	yes
GATCACGGGAGCTGAGCAAC	61	15	yes
GATCACGGAGCTGGAGTTCG	14	11	yes
GATCACGGAGCCAAGGAAGA	7	9	yes
GATCACGCAGTCTTAGAAAT	49	1	yes
GATCACGACGACGCCCACGC	481	74	yes
GATCACCTGCCAGACTGTTA	18	2	yes
GATCTGTCTGTTTAGTGGAT	8	0	yes
GATCACCTCCCAGATTCTGA	234	15	yes
GATCACCGTGTAGCTGAGGC	74	8	yes
GATCACCCACCCATCAGCCA	26	25	yes
GATCGAGGGGAAGGACGCTG	9	7	yes
GATCACCAAGTGGAATGAAA	8	3	yes
GATCACCAAGGAATCCAAGG	568	19	yes
GATCACCAACTCACGTCATG	109	20	yes
GATCACCAACCACCCCAGCA	516	49	yes
GATCACAGTGGAATCTTCGG	65	5	yes
GATCACAGTGAGATTCTCAT	1	1	yes
GATCACAGGTCTGAGCAAAG	31	4	yes
GATCACAGGATTGGCGTCCC	48	2	yes
GATCACAGATTCTGCTGGCC	5	4	yes
GATCACAGAGGGGCCAGGAT	141	22	yes
GATCTAGCAAGCACTGCAGG	6	5	yes
GATCCTGGGTAGGGGCGAAG	8	4	yes
GATCTAATCCGTGGGTGCTC	18	14	yes
GATCAGAAGTTGAGACTTCC	1	1	yes
GATCGGCGTTTACCTTTGTA	1	1	yes
GATCACACTTGGGGAAGATG	65	3	yes
GATCACACTGGAACAGAACC	195	13	yes
GATCACACCTGTGGGGTCAA	75	74	yes
GATCACACCTGTAGACAAGA	88	3	yes
GATCACACCCAAAGCTGTCC	91	56	yes
GATCACACAGGGAGGCCTTG	368	28	yes
GATCACAAGGTGCTCCTGCA	17	13	yes
GATCACAACTGATGGCGGGT	674	45	yes
GATCACAAACACCGGTGAGA	1	1	yes
GATCTAAGCGGGACTATGAG	25	20	yes
GATCAATGTCGTCATCATCC	45	10	yes
GATCAATCACCAGCGCGAAG	122	10	yes
GATCAAGATTTGGCCAATTG	66	5	yes
GATCAGGAGGTGAACAGAGA	240	25	yes
GATCACGTGCTTGTGCCAGG	3	2	yes
GATCAACTCATGGAGCTGGC	272	38	yes
GATCCCCAGCACCCACATAG	11	9	yes
GATCAACGCCATGACCTACC	125	1	yes
GATCAACCCCTACCAGCCAG	8	10	yes
GATCAACACTTTTCTCTCAG	10	2	yes
GATCAACACTCCCTGTATCT	7	1	yes
GATCAACACACTGGAATGGA	30	4	yes
GATCAAATTCCCAGGGACAT	110	7	yes
GATCCGAATCTGTGCCCAGC	346	15	yes
GATCATCCCGTGCAGCCGCG	3	3	yes
GATCCCAGCATCGGCAAGCA	21	27	yes
GATCACCAAGGCTCGGGAGT	8	6	yes
GATCCCTCTCTCACACTCCT	15	1	yes
GATCCCGTGTTCCTTTCAGC	8	4	yes
GATCCTCCTGGGCTTGAACT	12	12	yes
GATCAAACTTAAGACCAACC	51	1	yes
GATCAAACAGCTGTACCTCA	45	25	yes
GATCTCAGTGAGTGCATCTA	24	3	yes
GATCGACACATGTGTGGGGA	53	27	yes
GATCAACCACGTCATCAGCG	3	2	yes
GATCCCTTTATGAACCTTGT	40	2	yes
GATCCAGCATGCCAACGTGC	20	20	yes
GATCTGGTCCTGCTCCTACC	1	1	yes
GATCCCTGGTCCTCTGAGAG	1	1	yes
GATCAAGACTACCATGGTCA	31	4	yes
GATCAGTCCAGCTCTGGGAG	3	2	yes
GATCAGTCACAGCTTGTGCC	16	0	yes
GATCTCACTCACGATGTCTT	9	3	yes
GATCGTTGAGACTTCTTTCA	18	14	yes
GATCCAGAGGCCCTAGCCAG	205	14	yes
GATCCAGAGAGCTTCCTAAA	64	3	yes
GATCCAGAATGTGTGGCAAC	10	5	yes
GATCCAGAACACTTGACACT	8	6	yes
GATCAACACTGAGGAGAAGC	8	6	yes
GATCCACTGCGTTTCCATGC	136	14	yes
GATCCACTCTCTCATGGGCT	15	14	yes
GATCCACCTTGTGGCCTGGC	497	49	yes
GATCCACCTGTCTCTCCTTC	35	7	yes
GATCTCATGGTTGACTCTCT	17	8	yes
GATCTCATGGCCAAAGTAAG	13	17	yes
GATCTCATGGCACACATAGC	39	39	yes
GATCCCTCCCATGTTGGGAG	3	2	yes
GATCCACCGTACCAGGAAGC	254	10	yes
GATCCAGTCGTTCTGCTGCG	169	8	yes
GATCTCAGTCCCCGCCTGCA	149	29	yes
GATCTCAGTAGGCTAGGAGA	4	3	yes
GATCCAGGTGTTTGGCCTGA	5	0	yes
GATCAGGCGAAGCAACTGCT	12	1	yes
GATCCTGCCCCCACGCTGGG	37	30	yes
GATCCACCAAGGTAGAAAAC	27	1	yes
GATCCACAGGCTCCTGGGCC	35	34	yes
GATCCACACGGGCGAGAAGC	6	6	yes
GATCCACACAGGAGAGAAGC	115	3	yes
GATCCAGGACAGCCAGAGCT	30	7	yes
GATCTCACTGTGTCGCTCTG	3	2	yes
GATCCAGGACACAGCGTGGT	41	3	yes
GATCTCACTGGACTTGGTGT	114	13	yes
GATCCCGTGTAGCCTTCGTT	39	6	yes
GATCAGGACCTCAGCGATGG	30	1	yes
GATCTCACTAACCTGCCACC	82	14	yes
GATCCAGCTGCAGAAGCCAG	9	1	yes
GATCTCACGGCCTGCGGGGT	110	32	yes
GATCCAGCTCTCTTAGACAG	30	9	yes
GATCTCACGGCCAGACAGAC	117	13	yes
GATCAAGCCTAGCCAGGACC	32	7	yes
GATCCAAGTTATTGGCACAC	1	1	yes
GATCCAAGGGCCCTGTATGT	36	14	yes
GATCTCACCTACCTATCAGG	164	131	yes
GATCCAAGGACAAGACACCA	74	1	yes
GATCTCACAGTTAGTAGTCA	35	8	yes
GATCTTACTCAAGTACCTAG	4	3	yes
GATCGAGTGTATCACGCAGG	52	15	yes
GATCTCAAGCGCTTTGCTCT	52	12	yes
GATCTCAAGCAAGTCAGAAG	11	9	yes
GATCTCAAAGTGGCTGATGC	14	2	yes
GATCTCAAAGGGAAACTGAC	50	2	yes
GATCTCAAAGGAACTTCTCC	34	21	yes
GATCCCAGTGGTATTCCGCT	3	4	yes
GATCCAACTGACTGGCTAGC	257	16	yes
GATCCAACTGACAGATGAGG	4	3	yes
GATCCAACTCTGTAAAGGCT	44	0	yes
GATCCAACTCAGTTAGGCTT	1	1	yes
GATCCAACTCACCCCATCAG	6	6	yes
GATCCAACGCAGCACCGTCT	175	9	yes
GATCCAACCCCCTCTCCTGA	13	2	yes
GATCGAGCCAAGAGCTGTAA	32	26	yes
GATCGAGCAGGCCCGGCTGC	21	0	yes
GATCCAAAGACGCTAGATGT	76	7	yes
GATCCAAACGTCACAGAATT	46	3	yes
GATCTATGTCATGGCCACGC	151	7	yes
GATCTATGCCTACATGAGTC	2	2	yes
GATCTATGAGACAGAACTGG	79	0	yes
GATCTAGTATTCAGGGCGGA	66	5	yes
GATCCCCAGCTGAGCGCAGG	10	1	yes
GATCCAAAAGGAAGCAAATT	68	20	yes
GATCTATATCCTCTGACAAC	23	8	yes
GATCCACTTGCGTTGTGAGC	12	12	yes
GATCTACTTGTGTGTGTGTG	199	15	yes
GATCCACTCCAGGGCTTGGA	2	2	yes
GATCTACTCCTTCAGAGCCT	135	2	yes
GATCTACTACCAGACAGACA	76	6	yes
GATCCACGGGGTGACTTCCA	15	3	yes
GATCTACGGTTCCCACGCAT	327	53	yes
GATCTACGGCCTGGACTTCT	3	3	yes
GATCTACCTGTTCTCCCTGC	3	2	yes
GATCCTGTGGGGCTATGACG	3	3	yes
GATCCTGTCTCTGGCAACCC	2	0	yes
GATCTACCTGACCTTGTTGA	5	4	yes
GATCTACCTCCATAGAGATG	14	10	yes
GATCTACCTACCCGTGGTGT	38	5	yes
GATCTACCAGGTGGACACCC	63	4	yes
GATCTACAGGACCCGCCCCT	16	8	yes
GATCTACAGCGTGCCCTGGA	17	17	yes
GATCTACAGCACTGCCTTTC	9	7	yes
GATCTACACACTCCCTTTTT	50	6	yes
GATCCACCAGCGTGTGCATG	118	23	yes
GATCCAGGGTGAGTTCTTAA	4	3	yes
GATCATGACGAGATGGTGAT	30	3	yes
GATCATGACCGAAAGCTCGA	48	7	yes
GATCAGTACCTAGCGCCCAC	5	4	yes
GATCATTCTGAAGTACATTG	3	2	yes
GATCATTCCAAGTTTCACGT	49	3	yes
GATCTACAAAACACAGGGAG	15	3	yes
GATCTAATAGGACTTCTGTT	1	1	yes
GATCTAACTTAATCAGGCAC	13	10	yes
GATCCACACAGCTGCAACGT	17	13	yes
GATCTAAATGCCCAAGTTGA	104	12	yes
GATCCACACAATGGAGACCT	178	6	yes
GATCTAAATCTTTCCTCAGC	32	4	yes
GATCTAAAGTTACTCTGCTT	5	4	yes
GATCTAAACTGTGGTGTGAA	31	31	yes
GATCTATTACCTGGTTGTAG	10	8	yes
GATCTAGCTCATCAGAATAC	3	3	yes
GATCAGAGAAGCAGATATTT	49	65	yes
GATCTATCACATGTGGAAGT	9	7	yes
GATCCAGAGGAGAAACTAAG	2	3	yes
GATCTAGTCCTCCCGTTCAT	20	2	yes
GATCGGCACTGGCATGAAGG	2	2	yes
GATCCAATTGTGTGCTGTGC	6	5	yes
GATCGTTGTCGCCGCGTCTT	12	9	yes
GATCGTTGGATACTCACAGA	26	2	yes
GATCGTGTGGAGTGAAAGGC	32	6	yes
GATCGTGTCCGGCATGAAGT	993	41	yes
GATCGTGTAGCAGGGTAAGG	3	1	yes
GATCCAAGGGGAGAGTCAAG	15	1	yes
GATCCAAGGGCGCACGAAGA	33	6	yes
GATCGTGGTGCAAGGAGAGC	302	164	yes
GATCCCCATCATAGTGTGTG	23	4	yes
GATCGTGGTCCAGAGGAGCA	39	5	yes
GATCCAAGGCGGCGACCCGA	118	28	yes
GATCGTGGGAACCATTGTCA	3	2	yes
GATCGTGGCTAGTGAGATAG	18	2	yes
GATCCAAGAGGCTGTTTTCG	3	3	yes
GATCGTGAGGCGGCTGGACC	41	33	yes
GATCGTGAGGATGGAGAAGG	155	3	yes
GATCGTGACGGCACTGACGT	43	3	yes
GATCGTGAAGCCGCTGAATC	23	6	yes
GATCGTGAAGCACCTGAATT	49	3	yes
GATCGTCTTGCTTTTGGAGT	10	8	yes
GATCTTTGGAGGAATCACGG	4	3	yes
GATCGTCTCAGTTACGAGGC	160	6	yes
GATCTGCCCTAGAGTCTCGT	1	1	yes
GATCGTCACCACAGTGGGAA	3	2	yes
GATCGTATCCCCAGGCGTGG	47	13	yes
GATCGTAGTAGTTCCTGTTG	15	4	yes
GATCGTACGGCTGTAACAGG	51	5	yes
GATCCAACCATGACCAGGTG	9	7	yes
GATCGTAAGTTCTGGGACGC	3	2	yes
GATCAAGCTTGGCTAGTCTG	3	2	yes
GATCGGTGTCGAGCACGGAC	35	14	yes
GATCAGAGAGTGAAGAGGAC	3	0	yes
GATCCGTGACATTTTATTTG	7	5	yes
GATCGTGGTCATCCATGAGG	9	2	yes
GATCGTCATTCTCCAAAGAG	17	1	yes
GATCCGCTACCCTGGTGCTG	4	5	yes
GATCCTAGCTGGGCAGTAGT	11	6	yes
GATCCGACGCCTCGGTGCAA	8	8	yes
GATCCGACCTTTGTTGGCCT	30	6	yes
GATCAAACCTACCAGCCGGT	2472	191	yes
GATCTCAAAGAAGAACCTCA	2	2	yes
GATCTATGTGCTGGGGGGAC	4	3	yes
GATCCAAACTCTGCAAGCAG	20	9	yes
GATCTGCCACACCAGAAATC	6	5	yes
GATCCTTGGATGAGAAGCTA	16	21	yes
GATCAGAGAAACCGTCTCCC	40	4	yes
GATCCAGGCCGAGGACCGTG	19	4	yes
GATCAGTCTTTTCAGTATTT	2	2	yes
GATCAGTCTGAATTGAACAT	3	2	yes
GATCAGTCGTAAAGGACTCA	22	0	yes
GATCAGTCCTCTAGCATTTC	97	60	yes
GATCTTGGCTGACTACGGCA	2	2	yes
GATCAGTCCTACAAAGTTCC	17	3	yes
GATCAGTCCCTTCCCCCAAC	148	22	yes
GATCAGTCAGGTCCTAGATG	1	1	yes
GATCAGTCACAGGCAAACTC	44	31	yes
GATCGGCTGCTTTTGTCTCT	38	2	yes
GATCGCTTTAGCTTGCCTAC	80	1	yes
GATCGCCTGCATCTTCAAGG	8	1	yes
GATCAGTAGGAAGCACAGGT	718	39	yes
GATCAGTACTGCAGTTCCTG	15	8	yes
GATCAGTACTACTGTGGTGT	13	2	yes
GATCAGTAAGGATTCCTGTA	22	0	yes
GATCAGTAACAGCTCAGACA	42	4	yes
GATCAGGTTTGGACTCCTTC	129	20	yes
GATCAGGTTTGCACCAAGGT	58	15	yes
GATCAGGTTCTGCCACATCT	2	1	yes
GATCAGGTGTTTGGATGGCA	6	6	yes
GATCAGGTGTTCAAAGTCAC	20	1	yes
GATCAGGTGTCAGTTTTCTA	22	2	yes
GATCTGCGATGAACTGGGAG	720	30	yes
GATCGCCAACTCGCTGGCCA	7	0	yes
GATCCATTTGGAGCTTACTC	1	1	yes
GATCAGGTGAAGACCCTCTC	34	27	yes
GATCAGGTCAGAGATGCGGT	189	5	yes
GATCAGGTAGAGAGAGCTTG	19	19	yes
GATCAGGGTGGAATGTGCCT	32	33	yes
GATCAGGGTCCTCCTTCCCT	57	12	yes
GATCAGGGGGAAGGGGTCAG	80	1	yes
GATCAGGGCGTGGTAGAGAA	29	0	yes
GATCAGGGCCGTGTGGATGC	255	1	yes
GATCAGGGCCGAGTGATGAG	93	4	yes
GATCAGGGCCCATTAGTGAG	71	8	yes
GATCAGGGCCAGGGGAGGTC	234	5	yes
GATCAGGGCAGAGATGGAAG	47	5	yes
GATCAGGGCAAGGGCTAGCC	16	12	yes
GATCAGGGCAAGAGGATTGT	124	18	yes
GATCAGGGCAAAGTGGCTTT	121	3	yes
GATCAGGGACTCTTCGGTGT	3	4	yes
GATCAGGGACCACGAACAGA	435	59	yes
GATCAGGGAAGTTCATTGTG	41	42	yes
GATCGAGAAGTTCAGGCAGA	4	3	yes
GATCAGGCAGAGAAAGGACA	3	2	yes
GATCAGGCTGAGCTGAATGT	28	2	yes
GATCAGGCTACTACAAAGTT	653	56	yes
GATCCAAACACACACTAGGA	473	26	yes
GATCAGGCGACAGTGAAGAT	13	6	yes
GATCAGGCCTGGAGCCCCAG	6	5	yes
GATCAGGCCTGAACCCGTCC	278	23	yes
GATCAGGCCCACAGCCGAGT	72	24	yes
GATCAGGCCATCAAGTCACA	56	24	yes
GATCAGGCCATACGTAGCCT	98	17	yes
GATCAGGATTCAGATGTAGA	15	12	yes
GATCAGGATGGCTGGATTCA	529	77	yes
GATCAGGAGTTTAAGTGGTT	28	10	yes
GATCAGGAGTTACTATCCAG	59	47	yes
GATCAGGAGTGTCCCACACT	46	2	yes
GATCCTTCTCCCATACCCAG	2	2	yes
GATCAGGAGGGTCTATTTCC	100	67	yes
GATCAGGAGGGTCAGCTGTG	49	1	yes
GATCAGGAGGCAGTGTGTGG	58	3	yes
GATCAGGAGGAGAAAGTGAG	5	4	yes
GATCAGGAGCTGGCATTGGC	311	177	yes
GATCAGGAGCCCATTGGTGA	21	16	yes
GATCTTTCTCAAGAGCAGTG	2	2	yes
GATCAGGAGCCAGGGAGCTA	496	189	yes
GATCAGGAGCACCTGTGGCT	94	23	yes
GATCAGGACTTGGTGGAAGC	103	4	yes
GATCAGGACTCCTGTGACTC	98	12	yes
GATCAGGACCCCATTTTCCA	18	14	yes
GATCAGGAATGTGTGCAGCA	99	16	yes
GATCAGCGGTGGGAATGACA	2027	37	yes
GATCAGCGCTATTTCCTGAG	9	2	yes
GATCAGCGCCTCCAGTTCCT	198	1	yes
GATCAGCCTTTTCTGTCTTG	19	4	yes
GATCAGCCTTCAGTTCATTT	6	5	yes
GATCAGCCTGGGCCACCTTG	81	65	yes
GATCAGCCTGCTCCTGGGGC	99	8	yes
GATCAGCCTCCATCCGCTCA	68	9	yes
GATCAGCCGCTCAAGATTCT	535	35	yes
GATCAGCCCGACTGTCTGCT	21	9	yes
GATCAGCCCCAGGTTCTTAG	20	16	yes
GATCAGCCCATCCACTCTTT	3	3	yes
GATCAGCCCAGCCCATGTGA	503	11	yes
GATCAGCCATTTCTTGGGGT	19	10	yes
GATCAGCCAGTATCTTGAGT	36	8	yes
GATCAGCCACTTAGAATTCA	35	2	yes
GATCTTGTCTGTGTCGTTCT	18	7	yes
GATCAGCCACAAGATTTCAT	29	2	yes
GATCAGCCAAGGGTTCAGAG	2358	160	yes
GATCAGCATTCTTGAGCTGG	204	8	yes
GATCAGCATGGTTGTTCTTC	51	12	yes
GATCAGCATGGGCACACAGC	32	33	yes
GATCAGCATAGTTGTAGATT	41	3	yes
GATCAGCATAGCACATGAGT	30	3	yes
GATCAGCAGTGTCGGCCATT	362	18	yes
GATCAGCAGTGCCTTGTGTT	95	0	yes
GATCAGCAGGGATTATTCCA	10	1	yes
GATCAGCAGGAACCCCACCT	33	12	yes
GATCAGCAGCCTACGACCTT	42	6	yes
GATCAGCAGCATCAACTCCA	3	3	yes
GATCAGCAGAGTGGTTATGG	87	1	yes
GATCAGCACTTGCCTGGAAA	7	2	yes
GATCAGCACTCTGCCTCCAA	97	4	yes
GATCAGCACTCAACCATTCT	12	6	yes
GATCAGCACTAAGACTGCTA	73	2	yes
GATCAGCACCTTGAAGAAGT	18	18	yes
GATCAGCACCTCTCCAAGAA	20	5	yes
GATCAGCACAGGGTCAACTA	60	1	yes
GATCAGCACAGACACCATTT	97	0	yes
GATCAGCAAGTGACATTGAT	21	1	yes
GATCAGCAAGTCAGGAGTCA	201	2	yes
GATCAGCAAGCAGGAGTGCG	22	23	yes
GATCATCCCGCGGGACCTCT	1876	548	yes
GATCCTCAAGAGAAGCTTCA	12	12	yes
GATCTACATTTGGGGAAAGC	6	5	yes
GATCAGATTTGTCCACAAGG	75	3	yes
GATCAGATTTGGTCTATCGG	67	54	yes
GATCTGTGCTACTGGCCCCC	27	1	yes
GATCAGAGTTCTTTTGTACC	8	6	yes
GATCTGCCAGGCTTCGCTTG	6	5	yes
GATCAGAGTGTGTCCTGCTT	6	1	yes
GATCAGAGTCGCTGTCTCCT	3	2	yes
GATCAGAGTCGCCCTCCCAT	93	13	yes
GATCAGAGTCCACCTTTACC	35	1	yes
GATCAGAGTCATAGGCTGGC	12	9	yes
GATCAGAGTATGTCTTGTGT	11	2	yes
GATCAGAGGTTAGGACGTGA	49	1	yes
GATCCCTATGAGTTCAAGGC	5	4	yes
GATCCATTTATGGGACACTG	50	13	yes
GATCAGAGGCTCCCAACTGG	320	7	yes
GATCAGAGGATGTGCCCTTG	9	1	yes
GATCAGAGGATGCGGAGCTA	27	9	yes
GATCAGAGCCGAACCTACTT	13	0	yes
GATCAGAGCCAAGAAACGCC	303	7	yes
GATCTCTCGGTGTGTCTGCG	2	2	yes
GATCAGAGATGGGCAGCCTA	19	15	yes
GATCAGAGAGTGTCAACTTA	57	3	yes
GATCAGAGAGAGAGAGTTTC	8	6	yes
GATCAGAGACAAGTTCATTA	24	3	yes
GATCCAGCTCCCGGATGGAA	1	1	yes
GATCAGAGAACGGAAGAAGC	56	13	yes
GATCAGACTGGTGAGAAAGC	10	8	yes
GATCAGACCTGTGGCTGAGT	111	18	yes
GATCAGACCTGGGCGTGAAA	68	42	yes
GATCAGACCGTTGGGTGGAC	6	5	yes
GATCAGACCCAAAGAAAAGT	106	8	yes
GATCAGACCATTGAAACCAC	14	11	yes
GATCAGACACTGACTGGTGA	217	0	yes
GATCAGACACTCCCTCACCA	88	51	yes
GATCAGAATGAACTTGCCAA	40	1	yes
GATCCTTCTGATTGAGGGAG	3	3	yes
GATCAGCTCCTCTCGTCTGA	11	0	yes
GATCCAAGGCCTCCACGTCT	2	2	yes
GATCTCTCCCTCATATAACT	27	5	yes
GATCCTAGACTTGTATGGCA	2	3	yes
GATCTGGGAGACGAGTGGTG	3	2	yes
GATCTGGCTTTCCAGATGGC	12	12	yes
GATCTGGACCTCGTATACTG	25	20	yes
GATCCGTCGCCACTGGGGAG	3454	664	yes
GATCAGTTACACCTGCAGCA	10	4	yes
GATCTGTTTTCCCCTCGGCT	2	2	yes
GATCAGTAGTTGCATAGGGA	8	2	yes
GATCCCTTCCCCACCTAGCT	26	8	yes
GATCCCGACGGGTTGGCTGC	3	1	yes
GATCCAGACCTCTGGCTTGC	8	0	yes
GATCTTACAGTGCTAGCCAA	5	4	yes
GATCCACATCAAGTGGGGGG	13	0	yes
GATCGTAAACTACTTGAGCT	132	5	yes
GATCGGCGCCTCCGGAGTAC	95	11	yes
GATCACTAGAGCACTCCCAG	12	9	yes
GATCATACTCATCCCCTCCT	6	8	yes
GATCATTCTGGTTTCAGAAC	36	0	yes
GATCTGGGCTATGAGCCACT	53908	3272	yes
GATCATCCGCAGAATACGGA	18	2	yes
GATCGCCATATGGACCACCT	41	41	yes
GATCCTTGAGAGGCAAGACG	31	4	yes
GATCACCTCTGCCCAGTGAG	2	2	yes
GATCAGGTGGAGTTGAAGGA	74	20	yes
GATCCTGGGTAGCATTTTAG	19	10	yes
GATCACCAGAGACACCTGGC	1	1	yes
GATCACTCATTGTTCAGGTG	2	2	yes
GATCCCTGCCTTACAATTGG	2	2	yes
GATCTGACGCCCTCTTCTGT	1224	1316	yes
GATCGGGTCAGTCACCTTTG	11	11	yes
GATCGGGCTGCCTGGCGTGG	74	26	yes
GATCGGGAACAGAAAGGGCG	66	7	yes
GATCTGAAGTGACCTTATGG	16	12	yes
GATCGGCGTGTGGGCCAGGC	90	12	yes
GATCGGCGCTTTCAGACTAA	8	8	yes
GATCCCAGAAGGGCAAATTG	3	3	yes
GATCGCTGTGGCCGAAACTT	52	0	yes
GATCGCTGGGGAGTCGGGTC	23	3	yes
GATCCAAACTAAAGGCAGAG	15	8	yes
GATCACATAAAGCCATCCCT	21	5	yes
GATCACAGTGTACCCCACAC	3	2	yes
GATCACAGTCTGCATCCTAG	25	14	yes
GATCTTCAGTGGGTTTCTCG	19	19	yes
GATCGCTGAGCGGTGTGCAT	15	12	yes
GATCGCTCTCATTGCCCTTT	16	0	yes
GATCATTGGGGAACGGCAGC	42	4	yes
GATCGCTACCAAGCAGTTCT	226	26	yes
GATCGCGGACGGGCTGTGCC	31	6	yes
GATCCTCCCCGTATGATGAA	11	11	yes
GATCGCCTTCTCCACCAATT	125	5	yes
GATCATGTTTGGCAAGCGGC	21	4	yes
GATCGCCTGCGCACATTACC	30	7	yes
GATCGCCTCCTCCCTCTCTT	150	0	yes
GATCACAGACGACTGCTCCC	2	2	yes
GATCACACTTCTCTTAGGCA	1	1	yes
GATCTGGTGCTGCGCGGATG	77	76	yes
GATCTTCCCTCCGCCACTTC	10	8	yes
GATCCCTTCTCAGCCTCCAT	2	2	yes
GATCCCTTCCAGGTCAGCTC	44	7	yes
GATCGCCCTGTCCAACAAGC	9	1	yes
GATCATGGTAGGAAAGATGG	21	1	yes
GATCGCCATCGGCAGGACTG	7	1	yes
GATCGCCAGGCCTTTTCATT	6	5	yes
GATCATCTTTCTGAGGGCTG	33	11	yes
GATCATCTGGGAGGGGATGC	11	5	yes
GATCCTGGAGGCTTGTTGGC	2	2	yes
GATCCCTACTTGGGCTTGTC	3	1	yes
GATCGCATGCGCCCCATCTG	117	48	yes
GATCGCATGAAGAAACCATG	116	10	yes
GATCGCAGTAGCCAGCGCAG	418	56	yes
GATCGCAGAGTCCGCCAACT	62	12	yes
GATCATCGAGCCCACCAGTC	52	53	yes
GATCGACGAGAACTGGTATG	202	4	yes
GATCATCCAGGCTTAAAATT	11	2	yes
GATCCTTTTGCAGTCCAGAA	2	2	yes
GATCCCCTCTTATAGTCCAA	6	1	yes
GATCAGGTCTGCTTCAAGTA	36	9	yes
GATCACGGACGTGCAGCTCG	139	111	yes
GATCCTTTTCCACTCCCAGG	161	22	yes
GATCCTTTGCTCCTAGTGGA	134	2	yes
GATCCTTTCCTTGGACTCAC	49	4	yes
GATCCTTTCCATGCAAACTG	105	6	yes
GATCCTTGTTGTGCCTCTTC	31	9	yes
GATCCTTGTTCAATGCACGT	3	2	yes
GATCCTTGTGGCTGTGAAAA	2	2	yes
GATCCTTGTCCACCCCTCCC	95	25	yes
GATCCTTGTAAGAGCCAACT	3	2	yes
GATCCTTGGGGTAAGCAGAA	16	2	yes
GATCCTTGAGGTCACGTTGC	253	0	yes
GATCCTTCTTGTGGAACAAC	87	1	yes
GATCCTTCTCTGCTAGTTTA	13	10	yes
GATCAGCTCAGTTTGCAGAG	5	4	yes
GATCTGCTTCGGAATTGGTG	6	5	yes
GATCGACCATACAGTAGAAC	8	4	yes
GATCTCGTGATGGTGGCCTG	10	2	yes
GATCACCCTGCACCCCGTCA	25	5	yes
GATCCCAGATGACAGCCAGA	20	4	yes
GATCCCAGACTCACCCACGT	18	3	yes
GATCCTTCTACCCACATACT	5	7	yes
GATCCTTCCTGCGGGCGGTG	16	2	yes
GATCCTTCCAGGAAGAGGAA	23	19	yes
GATCCTTCAGTCCTCTTAGT	13	7	yes
GATCCTTCAGAATCTCTGTT	9	0	yes
GATCAGTTTGCCTTCATTCA	56	14	yes
GATCCTTACTTGGTGCAGGT	30	1	yes
GATCCTTACCCTGTCCCTGT	340	26	yes
GATCAGTGTGTCTGTCTATG	23	6	yes
GATCCTGTTCCGAGCAAGCT	112	25	yes
GATCCTGTTAGTGAGCAGGG	10	1	yes
GATCAGTGCCTGGCGCCAGA	456	27	yes
GATCCTGTGTGGGAGGCTTC	355	22	yes
GATCCTGTGTGCGTTGATGA	3	1	yes
GATCCTGTGGAAAGGATGCA	14	6	yes
GATCAGTCAGCCGCTGCCCG	112	4	yes
GATCCTGTCCCAGGGGCTAG	228	26	yes
GATCAGGTCTCTCCAACTCA	50	7	yes
GATCCTGTCCAAAGACATCC	12	5	yes
GATCCTGTCACTGGGGAGGC	107	4	yes
GATCCTGTAGCTGCCAGACA	29	39	yes
GATCCTGTAAAGGCAGGGCA	15	15	yes
GATCCTGGTTGGGGGCAAGG	150	33	yes
GATCAGGCTAATCTAGTTGT	1	1	yes
GATCCTGGTGTTTCCACATG	9	7	yes
GATCCTGGTGGTTCACCTCA	134	10	yes
GATCAGGCAGCAGAATCAGA	15	12	yes
GATCCTGGTGAATGAACCAT	61	11	yes
GATCCTGGTCCCCAGCACCT	120	0	yes
GATCCTGGTAGCTCACCAAG	108	44	yes
GATCCTGGTAATGCACTTTG	517	408	yes
GATCCTGGGTGCCTCTGATG	13	2	yes
GATCAGGACTTCTACTGGCA	23	4	yes
GATCCTGGGTCCCTCGTAAG	93	2	yes
GATCCTGGGTACTAAGGTCA	129	86	yes
GATCCTGGGGACCCAGAATG	71	10	yes
GATCCTGGGCTTCTTGCTAG	4	3	yes
GATCCTGGGAGCGAGGAAAC	13	5	yes
GATCCTGGGAACTATGTAGA	7	1	yes
GATCCACTTTGGCACAGAGG	9	9	yes
GATCCTGGCGCTGGCTGTCC	182	12	yes
GATCCTGGCAGTGGACCGCC	85	1	yes
GATCAGCTGGGTTTTCTACA	2	2	yes
GATCCACGCACATTCTCACC	18	0	yes
GATCCTGGCAACAGCTGTTT	70	0	yes
GATCAGCTGATGTGGGTGCT	1	1	yes
GATCCTGGAGTTTTCTACAG	85	10	yes
GATCCTGGAGGAACCTTCGC	384	15	yes
GATCAGCTCTGCCGTCTCTA	16	12	yes
GATCCTGGAGAAGCATGTTC	16	0	yes
GATCCTGGAGAACACTGGTT	111	5	yes
GATCCTGGACGAGGCCACCA	99	39	yes
GATCTGCATGTCTTCATTGA	31	6	yes
GATCACAGCTGATGATACAA	4	3	yes
GATCCTGGAAATGGACAAAG	84	5	yes
GATCCTGCTGACACGGTGCG	65	6	yes
GATCCTGCTCCGGCTCCTGC	5	4	yes
GATCCTGCTCCAGGAGATTG	184	1	yes
GATCCTGCTAAGCACTGAGG	113	4	yes
GATCCTGCGGGCTGAGGGCC	16	2	yes
GATCCTGCCCTGGGGTGAGG	102	22	yes
GATCCTGCCCTCCACACCCA	60	10	yes
GATCCTGCAGCGGTTCCTAC	54	10	yes
GATCGCCAAGTTCAAAGCTG	59	14	yes
GATCAAGGCGTTTGAGGAGC	6	6	yes
GATCCCAGGGGATGGCATCG	1	1	yes
GATCCATTCGCAACTTGGCT	22	2	yes
GATCCCAACAATGCAGCCAT	409	6	yes
GATCTGTGGCAAGAGTTTCA	41	4	yes
GATCTCTCCCCAGGGAAGGA	159	32	yes
GATCAAGGTGGGAGGGAAGA	106	61	yes
GATCAGAAGTTCAGGGTTAT	60	0	yes
GATCAGAAGTTCAAGGCCAT	9	7	yes
GATCAGAAGTGCCTCCTTGT	180	58	yes
GATCAGAAGTAGCCAAGTAG	9	2	yes
GATCAGAAGTACCAGAAACA	318	70	yes
GATCCTGCGGAGCCTCCCAG	6	1	yes
GATCAGAAGGAGATACTCTG	122	68	yes
GATCAGAAGGAAGAGAAACA	62	11	yes
GATCAGAAGCTGTGTGCGTT	106	16	yes
GATCAGAACTGGGTGCCAGC	28	2	yes
GATCAGAACTGGGTATCAGT	4	1	yes
GATCAGAACTGGCTGCAGAG	3	2	yes
GATCAGAACCTGAACAAAAT	7	5	yes
GATCAGAACCCAGCCGAGTG	84	17	yes
GATCAGAACCAAAGGCAGGG	9	7	yes
GATCAGAACTAGCTAGTGCC	3	2	yes
GATCAGAACAGGTGTCCCTT	11	9	yes
GATCAGAACAGACAATAGGT	24	19	yes
GATCAGAACAACAGACAGTG	122	3	yes
GATCAGAAATAAGTGCTACG	3	2	yes
GATCAGAAAGATGCAGTTCT	7	5	yes
GATCAGAAACTGTCCTCTGA	52	2	yes
GATCAGAAACAACTGTGTCT	106	16	yes
GATCAGAAAAGTCTCGACTA	21	16	yes
GATCACTTTGCCAAATAAAT	1	1	yes
GATCACTTTGAGGAAGCCAT	350	279	yes
GATCACTTTCTAGGTTCCTA	22	5	yes
GATCACTTGTTTGTGGTGAG	173	29	yes
GATCACTTGTCAGTGTTCAG	192	18	yes
GATCACTTGGGCCTCAGTTC	3	2	yes
GATCACTTGGGATGAGACTG	19	4	yes
GATCACTTGGCTTTTCTGGG	37	21	yes
GATCACTTGGCGGTGACTTT	112	0	yes
GATCACTTGATTTCTTGTGC	15	3	yes
GATCACTTCTGAAGAGCTTC	77	9	yes
GATCACTTCGGCCTGTACAC	119	54	yes
GATCACTTCGCCCTTTTTTG	170	2	yes
GATCACTTCCTATAGACCCA	2	3	yes
GATCACTTCCGTGCCTCCCT	129	12	yes
GATCACTTCCCAGGGCCTGT	98	26	yes
GATCACTTAGTGGGGGGTTT	48	5	yes
GATCACTTACTGCCTAATGC	67	5	yes
GATCACTGTGTTGGACACTC	414	33	yes
GATCACTGTGTACACATTGG	25	13	yes
GATCACTGTCTCAGGCCTTT	89	3	yes
GATCACTGTCCCCCTGGGAA	29	13	yes
GATCACTGTATGTTTGAGAG	6	1	yes
GATCGACCACATCCTGGATG	80	7	yes
GATCCATGACACAGGCTGTC	23	6	yes
GATCACTGTACTCTTCTTTT	6	3	yes
GATCACTGGTGTTTCCCATT	71	21	yes
GATCACTGGTGTGTGCCAGT	38	2	yes
GATCACTGGTGGAGAAAAGA	6	6	yes
GATCACTGGTCTGTGACCTA	13	7	yes
GATCACTGGGTGTGTTTCAG	81	65	yes
GATCACTGGGGGCTCTTGTG	58	10	yes
GATCACTGGGAACAAACGGC	518	9	yes
GATCACTGGCTGCCGCTGGA	2	2	yes
GATCACTGGAAACGATTGCT	72	1	yes
GATCACTGCTCAAGCCTGGG	73	7	yes
GATCACTGCTAAGTTTCAGC	35	7	yes
GATCACTGCGAAGTTTCGTT	67	10	yes
GATCACTGCCTTTCCCCCTC	42	11	yes
GATCACTGCCGAGAAAATCA	145	2	yes
GATCACTGCAGGGGGTGCCA	458	28	yes
GATCACTGCAGGCGCAGCGG	632	23	yes
GATCACTGCAACCTTGTGCT	58	6	yes
GATCACTGATTCAGAGCTCA	141	3	yes
GATCACTGATGGCCAGAATG	41	3	yes
GATCACTGAGGAGACATTTT	3	3	yes
GATCACTGACCTTGGAGCTT	220	4	yes
GATCACTGACCTCTGGAGTC	87	3	yes
GATCACTGAATATTGCCCCT	22	3	yes
GATCACTCTGGCCGCTCTTC	242	76	yes
GATCACTCTGGCCAAGTAAG	79	4	yes
GATCACTCTGGAGTTCAGCG	6829	64	yes
GATCACTCTGAATGGTTGAA	8	1	yes
GATCACTCTCTGCATCGCTG	41	14	yes
GATCACTCTCATACGATACG	6	2	yes
GATCACTCTAGTCCCCACCC	22	22	yes
GATCACTCGGAAATTCAGGC	21	1	yes
GATCACTCCTTTTGAGGAAA	102	9	yes
GATCACTCCTGTTATGTGAC	13	0	yes
GATCACTCCGTGCACCTGCT	20	1	yes
GATCACTCCCTGCCTGAGCC	308	32	yes
GATCACTCCAAGTTGACATT	129	8	yes
GATCACTCAGTGAACAATCC	8	4	yes
GATCACTCAGCAGCCAGGAC	167	4	yes
GATCACTATGTCCAGGCTTC	15	3	yes
GATCACTAGTGAGAGCTGAA	13	13	yes
GATCACTAGTGACTGTTGGG	90	11	yes
GATCACTAGGTCATTTTGTT	21	0	yes
GATCACTAGGGGCTTTCAGC	8	8	yes
GATCACTAGCTTCGAGGAGG	119	24	yes
GATCACTACCCATCCTTAGC	126	3	yes
GATCACTACAAACCAAAGCA	4	2	yes
GATCACTAATGTGGAGCAAG	13	7	yes
GATCACTAACATTCCCCGTA	6	3	yes
GATCACTAACAGTTTGCATA	42	4	yes
GATCACGGTTTTCTCTGTAA	564	19	yes
GATCACGGTTCAGGTTTTGC	3	1	yes
GATCACGGTTCAGATTCGTT	42	1	yes
GATCACGGTGAACCCCCAGT	451	28	yes
GATCACGGTCCCGTGACCGC	76	19	yes
GATCACGGTATTTGACCGTG	29	2	yes
GATCACGGGAGAAGTACAAG	30	3	yes
GATCACGGCTTCTCAGCCGA	2	2	yes
GATCACGGCAGTGGATTGGG	342	14	yes
GATCACGCGTCCAGATGTGC	122	13	yes
GATCTGTTACAGAATTCGCC	9	7	yes
GATCACGAGAGAAGCCAAAA	39	4	yes
GATCACGACCGATACAGTGA	6	5	yes
GATCACGAAGGAGGAGCTGG	12	1	yes
GATCACGAAGATGTTGGGCG	42	0	yes
GATCACCTTTGTCTGATAGC	92	1	yes
GATCACCTTGCTGGCATCAG	99	22	yes
GATCACCTTGAGCCTCTTCT	20	0	yes
GATCACCTTCCTGTCTCATC	118	6	yes
GATCACCTGTTTCGCTGTGG	2420	93	yes
GATCACCTGTGCCAAAGACA	47	2	yes
GATCACCTGTAAATGGCCAC	5	4	yes
GATCACCTGGGCCAGTCCAG	36	35	yes
GATCACCTGGGATTTCTCAG	8	8	yes
GATCACCTGGGACTCTAAGC	51	7	yes
GATCACCTGCTCTTTTCCTC	48	7	yes
GATCACCTGAAAGACCTGGG	60	4	yes
GATCACCTCTTAGGGATGGT	327	31	yes
GATCACCTCTGGGCCTAATG	81	18	yes
GATCACCTCTCATCCATGTG	22	7	yes
GATCACCTCGGATGATGGCT	28	3	yes
GATCACCTCATTCCTCGACT	41	10	yes
GATCACCTCAACGTGGGTGT	335	36	yes
GATCACCTCAAACTAATTTG	35	2	yes
GATCACCTAGGTGAGCTGGG	23	1	yes
GATCACCTAGGAGAGCCACT	69	5	yes
GATCACCTAAGGGGTCTGGG	30	10	yes
GATCACCTAACTGAGCCAAA	15	14	yes
GATCACCGTTTCAAGGCCCA	128	2	yes
GATCACCGTGTTTTCGTGGT	51	2	yes
GATCACCGGGGATGAATTCT	15	1	yes
GATCACCGGGAGGGAGACAG	93	9	yes
GATCACCGCTCACCTTTCCA	25	2	yes
GATCACCGACTCCCTTACTA	39	5	yes
GATCACCGACCGCATCGAGA	2628	102	yes
GATCACCGAACTAGACACAG	79	9	yes
GATCACCCTTGAATGTCTAC	2	2	yes
GATCACCCTGAATACTCCTA	7	7	yes
GATCACCCTCAGGTGCAGGT	289	5	yes
GATCACCCCTCTGCCTTTGT	88	13	yes
GATCACCCCCTTCCCTCTGT	147	25	yes
GATCACCCCCAATTGTATGG	2911	254	yes
GATCACCCCCAATTGTATGC	23	24	yes
GATCACCCCACAGTGAGGCG	87	3	yes
GATCACCCCAAAGCCTTCAA	7	7	yes
GATCACCCATTCTTGTGATA	4	3	yes
GATCACCCATCATTCTGAGG	153	19	yes
GATCACCCAGAAGTGGCTCT	734	9	yes
GATCACCCACATTGGGTGAG	41	6	yes
GATCACCATTTCCGACTGTG	3586	253	yes
GATCACCATTCCGGTTACTT	127	2	yes
GATCACCATCTAGTGAGTCG	337	18	yes
GATCACCAGTGTTTAGTCCA	18	2	yes
GATCACCAGTGGGAAAGCAG	46	9	yes
GATCACCAGGATTGGTGCAC	83	6	yes
GATCACCAGGAAGAAAGAGT	3	3	yes
GATCACCAGGAACTTCTATG	28	8	yes
GATCACCAGCCTGAAGCTGA	74	1	yes
GATCACCAGCCCCTGGGGAT	29	11	yes
GATCACCAGCAAACAGCTTT	499	17	yes
GATCACCAGAGGAGATAGGA	70	0	yes
GATCACCACCCCTGTTAAGC	617	47	yes
GATCACCACCAGGACGCTGA	434	56	yes
GATCACCAATGTTGTTTTTG	10	1	yes
GATCACCAAGGTTGATGCAC	424	4	yes
GATCTATGCCAACTGCCACA	1	1	yes
GATCCGGGCTCTAGACAGCG	36	8	yes
GATCACCAACTCCTTCCCCA	35	3	yes
GATCACCAACCTGCTATCAT	2	2	yes
GATCACCAACAGTGCTTGCT	9	9	yes
GATCACCAACAGAAGCAAAT	6	3	yes
GATCACCAACACCAGGCCGC	2	2	yes
GATCACCAAAGGGGACTTTG	3	1	yes
GATCTGGGGCAGGGTGTCTG	2	3	yes
GATCACATTTGCTTTGTGTT	5	4	yes
GATCACATTCTGGGCTTCCA	1	1	yes
GATCACATGTAGTGGGGAGG	44	6	yes
GATCACATGAACGTCTCCTG	51	34	yes
GATCACATCTATGAGAAGTT	274	16	yes
GATCACATCGAGGTGTCGGA	2	2	yes
GATCAGGGCTTTGGAGTACA	707	33	yes
GATCACATCCAAAAAGTCAT	18	4	yes
GATCGCTTGTTGGCAATCGG	4	3	yes
GATCTGAAGAGGGGTGAGCT	66	20	yes
GATCACATCAAAGGATGATG	12	1	yes
GATCACATACGCAGGAGTGG	54	6	yes
GATCACAGTTGCTACTGCCT	13	4	yes
GATCACAGTTCCAGGAACAG	420	26	yes
GATCACAGTGCGTGCCTGGC	230	8	yes
GATCACCACTGTCCCTGGAT	2	0	yes
GATCACAGTGAACGGAGATA	32	10	yes
GATCACAGTCCTTCCTCTGG	810	39	yes
GATCACAGTATTGTCTCAGA	86	18	yes
GATCACAGTACAATAGCTCA	11	5	yes
GATCACAGGTGTGCATACCA	4	4	yes
GATCACAGGGATGCGGCGTC	167	22	yes
GATCACAGGCAGTCCAGGGG	119	6	yes
GATCACAGGACTCTTTCCCT	1	1	yes
GATCACAGGACAGCTGAACC	109	21	yes
GATCACAGCCTGGATTTTTC	118	19	yes
GATCACAGCTGAGGTGTGGG	5	4	yes
GATCACAGCTCAGTTCCTAT	92	8	yes
GATCACAGCGTTCGTGCCCA	115	3	yes
GATCACAGCGGAGTTAGCTT	30	1	yes
GATCCGCGTCTGGTTCTGCA	22	5	yes
GATCGACATCAACGGGGATG	183	25	yes
GATCCTCAGAAGGGAAACGT	4	2	yes
GATCTCAACTGAAGCTCTTT	2	3	yes
GATCTTGTTGTGAGTGTTTG	18	18	yes
GATCTGGAAGTGTGGGAACG	262	23	yes
GATCCCGTTGAAACTGCTGC	209	6	yes
GATCGTCGCATGGCTCTCCC	9	7	yes
GATCTGAGTTGAGCCTGGTT	20	26	yes
GATCTAACCATGAGCCTGTG	25	14	yes
GATCTAAGTTCAGTTCCCAG	14	11	yes
GATCCCCTTCTACCTACTCC	128	11	yes
GATCCCTCGGTCAGCACCGT	18	3	yes
GATCTGAAATGAGCAAGTTT	5	4	yes
GATCTACACATGTGGGAAGC	5	4	yes
GATCCTCAGGACCCACGTGG	15	3	yes
GATCTGTTGAGGTCAAGGCC	4	3	yes
GATCCTGTGTCACAGCTGCC	4	4	yes
GATCCTTGCTGGGGGTAATT	2	2	yes
GATCACCTGTCCACTGCCTC	15	12	yes
GATCCATCTGTGTAGTTTCT	88	16	yes
GATCCCTCTGATGTTGAGTG	2	2	yes
GATCCCTCTCCTCCATGATT	2	2	yes
GATCCCGTCTCTCCTATGTT	6	3	yes
GATCCGGGCTTCTTTCCCAA	16531	953	yes
GATCGACAGATTGACCAGTT	18	2	yes
GATCTCTGGGTATCAAGGAA	2	2	yes
GATCCCATGCGGTTCTATCC	12	9	yes
GATCCAGTCTCATCTCAGCT	99	2	yes
GATCCAGTTTTGTTTGGACC	8	4	yes
GATCAAAGTATTGGAAGAGG	19	1	yes
GATCAAAGGGTGAAGTCGGT	19	15	yes
GATCTGCCTCTCTGCCTCCC	6	2	yes
GATCTGACGGTGCCCTTGGC	1345	636	yes
GATCAAAAGGTCAAGGTCGT	23	8	yes
GATCCTGCAACCCATTTCCA	126	11	yes
GATCCTGATGCAAGGCTGGC	12	9	yes
GATCCTGAGTGAGTGTGAGG	148	1	yes
GATCAGCAACTACAACTTTT	19	3	yes
GATCCTGAGTCAGAGAGCTC	4	4	yes
GATCCTGAGGCCTGTGAGAA	60	14	yes
GATCCTGAGGAGGGGTTTGA	42	4	yes
GATCCTGAGGACATCGACCT	5	4	yes
GATCCTGAGGACAGGAGAGG	11	0	yes
GATCCTGAGATGGCTCTGAG	6	3	yes
GATCCTGAGAGTGTCACTGT	36	0	yes
GATCCTGAGACACAAAAGGT	61	2	yes
GATCCTGAGAAAATCAGGGC	23	1	yes
GATCCTGACTTCTAGCTGTG	2	2	yes
GATCCTGACGACGAGACCTT	37	5	yes
GATCCTGACCGAGCGTGGCT	28	5	yes
GATCGAGCTGCGCTGTGGCC	6	5	yes
GATCTAACAGCTGAGTCCAG	17	13	yes
GATCTAAACCCTTGGCATTT	15	5	yes
GATCGTTTCCCTTGCATGCC	91	45	yes
GATCTTTCCACCAAGCCATA	32	3	yes
GATCCAGGCTCGGGAGTGCC	5	4	yes
GATCCTGACCATCACTATAC	143	2	yes
GATCCTGACCAGGGGGAGTC	295	4	yes
GATCTCTTTATGTCTCTCAG	4	3	yes
GATCCTGAATTGCTGGAGAG	52	6	yes
GATCCTGAATTCACCCCCAA	57	27	yes
GATCCTGAAGTCTGCAGACC	439	3	yes
GATCCCGGGGCTGTAACTGT	71	14	yes
GATCCTGAAGCCCCTCGCTT	99	8	yes
GATCCTGAAGATGTGGACAC	112	13	yes
GATCCTGAAGATGAGGTTCC	4	3	yes
GATCCTGAACCCACCCCCGT	127	19	yes
GATCCTGAACACTCCTGGGG	14	11	yes
GATCCTGAAACGACAGTGGT	154	3	yes
GATCCTGAAAACGCCACCCC	64	28	yes
GATCCTCTTGTGGCCCAGTG	33	34	yes
GATCCTCTTGTCTGCTTCGC	482	75	yes
GATCCAGGACCTGGTAGCAA	152	14	yes
GATCCTCTTCTGGAGTGTCT	3	3	yes
GATCCAGGAAGTTGGTGAAC	430	40	yes
GATCCTCTTCTCCGCGTGCC	118	12	yes
GATCCTCTTCCACGAGACAC	5720	42	yes
GATCCTCTGGCACGCCTGGC	12	12	yes
GATCCTCTGCAGAGGAGTAT	30	1	yes
GATCACTTTCCTCCCACGTG	44	4	yes
GATCATCTAGGCCAGAGTCC	19	15	yes
GATCCTCTGACATCAGAAGC	210	47	yes
GATCCTCTGAAAAACCAAGA	48	32	yes
GATCCTCTCCAAGGAGGAGC	352	37	yes
GATCCTCTCAGAGTCCTGCA	303	20	yes
GATCACTGTGTCTCCTGACA	4	3	yes
GATCACTGTGGCCCCACCAA	50	17	yes
GATCCTCTACTACTGCAGAC	46	2	yes
GATCACTGGGGAGAAGTTAT	17	13	yes
GATCCTCGGGGTGCCAGCCA	286	19	yes
GATCCTCGGAGCATGAAGGC	15	15	yes
GATCACTGAGGATGGCTGAC	66	8	yes
GATCCCAAACATTTGTCGGA	1	1	yes
GATCCTTCCTAGAGTCACTC	15	1	yes
GATCCAGCAGCGCAGGCAGG	28	8	yes
GATCACGTTCTGCTTGGAAG	46	3	yes
GATCACGTGACCACAGCCCC	207	8	yes
GATCCTCCTCCAAGTCTGAC	171	35	yes
GATCCTCCTACCTGTTTCTA	9	5	yes
GATCCTCCGACTGGAGAAGA	7	7	yes
GATCCTCCCTCAGGACTACG	78	33	yes
GATCCTCCCGTATGCCAACC	203	13	yes
GATCCTCCCCTGGCCTCAGT	103	26	yes
GATCCTCCCCTGCCCTACAC	383	113	yes
GATCCTCCCCGCTCGCTCAC	312	10	yes
GATCCTCCCCCTCTGTCTTT	131	9	yes
GATCCTCCCAGACCCTCTGA	372	88	yes
GATCAAACTGTGCAAATAGT	6	1	yes
GATCCTCCAGTCTGGTAGTG	22	11	yes
GATCACCCGACGCAAGTGGG	10	1	yes
GATCCTCCAGCAGCCTTTTG	48	49	yes
GATCCATGCTTCAGCCCAGC	6	6	yes
GATCCTCCACTCATTGAGAA	3	2	yes
GATCCTCCAAGGAAGGCAAA	29	23	yes
GATCCTCATCATCGCGGGTA	28	28	yes
GATCCTCATCAGTGTGGCCA	255	17	yes
GATCCTCAGGGACACCACCT	8	8	yes
GATCCTCAGGAGTCAGTATT	204	10	yes
GATCCTCAGCCTCCCAGAGC	195	12	yes
GATCCTCACTGAGAAGGAAC	15	4	yes
GATCCTCACTGACAGATGGG	37	5	yes
GATCCTCACACCCTGTTCCC	20	2	yes
GATCCTCAAGTCGGTGGTGG	13	2	yes
GATCCTCAACAGCCACTGCT	40	6	yes
GATCACAGTCAATGACCTAC	7	1	yes
GATCCTATCTCGCCCAGTGA	169	26	yes
GATCACAGCAACTATGGCTT	3	2	yes
GATCCTAGTGCAGGAGGGGG	1	1	yes
GATCCTAGTCCTTGCCCCGT	236	21	yes
GATCACACTTACCAGTCAGC	24	15	yes
GATCACACTGTCTTGGAATT	50	15	yes
GATCCTAGCCAGATTACTAG	4	3	yes
GATCCTAGCAGCGGCGGTGG	47	2	yes
GATCCTAGAGCACTTGAGGA	16	4	yes
GATCCTAGAGACAGGCCATC	101	18	yes
GATCCTAGACTCTCCTTGTT	127	1	yes
GATCCTAGAATAGCG