#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCATAGTGGACGTTGTTA	72	26	yes
GATCACCTCACATTCTCATG	4	6	yes
GATCATAGGACCACTTTTCA	7	7	yes
GATCAAGCAGCAAAAAAAAA	60	37	yes
GATCATAAACATGTCAAAGG	8	8	yes
GATCAAGCACTAGTAAAGAA	39	38	yes
GATCAAGCACATCTGTGCTG	1	1	yes
GATCATAAACAGCTGTATTG	8	6	yes
GATCAGTGTGTGCCAAGGAG	382	14	yes
GATCAGTCAGTGACAACCAA	38	5	yes
GATCAAGAGGAAGCACAATA	38	18	yes
GATCAAGAGAAAGAAGTGGG	16	13	yes
GATCGTACACGCTCAGTTTA	2	1	yes
GATCAGTAGAGCTTGGACCC	224	19	yes
GATCAGTACACGGTGTATGT	8	5	yes
GATCAGGGCAATGGTCACTG	155	12	yes
GATCAAGACGCAGGTCGAGG	8	7	yes
GATCAGGCTGTTGTAAAATC	5	4	yes
GATCAGGCTCTTTGTTTGTG	92	13	yes
GATCTGGCCAACGGCAACAT	17	13	yes
GATCTGGCAGTCATAGCTTG	1463	69	yes
GATCTGGCAACTGTGCGGGG	6	5	yes
GATCTGGCAAAAACTACGGG	69	59	yes
GATCTGGATGTGTGATAATC	19	12	yes
GATCTGGAGTTGGCTTGTGC	1	1	yes
GATCTGGAGTCCGCTTACAA	16	16	yes
GATCTGGAGAAGAATGGTCG	7	7	yes
GATCTGGACTTTGCTCAACC	59	3	yes
GATCTGGACTGGTGTTTCTT	129	18	yes
GATCTGGACTCACCTGGGAG	180	6	yes
GATCTGGACTCAAGGGGCAT	37	23	yes
GATCTGGACGGAAGTGGAGT	4	4	yes
GATCTGGACGATTCTGAGCC	81	6	yes
GATCCTGTGTTTGAATGACA	47	9	yes
GATCAGGCCCAGTACTGCAT	79	1	yes
GATCAGGCCCACTCCAGGAG	1159	79	yes
GATCAGGAAGACACGGACTC	8	5	yes
GATCAGGAACGCTCTGGATG	7	7	yes
GATCAGCCTACGCTCACATT	72	11	yes
GATCAAGAATGGACCAAGAT	111	79	yes
GATCAGACTGTTGCTTTCGC	181	43	yes
GATCAGCACCAAGTGACTTG	17	25	yes
GATCAGAGCTGCTGACGCTG	26	4	yes
GATCAACTGCTTAGTGCGAC	15	13	yes
GATCAACTCCTTGAGACACT	14	14	yes
GATCTGGACCTAATAAAACA	31	31	yes
GATCTGGACCAGGCTTGGAA	8	3	yes
GATCTGCTTTTTGAAATGAA	175	57	yes
GATCTGCTTTGTGCTTGGCT	251	10	yes
GATCTGCTTTCTCAGGACTC	63	19	yes
GATCTGCTTTCCCTTTGTAA	29	9	yes
GATCTGCTTTCCATCGTGTC	5	3	yes
GATCTGCTTGTGTTGTGTTG	34	24	yes
GATCTGCTTGCCCCAAACAA	36	10	yes
GATCTCTACCACCCAGGTAC	13	22	yes
GATCTCGGACGCTCAGTGGG	49	31	yes
GATCTCGCTTTCAGTCTGCT	45	16	yes
GATCTCGCTGGTTCGCACCT	75	47	yes
GATCTCGATTCTACAGTGGT	34	22	yes
GATCAGAAGTTCAAGCTCAT	21	21	yes
GATCAGAACCTTGCCGAAAC	9	5	yes
GATCAACGTGATGGACGCAC	14	4	yes
GATCTCCTTCCAGGCCCAGG	5	5	yes
GATCTCCTGGCCACTGTGGT	11	11	yes
GATCACTGTTTGTGCCTCTG	225	45	yes
GATCACTGTGTCCCAGGCTG	63	19	yes
GATCACAATGAAGTCCTGGG	63	24	yes
GATCACTGACATCTATACCC	62	10	yes
GATCAGAATGGCGGAGGCGG	32	32	yes
GATCACTCTTCCCGCTGCTG	31	14	yes
GATCACTCTGGTCGTGTGGG	22	8	yes
GATCAACCGCATATGGAAAC	6	4	yes
GATCACGCTGCTCCGACAGG	1	1	yes
GATCACCTTGTGAGGCCTAT	30	6	yes
GATCACCTGTGGAGTTGTCA	30	10	yes
GATCACCTGACTCCTAACCG	3	4	yes
GATCTCCTCTCTTCCCACGG	26	19	yes
GATCTCCTCTCCAGGGAGCT	53	37	yes
GATCTCCCTGTGCCGGTGCC	70	11	yes
GATCACCATATCAAGTTTTC	58	5	yes
GATCACCAGAAAGTTTGTTA	4	3	yes
GATCAATTGGCACTAGACCC	2	4	yes
GATCACATGGGTCGAGGGTT	91	5	yes
GATCACATACTTACTGAAAT	11	8	yes
GATCACAGCCGAACCTGGGT	5	4	yes
GATCAATGATGTCTATGGCA	3	3	yes
GATCACAGAGTGGGAATCTC	96	6	yes
GATCTTGAAGAAGATGAGGC	26	18	yes
GATCAACACTCCCCACGATG	2	4	yes
GATCACACTGTCTGAGGCGT	33	7	yes
GATCACACGCAGAATGAAGT	34	7	yes
GATCACACCAGAGTCCAGGT	10	6	yes
GATCTGTAGAAGAGGACCTG	19	19	yes
GATCTGTACTTTGCTCTCGA	3	2	yes
GATCTCCAGGACTTGTGTGG	6	6	yes
GATCCCTTCTTGAACTCCGC	1577	83	yes
GATCAAGTGCTCAATCGAAG	5	4	yes
GATCTCAGTCGGATGCACCC	20	13	yes
GATCAAGGCAGTGGGCTGAT	2	2	yes
GATCAAGGACATCCATGTGC	14	9	yes
GATCAAATCCGACGACGAGG	51	6	yes
GATCAAGAGCAGTGCTGCTC	50	8	yes
GATCAACGTCTGAAAACAAT	4	4	yes
GATCAACTTGGCTATGATAA	33	23	yes
GATCAAATATGTGCCCTATG	14	14	yes
GATCAAAGTTCCCAGAAATG	2	2	yes
GATCTCAGCACTGTGTGTCA	5	7	yes
GATCGCTGCCAACATCCAGG	1	1	yes
GATCAAAGCCAAAAAAAAAA	4	4	yes
GATCAAAGAAGATGTCCCAC	20	7	yes
GATCAAACCGCAAAAAAAAA	2	2	yes
GATCTCACGATGAGCTATGA	92	32	yes
GATCAAACCCAGGGCTTTGT	35	11	yes
GATCATATACAGACACATAA	2	1	yes
GATCAAAACACGCGAGTCTG	6	5	yes
GATCACTTTATTTGCTAGGG	577	70	yes
GATCAAAGGAAATGGAGCCA	101	63	yes
GATCATCCAGACATTAACTG	3	3	yes
GATCTCACTGAGTAAACACA	6	5	yes
GATCTCACTATGTATCCCTA	17	17	yes
GATCATGCAACAAAAGCAGA	43	38	yes
GATCTCAAGTTGAACCGACT	95	70	yes
GATCTTTTTGTTCTGTTTTG	8	10	yes
GATCAAAGACGGTCCCCAGA	5	9	yes
GATCGAGGATGTGAGGAAGT	2	2	yes
GATCAAAGAAGGCTGTTGAC	5	5	yes
GATCTTTTTCTCCATCTCTT	196	24	yes
GATCAGAAATAAATGCGTAG	1	1	yes
GATCTTTTGGAACTGGAGTT	9	9	yes
GATCAAACGTGGCTGAGCGC	559	95	yes
GATCAAACGTGGCTGAGCGA	2	4	yes
GATCTCAATAAATGTCAGAA	1	1	yes
GATCAAACGCCCTGGCAGAA	7	9	yes
GATCATCTTGTGAAAACCCA	1123	65	yes
GATCCACCTGAGAGGGATGG	17	11	yes
GATCAAACCTGAGGGCACAT	26	9	yes
GATCTTTTCCACCTTCAGAG	62	9	yes
GATCAAACCCGTGGAAGAGG	11	10	yes
GATCTTTTCATTGATTAGCT	1	1	yes
GATCAAACAGGCTGTCAAGA	26	17	yes
GATCTTTTACTTCGTGGCTG	43	11	yes
GATCAAACACCTACTTCCAT	1	1	yes
GATCACATTGGTTTCTCAGC	2	1	yes
GATCTTTGTGGTGTGGGCCA	26	34	yes
GATCAAAACCCATCAACACC	143	26	yes
GATCAAAACCAGAGATTCCA	8	5	yes
GATCTTTGTCCAGTTCTGCA	2	2	yes
GATCTTTGTATGGCGGCTGT	2235	397	yes
GATCTTTGTAAGTTCAAGGC	10	10	yes
GATCGTGACCCCAAGGACTG	5	5	yes
GATCCAAGCCCGGGGCCCGC	16	29	yes
GATCCTTTCTTAGAGAGTCC	7	5	yes
GATCAAAGGTACGGGCGCTC	1	1	yes
GATCTTTCTGGCAAGGAAAC	2873	111	yes
GATCAGTTTGCAGTGGGATT	5	3	yes
GATCATCCAGAACACAGCCT	154	50	yes
GATCCAGAAACACAAAAAGG	22	17	yes
GATCCTGATGCTGCCACGGA	4	6	yes
GATCTGCGCTTCCAGAGTGC	2990	142	yes
GATCCACTCAGCCGTGGTTT	12	2	yes
GATCCTGAGCTTTGACAAGA	512	376	yes
GATCCTGAGCCAGATGTCAT	42	12	yes
GATCCTGAGATGCAGCTCAT	5	6	yes
GATCCTGAGAGCCTCATCCT	13	10	yes
GATCCTGAGAGAAAACAGCA	12	8	yes
GATCCTGACTTTGCCAGCTG	37	8	yes
GATCCTGACTCTGACACTAC	102	22	yes
GATCCTGACCTGGGCTTCCT	115	12	yes
GATCCTGACCACATGAACAA	421	105	yes
GATCCTGACATAAACCCTTG	9	7	yes
GATCCTGACAGTGCACCTAA	94	24	yes
GATCCTGACAGAGCCTTGGT	236	23	yes
GATCCTGAATTGGAGAAAAA	24	17	yes
GATCCTGAATGTGGAAAAGA	3	4	yes
GATCCTGAATGAGCTGTACC	28	14	yes
GATCCTGAATGACGTTCAGG	407	90	yes
GATCCTGAAGTGGCCTCAGC	9	8	yes
GATCCTGAAGTAGACAAAAA	75	56	yes
GATCCTGAAGGTCATCCGCA	60	8	yes
GATCCGTGGCAAAGGGAACC	2	3	yes
GATCCGCATCCTCAACCCAT	31	22	yes
GATCCGCACCGGGTGGGGAA	9	7	yes
GATCCGATTTCTGTGTCTGA	9	6	yes
GATCTGCGTATGGCGGCCAA	21	37	yes
GATCCTGAAGAACTTTGTCA	66	7	yes
GATCCTGAAAGCCAAGTTAG	128	59	yes
GATCCTGAAAATTCTTTGCA	15	22	yes
GATCCTCTTTGCCAACCCCA	112	37	yes
GATCCTCTTTGCACAGAAGA	45	38	yes
GATCCTCTTTCACGCTTCTT	67	12	yes
GATCCTCTTGTTCCACGATG	13	6	yes
GATCCTCTTGTCCACTCCAC	112	20	yes
GATCCTCTTGCTGCAGCTTC	80	9	yes
GATCCTCTTGCGGGACAGTC	48	14	yes
GATCCTCTTGATTCCTTCTG	26	18	yes
GATCCTCTTGATGCAGAGAG	156	42	yes
GATCCTCTTCTTCCTCGTGA	16	3	yes
GATCCTCTTCTTCAGCACAC	602	120	yes
GATCCTCTTCTGCTGTTCTG	8	7	yes
GATCCTCTTCCTGCTCCAGC	65	12	yes
GATCCTCTTCCCATCCATCC	14	12	yes
GATCCTCTTCATCTTGGGCA	515	65	yes
GATCCTCTGTTGGGGCCTCG	43	32	yes
GATCCTCTGTGTCCTTATTT	25	5	yes
GATCCTCTGTGGACTCATCT	23	16	yes
GATCCTCTGTGCCTCACTCC	178	15	yes
GATCCTCTGTATAATCTGGT	9	7	yes
GATCCTCTGCAAGAGCAACA	101	26	yes
GATCCTCTGAGGCAGTATTG	478	48	yes
GATCCACCCCTTAAGAACCA	34	27	yes
GATCCAGCAAGACCCTGAGC	22	12	yes
GATCCGAGAGTGACAAATCC	11	7	yes
GATCAAGAAATGTCCTCTGT	3	2	yes
GATCAACTTCCGCAAAAGCT	2	2	yes
GATCCACATGGTTGCCTGCT	153	10	yes
GATCCTCTGAATGTTTTCCC	193	17	yes
GATCCTCTCTTGTGCTACCT	33	11	yes
GATCCTCTCTGAACCTCCTG	366	30	yes
GATCCTCTCTCGGTGTGGTT	120	17	yes
GATCCTCTCCTTCTGACCTC	36	10	yes
GATCCTCTCATTCAGTCTTC	2	3	yes
GATCCCAAATGGCCCATGCA	191	178	yes
GATCCTCTAGGGGTTATGGG	165	12	yes
GATCCTCGTGCCTGTCTCCC	335	76	yes
GATCCTCGGGGTTCAGCCTC	1	1	yes
GATCCTCGGGCAAGCCAAGA	639	447	yes
GATCCTCGGGATGCTGGCTT	4	3	yes
GATCCTCGGGAGACCACTGG	59	45	yes
GATCCTCGGGAATTTTTACC	107	13	yes
GATCCTCGGAGGCTACCGAG	14	11	yes
GATCCTCGCAGCTTCTATGA	235	164	yes
GATCCTCGACAGGAAGCCAC	14	2	yes
GATCCTCCTTTTCTTGGCGG	16	3	yes
GATCCTCCTTGTCAAGTACA	2085	300	yes
GATCCTCCTGTGTCTTCCTC	58	19	yes
GATCCTCCTGTGAAGTGCCA	2	3	yes
GATCCTCCTGCGTGCTGACA	134	24	yes
GATCCGCCTGCTTCTGCCTC	4	6	yes
GATCCCTTGGAACTAGATTT	14	9	yes
GATCCTCCTGCCCCTCCAAT	11	7	yes
GATCCTCCTGCCCCGACAAG	4	5	yes
GATCCTCCTGAGTGCTGGGA	19	3	yes
GATCCTCCTCAGACTTGTCC	40	5	yes
GATCCTCCGTGAGTATGCCT	68	17	yes
GATCCTCCCCTTTACGGACA	212	20	yes
GATCCTCCCCCTCTCCCACC	4	5	yes
GATCCTCCCCAGGGATGGGG	110	25	yes
GATCATCTGTTAGAGACAAT	10	10	yes
GATCCTCCCACAGGGACACT	104	21	yes
GATCCTCCCAAGTGAATGAC	201	31	yes
GATCCTCCAGTCAGTCTATT	74	6	yes
GATCCTCCAGGACAAGGGGT	124	32	yes
GATCCTCCAGCAGAGTGGAC	4	6	yes
GATCGCCCTCAAGGGCGGCA	16	16	yes
GATCCTCATCTTCATTCCTT	26	3	yes
GATCCTCATATGAGGACCAT	83	3	yes
GATCCTCAGTTACTCGCTGC	8	10	yes
GATCCTCAGTGGGTAAGTGC	34	24	yes
GATCCTCAGTGCTACTTGCG	10	4	yes
GATCCTCAGGGTCTGCCCTT	15	11	yes
GATCCTCAGGAGTTGCAATG	1353	30	yes
GATCCTCAGGAAACAGTCTC	111	14	yes
GATCCTCAGCTGGCTGGAGC	61	5	yes
GATCCTCAGCCCTAACCCAG	1	1	yes
GATCCTCAGATTAGATGTTT	128	12	yes
GATCCTCACCATCCACGTTT	55	10	yes
GATCCTCACCAGCCGCGGGC	980	38	yes
GATCCTCACCAATATGGTGA	2	3	yes
GATCCTCAAGGAAGACTTGC	5	7	yes
GATCCTCAAGCGCCTCAACC	68	8	yes
GATCCCTGTGTTGGGCAAAG	5	6	yes
GATCCAGTGCCTGTGTAGAA	117	11	yes
GATCCAATGGTATTTTGAAA	8	5	yes
GATCCCTGCTCTGCAATGAG	60	6	yes
GATCCAATCAATCTCCCCGA	36	30	yes
GATCCTCAACTCCTCCAAGG	37	2	yes
GATCCTCAACATCCGCCTGC	40	30	yes
GATCCTCAACAAGATGCTAT	225	33	yes
GATCCTCAAATCAGGCAACC	86	22	yes
GATCCTCAAATAAACAGGAC	5	7	yes
GATCCTCAAACAGACATTGT	11	4	yes
GATCCTATTTTGGATGGTGA	3	2	yes
GATCCTATTTCTTACGTTTC	24	7	yes
GATCCTATTGAGTTGCTAAG	40	16	yes
GATCCTATTCTTAGGTCTAA	37	6	yes
GATCCTATTCTCCAAAGACT	31	21	yes
GATCCTATTCCAGCCAAATG	463	32	yes
GATCCTATTCAGTGGCACAA	26	18	yes
GATCCTATTAGCCAAACTTT	81	27	yes
GATCCTATGTGTTGGCCATT	149	11	yes
GATCCTATGGCATATGCAAG	78	18	yes
GATCCTATCTCCCGGTTGGG	77	11	yes
GATCCTATCATTGCTGGTGG	203	36	yes
GATCCTATCACCAGCACTGA	101	36	yes
GATCCTATATTTCCTGCTGA	57	7	yes
GATCCTATAGATGAACATAG	84	21	yes
GATCCTATAAGTAACCCCAA	23	34	yes
GATCCTACTTTGGGAACATG	10	7	yes
GATCCTACTGTGGATGACAC	352	14	yes
GATCCTACTGATGAAGTGCC	232	40	yes
GATCCCTGAGGCTGCCTCGA	1	1	yes
GATCCCTGAGCTATTGCTAG	17	13	yes
GATCCAGGTTTTGTGGTCTT	3	4	yes
GATCCAAGCTGTCAAGAAGG	461	20	yes
GATCCAAGCTCCATTGTACC	12	18	yes
GATCCAAGCTAATCTGAGGA	142	7	yes
GATCACTTGTTTGTGGTGGG	19	14	yes
GATCCTACGGAGCAAGTCTA	4	3	yes
GATCCTACCTTCTGCTTTCG	135	23	yes
GATCCTACCTGAGTGGCAGC	621	76	yes
GATCCTACCATCCCTTTGAT	5	4	yes
GATCCTACCACAGAGCCTTA	45	16	yes
GATCCTACATCCATTCGGCT	98	41	yes
GATCCTACAGTGGCTGGCAA	178	20	yes
GATCCTACAGTCACTTCACA	81	13	yes
GATCCTACACTCCTGGCAGT	52	10	yes
GATCCTACACTACATCCAGC	17	8	yes
GATCCTACACATGGAGGCTG	37	14	yes
GATCCTACACACCTACCAGA	28	9	yes
GATCCTACACACAGTGGTGA	148	17	yes
GATCCTACAAGCCTGTCCGT	18	6	yes
GATCCTACAAAGGTCTTGAA	8	10	yes
GATCCTAATGGACAACAAAG	53	37	yes
GATCCTAATGAAAAAACTTG	5	4	yes
GATCCTAAGTTTTATCCCAG	1	1	yes
GATCCTAAGCAGATTCTGGG	65	27	yes
GATCCTAACTGTGGAACCTC	25	0	yes
GATCCTAACTCTGACCTTTC	120	10	yes
GATCCTAACTAAGCACATGA	59	19	yes
GATCCTAACCTAAGATGCCT	181	25	yes
GATCCTAACCCTGAACCCCA	6	5	yes
GATCCTAACCCAGTGGACTC	49	15	yes
GATCTTTGTGTGACTGGGTT	1	1	yes
GATCATTCACACCAAATTTA	4	4	yes
GATCCCGTGTCCTGCAGACG	41	26	yes
GATCCCGTCTCAGCCACGTC	2	3	yes
GATCAAGGTAAGAAACATTG	3	2	yes
GATCAAGGGGTCCAATCCAG	8	5	yes
GATCCTAAATTTGACCCAGG	51	12	yes
GATCCTAAAGGCCGGTCACA	585	106	yes
GATCCTAAAGAAAGATTACG	1	1	yes
GATCCTAAACTCTGTTGCCA	41	10	yes
GATCCTAAACTCCAAGGGGA	7	6	yes
GATCCTAAAACTGAGGAAAG	30	9	yes
GATCCTAAAACCAAGGGAAT	46	10	yes
GATCCGTTTGGCCTCTCAAT	31	8	yes
GATCCGTTGTTTATGTGGAT	2	3	yes
GATCCGTTGGAAGGTTTACC	16	16	yes
GATCCGTTGCCTCCTTAAAG	76	58	yes
GATCCGTTGCCAGTTACCTG	144	9	yes
GATCCGTTCCTTATTGCCTG	1	1	yes
GATCCGTTCCTCACAGTATC	6	2	yes
GATCCGTTCCTAGGGTACCT	90	23	yes
GATCCGTGTGTGTGTGGGAG	444	42	yes
GATCCGTGTGAAACTGGATG	2657	910	yes
GATCCGTGTCAACCCCTTTT	7	5	yes
GATCCGTGTATGTCTAAACA	26	26	yes
GATCCGTGGCTGCAGCAGAA	125	19	yes
GATCCGTGGAGAAACTTGCC	19	15	yes
GATCCAAAGGAGCTACTTAG	155	11	yes
GATCCAAAGGAACGTGCAAA	274	18	yes
GATCCCGGAAGGGGAGAAAG	6598	809	yes
GATCCCTAGTTTTGAAGAAC	1	1	yes
GATCCAAAACACACTGAGTT	3	4	yes
GATCCCGAGCTTCAAATCCC	6	5	yes
GATCCAAACCACAGGGATTG	5	4	yes
GATCCGTGCTGAGCGTCGGC	288	16	yes
GATCCGTGCATCTCATTGGC	295	55	yes
GATCCGTGAAGAACAAAAAG	7	10	yes
GATCCGTCTGTGGGGGCCTC	18	2	yes
GATCCGTCGCCTGGAGGTGG	85	31	yes
GATCCGTCCGAGATGGCAGA	1	1	yes
GATCCGTCAGTGGTCAGTGC	1	1	yes
GATCCGTCAGGCTTGCTCGT	91	8	yes
GATCCGTCAAGCTAACTGGA	9	9	yes
GATCCGTATCAGGTTCATGT	136	26	yes
GATCCGTAGTCTGAGTGATG	121	9	yes
GATCACCACCCTCAGGAGCC	83	8	yes
GATCCGTACCCTGGTGCTGA	230	32	yes
GATCCGTAAGAAAGAGAAGG	37	4	yes
GATCCGGTTCTGGGACAGCA	33	26	yes
GATCACATGGGTACCAACCT	11	9	yes
GATCCGGTCCCAAGACCGCT	499	87	yes
GATCCGGTCCAAGGCTCTTG	167	9	yes
GATCCGGGTGTCCAGTGACA	349	67	yes
GATCCGGGTGATGCGAATCG	13	5	yes
GATCCGGGCAAAGCCTGCTC	71	18	yes
GATCCGGGAGGTGTGCGGCT	1241	79	yes
GATCCGGCTGGGCCTGGCTC	73	7	yes
GATCCCCTGGGCTTTAATAA	4	4	yes
GATCCAAAAAGCAGTTCAAC	87	18	yes
GATCCCCTCCGTTGGCCCGG	26	18	yes
GATCAGTGTGTGCCAAGGAA	5	8	yes
GATCATTTGGGAAATGGCTC	2	2	yes
GATCCTCGGGAACGAGTAAC	13	19	yes
GATCCGGCAGAAGGATGAGG	62	43	yes
GATCCGGACTCACCTGGGAG	13	19	yes
GATCCGGACCAAGCCACCAC	6	9	yes
GATCCGCTTGGCAGCCATTC	323	35	yes
GATCCGCTTCGTGGAATGGG	25	0	yes
GATCCGCTTACAGAGACTTT	200	33	yes
GATCCGCTGCAACCCGGTGC	129	3	yes
GATCCGCTCTGTGGTCGCCT	147	25	yes
GATCCGCTCTGAGGTTCTGT	55	7	yes
GATCCGCTCCTGGCGACTCC	171	21	yes
GATCCGCTCAGAGCCCAGCA	25	7	yes
GATCCGCTCACGCCCAGCAG	107	16	yes
GATCCGCCTTCTACTCGGAA	17	3	yes
GATCCGCCGCTAAGACCTGG	43	19	yes
GATCCGCCCTGTGAGTCACC	44	5	yes
GATCCGCCCACACCCACGTG	225	159	yes
GATCCGCCAAAAAAATGCAC	64	45	yes
GATCCGCATGATGGGAGGAG	8	3	yes
GATCCGCATCCGCAAGCCCT	142	4	yes
GATCCGCAGGTCAGATGACA	13	10	yes
GATCCGCAGCTTTTCCAGCA	41	11	yes
GATCCGCAATTATGAAGAAC	69	51	yes
GATCCGCAAGGTGCTGGACG	443	31	yes
GATCCGCAAGGACTTCTTAT	75	52	yes
GATCCAGACTTTAAGGGTTT	21	8	yes
GATCCCCGCCCGTGGACTGC	32	7	yes
GATCCAGACAGCCATCAAGG	265	33	yes
GATCAAAGAGCAAAGGTCAT	7	7	yes
GATCTATGGGGCAGGGTTGG	6	6	yes
GATCTTGTGACAGTGTGTGT	17	17	yes
GATCCTAGTGATGATAATGT	20	2	yes
GATCCGCAACTGTCCGGAAG	155	38	yes
GATCCGATTTCTGATTTTGC	196	2	yes
GATCCGATTGAAGCCTCAGG	14	21	yes
GATCCGATGGGCCAGCCTTT	468	57	yes
GATCCTTTTATTTCACCGGG	21	17	yes
GATCCGATGAGGAAGATGAC	63	63	yes
GATCCGATGAAATTATTTCT	8	8	yes
GATCCGAGTGAAAGCCGGAG	139	82	yes
GATCCGAGGCTAGAGGGAGC	36	8	yes
GATCCGAGGCAGCCAATACA	57	36	yes
GATCCGAGCGACTGTCACCA	50	34	yes
GATCCGAGCCTCACTACCTG	72	53	yes
GATCCGAGCAGCCACATTCC	176	48	yes
GATCCGACAGGAGGGTGTAA	259	3	yes
GATCCGACACTTGCAGGACC	5	9	yes
GATCCGAATAATCCAGGAGG	432	272	yes
GATCCGAAGCTCATTCCAAG	55	71	yes
GATCTGCAAGGCCTAATTAC	8	8	yes
GATCTGATAAGCATTGGTCC	2	3	yes
GATCCGCAACTGTCCGGAAA	4	7	yes
GATCAACATTCACGCTGGGC	2	3	yes
GATCACGCTGCCCCCGACTC	1	1	yes
GATCCCGGGCAGGCAGTATG	8	5	yes
GATCTGCTTCCTGAAGAGTG	11	9	yes
GATCTGCTTCCCATTGTGGT	156	42	yes
GATCTGCTTCCCAACTGTTA	26	9	yes
GATCTGCTTCCATCCATCTC	45	7	yes
GATCTGCTTCATTATTTCAC	2	1	yes
GATCTGCTTATCCCATTTAG	33	25	yes
GATCCTAGGCTTCCTTCCCA	32	12	yes
GATCCTAGCTCAGAGAGGCT	34	34	yes
GATCTGCTGTTCCTCACGAA	203	40	yes
GATCTGCTGTGGCACAGGGC	6	6	yes
GATCTGCTGTCTACTACCTA	19	15	yes
GATCTGCTGTAGCATCAAGC	18	3	yes
GATCTGCTGGTCATTAAGGG	372	19	yes
GATCTGCTGGCAGTAGTAGT	19	13	yes
GATCTGCTGGAAGATAATCT	24	13	yes
GATCTGCTGCTAGGTATGTC	42	29	yes
GATCTGCTGCCAGGTTTTGC	4	4	yes
GATCTGCTGCAGGGTTCTGT	315	55	yes
GATCTGCTGCAGCTAAAGTA	46	32	yes
GATCTGCTGATGTTACGTCG	17	11	yes
GATCTGCTGATGATGGAACA	17	11	yes
GATCTGCTCTTTTCGTGTTC	13	6	yes
GATCTGCTCTTGCTAATAAC	14	3	yes
GATCTGCTCTGATGGTATGT	20	4	yes
GATCCTTCAAAGCAGAAGCC	3	3	yes
GATCTGCTCTCAAAAATTCC	8	5	yes
GATCTGCTCTAACCAGGCGT	62	10	yes
GATCTGCTCCTTCTGTCCCA	181	27	yes
GATCTGCTCCTGGAGGTGGT	3	4	yes
GATCTGCTCCCAAGTTATCT	118	14	yes
GATCTGCTCCAACTACAGGA	64	19	yes
GATCTGCTCAGTGACTTGTG	129	11	yes
GATCTGCTCACTCTATTACT	49	5	yes
GATCTGCTCAACAACTCCTT	6	5	yes
GATCTGCTATTGAATCGAAT	3	3	yes
GATCTGCTATGTACTCCAGG	195	21	yes
GATCTGCTAGCAGAACTTGT	28	28	yes
GATCTGCTAGAGCTGTAATA	363	44	yes
GATCTGCTAGACCAAAACAG	11	11	yes
GATCTGCTACTGGAGATGTT	34	6	yes
GATCTGCGTATGGCGGCCAT	2087	335	yes
GATCTGCGTACACCTGCGTC	59	63	yes
GATCTGCGGTGACTTGATGT	2470	207	yes
GATCTGCGCTATAGAAAAAA	13	12	yes
GATCTGCGCCTGCCTTGTCT	64	7	yes
GATCTGCGCCTGAGCCAAAG	226	28	yes
GATCTGCGAAGCCAGGCTTC	64	47	yes
GATCTGCCTTGGATTTCCTC	68	16	yes
GATCTGCCTGTTACCTCTTC	33	5	yes
GATCCCAGTGTCCTTGGAGC	16	8	yes
GATCTGCCTGAACGTGTGTA	19	14	yes
GATCTGCCTCAGGAAAAATA	32	3	yes
GATCCCAACATGAAATACGA	1	1	yes
GATCCTGCAGCACGTTATCG	19	5	yes
GATCATAAATACTCCGTAGT	2	2	yes
GATCTGCCGCAGTAAGCGAG	71	5	yes
GATCTGCCCTTTCTGGGTGA	138	24	yes
GATCTGCCCTTGCACCCGGC	33	25	yes
GATCTGCCCTTACATTCTTG	8	6	yes
GATCTGCCCGAAGCCATGAG	8	8	yes
GATCTGCCCCATGGTGTTTT	39	3	yes
GATCTGCCCAATCCTTCCTC	17	8	yes
GATCTGCCATTCCCATCTGT	23	7	yes
GATCTGCCAGTTTTGGTGCC	100	40	yes
GATCTGCCAGTCCGAGGTTC	94	37	yes
GATCACAGCAAAACTTGTTA	31	3	yes
GATCTGCCAGGACAAGCTGG	111	19	yes
GATCTGCCACTTGTTTTAAT	48	35	yes
GATCTGCCACTGCTTCTCTA	2	1	yes
GATCTGCCACAGCAAGAGTG	45	13	yes
GATCTGCCACACAGTAGACT	31	20	yes
GATCTGCCAAGATGAACAAG	2	2	yes
GATCTGATTTCATCTCCTCA	7	7	yes
GATCTGATTGTTCACTGCTA	83	16	yes
GATCTGATTGCCTTCATGGA	30	20	yes
GATCTGATTCTCTCTTCTGG	5	8	yes
GATCTGATTCTAATAACTGT	4	6	yes
GATCTGATGTTCTCTTCTGG	48	30	yes
GATCCTATGGGCTGCATGGT	1	1	yes
GATCTGATGTGGTAATCAGC	10	9	yes
GATCTGATGTCTTCTCTGAC	20	14	yes
GATCTGCGTGATGCGAATAG	3	2	yes
GATCTCCTCTGTCCCGTGTG	1	1	yes
GATCGGTCTGAGATGACTCA	2	2	yes
GATCAGTTCATCCACATAGA	11	11	yes
GATCTGATGTCAGTCGTGGT	3	3	yes
GATCTGATGTATGCCAAGCG	271	55	yes
GATCTGATGGTCCACTCTGC	5	3	yes
GATCTGATGGGTTTCTGGCT	58	42	yes
GATCTGATGCCTTCTGGTGT	38	28	yes
GATCTGATGCCCTGTTCTGG	17	17	yes
GATCTGATAGTCAAGTGTAT	76	48	yes
GATCTCAAAACCAAAACCAC	45	31	yes
GATCTATTTTCCTATGGAAT	2	2	yes
GATCTATTCTTGGTAAGGGG	2	1	yes
GATCTATCTGATGTGGGCAA	7	4	yes
GATCGATACCGGCTGAAGCT	8	8	yes
GATCTATCGGCCTCTGCCTC	9	9	yes
GATCTATCCTAGCCGGGAGG	999	153	yes
GATCTATCCCATCTAGTGGT	86	10	yes
GATCTATCCCAGAGTTCTAT	24	2	yes
GATCTTCTCTTCTTTTATTC	9	7	yes
GATCAGTCTCCATCAGACTT	59	32	yes
GATCTGTATCGGGGCTATTC	20	11	yes
GATCTGAGTGGGTGGGGGGT	91	59	yes
GATCTGAGTCAGGAATAGTT	4	4	yes
GATCTGAGGCCTTGTTTTTT	50	74	yes
GATCTGAGCTTTGTATAACA	28	25	yes
GATCTGAGCTGCCCTCTGCT	31	5	yes
GATCTGAGCTAAATGTCTAC	41	11	yes
GATCTGAGCCTCCACCTGTG	42	28	yes
GATCTACTGTGAAAAGCATG	16	16	yes
GATCTTTGCCAAAATGTGTG	34	9	yes
GATCTATGGATTTTGAGGAG	12	11	yes
GATCTTTCTGGAAAGAATAA	6	6	yes
GATCTTTCTGCCTTTACCTT	5	5	yes
GATCTTTCGGAGGAGATGTC	61	3	yes
GATCTATACAGTCGGGAAAC	1290	142	yes
GATCTGAGCATAGCGTCAGA	5	5	yes
GATCTGAGCATAGAAGAAGG	36	28	yes
GATCTGAGCAGCAATGCGCT	1	1	yes
GATCTGAGCACAGCCAGCTA	2	3	yes
GATCTGAGAGCCGTGGTGCC	4	2	yes
GATCTGAGAAGATGTGGATG	8	8	yes
GATCTGACTGTAGCCTTTTC	31	8	yes
GATCTGACCTCTCCTGGCAC	30	29	yes
GATCTGACCGAGAACTGAAC	4	4	yes
GATCTGACCAACAAGACCAC	65	12	yes
GATCTACCGTGCAGGGACTG	7	7	yes
GATCTACCGTAATGGCTCCA	3	3	yes
GATCTACCACCCTAACATCG	24	20	yes
GATCTTTCCAGAAGGTCTTC	30	8	yes
GATCTACACATGGGGCAACC	391	37	yes
GATCACTGACTGCCCCAAAC	40	10	yes
GATCTTTACAAGTCTGGCAC	10	10	yes
GATCCACAGTGTCCTGCAGA	2	2	yes
GATCTTGTTCCCTTACACGA	5	5	yes
GATCTGAATTTCTTCCTCTT	92	18	yes
GATCTGAATGTCCGAGAGAG	306	99	yes
GATCTGAATGCTGCCGAGTC	30	45	yes
GATCTGTAGGCAGAGCTCTC	6	11	yes
GATCAGCTATGAAGAAGGAA	54	34	yes
GATCTGAATGCTCTGGGGGC	18	27	yes
GATCTGAATCTACTTGTGAA	5	5	yes
GATCTGAATCCACTGTGGCT	3	4	yes
GATCTGAAGTTCTGTGTTCA	11	11	yes
GATCTGAAGTATCTGTACAG	19	28	yes
GATCTGAAGCTGCTGATGAA	69	54	yes
GATCTGAAGATTTCCCTATC	27	10	yes
GATCTGAACTGTCTAAAAGA	23	34	yes
GATCTGAACTCCAGAGAACA	88	58	yes
GATCTGAACCTGCCTGGAAA	16	3	yes
GATCTGAACACCCAGCGAGG	23	23	yes
GATCTGAAACAAATTTCCAT	1	1	yes
GATCTCTTTTGGTGTGTCTG	7	7	yes
GATCTCTTTTGCCAAGAAGT	86	12	yes
GATCTCTTTGTGTTCAAGAC	82	14	yes
GATCTAATTGCAGTGGTTAA	149	37	yes
GATCAGAGGATGGAGTTTGG	2	1	yes
GATCTACGCACGCATCAGCA	36	4	yes
GATCTTGTGGGAGTGACCAT	8	8	yes
GATCTTGTCTCACCCTGAAT	29	3	yes
GATCTACCCTGACTCAGGTT	24	16	yes
GATCTTGTACTGAGCGGCAT	5	9	yes
GATCACTACAGTGAAGTATT	24	31	yes
GATCTTGTCCAGAGCTTCCT	14	9	yes
GATCTTGTATTCTCTGGCTT	10	10	yes
GATCTTGTACAAACCGGTTT	90	18	yes
GATCTTGTAAATTCCCCACA	45	35	yes
GATCTCTTTGTCCTCCCAAT	11	8	yes
GATCTCTTTGCTTTGAAACT	38	38	yes
GATCTCTTTGATGCTGATGG	14	14	yes
GATCTCTTTCTTGTTCCCCC	21	5	yes
GATCTCTTTCTGAGACCTTT	48	3	yes
GATCTCTTTCCTGGACATTT	9	6	yes
GATCTCTTTCATTGTACAAG	42	27	yes
GATCTCTTGTGAAACGAAAC	11	11	yes
GATCTCTTGAATGACAGACA	59	59	yes
GATCTCTTCTCGCGCTCTCC	3	4	yes
GATCTCTTCAGAAGGGCACT	10	10	yes
GATCTCTTCACTGTTTTTCT	17	16	yes
GATCTGGGACTGAGAACAAA	2	2	yes
GATCCAAGAGAAAAACACTT	6	9	yes
GATCTTGGGGTCCTTCTCAA	62	39	yes
GATCTTGGGGAGTTTGACTG	13	13	yes
GATCTTGGGAAGCAAGAAAC	23	15	yes
GATCTTGGCTCTGTGGAATG	152	29	yes
GATCTTGGATGCAGACTCGG	19	19	yes
GATCTTGGAGCTTTGCCTAA	17	17	yes
GATCTAAGACCCAGCAGATA	79	58	yes
GATCTTGCTTTGTGACTTTT	26	3	yes
GATCTCTTATCGTTTCTCAG	2	2	yes
GATCTCTTAGACCCCTGCTT	4	4	yes
GATCCGCTCTGTAACTTGTC	5	5	yes
GATCTCTGTGGGCCTTTGGG	11	16	yes
GATCTCTGTGCTTTCTTCCT	46	14	yes
GATCTCTGTGCTGGCGCCTG	5	7	yes
GATCTCTGTGAGCTTGAAGC	18	13	yes
GATCTCTGTGAGCCTAGGAG	2	2	yes
GATCTCTGTGAATACTTTTC	26	20	yes
GATCATGTTTTTGTTCAGTT	10	15	yes
GATCTAACTCCTGTTGCTCT	20	2	yes
GATCTTGCTTCAGCCAACGC	262	27	yes
GATCACGTCTTAGCAGTATC	1	1	yes
GATCTTGCGTGTTCTGTCCG	14	14	yes
GATCACGATGGCTATGGCGC	14	2	yes
GATCTTGCCCCTGCCAGTGG	304	63	yes
GATCTAAAAGACCTGGGACT	11	11	yes
GATCACCTTTTTTGACGAGT	11	6	yes
GATCTTGCATCCGCCAGCCA	27	12	yes
GATCTTGCAGGACGTTCTCT	33	26	yes
GATCTTGCAGCTGAGGCTGG	22	22	yes
GATCCCGGCAGCGGCCTCCC	89	14	yes
GATCTTGCAAAAGGACCATT	16	16	yes
GATCACGTCTATGACCGGCT	16	15	yes
GATCCCAGGTCCCAGCTGTC	2	4	yes
GATCGTCTGGCTCCGGCTCC	28	20	yes
GATCGTCTGCTGTGAAACGT	124	34	yes
GATCGTCCCCAAAATTGCCT	30	19	yes
GATCTCACTATGTAGACCTG	82	14	yes
GATCGTACGGGGCTGGAAAC	45	6	yes
GATCTTGACCTTATCCAGTC	12	11	yes
GATCGGTGGGACCCGGGCGA	256	40	yes
GATCGTGGGCTTCAGCACCC	75	25	yes
GATCTTGAAGTCTTTCTTGA	173	79	yes
GATCGTGGATGAGTTTACTC	2	2	yes
GATCTTGAAAACCTGTCAGT	2	2	yes
GATCTGGTTGGGTTATGCTG	18	11	yes
GATCAAGACTTGTGCAGCAA	4	3	yes
GATCTTCTTCATGGAGGACT	2	2	yes
GATCGTGACCAGCACCTACA	2	2	yes
GATCTTCTGGTTCTCTTGCC	21	13	yes
GATCGGTCTGAGATGACTCC	92	9	yes
GATCACACTGAAGATGCCTC	98	9	yes
GATCCATAAATGCAAGATTA	2	2	yes
GATCGGCTTTGAGAGAGGGT	61	40	yes
GATCACCGGTTTCCGACTGA	4	6	yes
GATCGGCGTGGCAGCTGTGG	53	35	yes
GATCTTCTGAACATTGTTAT	44	28	yes
GATCAATGTAAATGGATGAC	10	10	yes
GATCTTCTCTCCAGAGACAG	7	10	yes
GATCTTCTCTCCACGTGGGA	1	1	yes
GATCTGCTGTGACTTGTATA	55	3	yes
GATCTTCGAGACTTTGTTAG	7	7	yes
GATCTGACTGCCAAATAAAT	26	26	yes
GATCGGCAAGCTGGAAGGCT	73	46	yes
GATCTGTGCTAATTCAAGCA	13	8	yes
GATCGGAATCGGAAGGAGAC	3	3	yes
GATCAGTTGACAGTGGCAAT	425	33	yes
GATCTTTCTACCTCTCTGCC	1	1	yes
GATCTTCCTGCCTTGGTATC	14	15	yes
GATCTTCCTCATTTACCCTC	59	53	yes
GATCTTCCTACAGAAAGTAG	9	9	yes
GATCTTCCGAAAGTCGGTCC	2	3	yes
GATCGGCTCTGAAGATTTCA	1	1	yes
GATCACCAGCCTTTTGCAAA	18	27	yes
GATCGGCGGGAAATGGCGGA	42	20	yes
GATCGGCGCCGTGAGATTCG	27	3	yes
GATCAGTGACTAAGTGCAGA	12	6	yes
GATCGCTCATTGGAACAGCT	2107	504	yes
GATCGCCGCTGGCTAGTTCC	6	6	yes
GATCGCCCTTGCTGGTCTGC	48	5	yes
GATCTTCCAAGTCTCTCATT	16	16	yes
GATCTGAAGCAATGTGACTG	4	4	yes
GATCTAATGGTCTCCCAGGT	4	4	yes
GATCTTCAGCCTCTTGGGGA	8	12	yes
GATCTTCACTCACGTCCGGC	7	10	yes
GATCTTCACCTCTTCTTCCG	836	113	yes
GATCGCCTGCTAGTGCGGGA	28	13	yes
GATCTTCACCGGAAGGTGCA	11	11	yes
GATCTTCACCATTGAGTATT	17	5	yes
GATCGCCTCTCAGTGCTGGT	2	1	yes
GATCTTCACAGTGCATGGCT	23	5	yes
GATCCCAACTTCCTACTTCA	4	3	yes
GATCAGAGAATAAAGCCCTA	7	5	yes
GATCTTCGACACAGAGAAGC	35	60	yes
GATCAAACAAGGGTGGTGAT	5	4	yes
GATCAAAAGGGACTCGTGTA	97	18	yes
GATCAAAACATGGATGAGAA	12	8	yes
GATCTCTTTTCAGAAGTGTC	144	8	yes
GATCACTGTCTCTCTTCCTC	3	4	yes
GATCTGTTGTTGTTCATGTT	5	3	yes
GATCTGAGCCGGTCGAGCCC	51	1	yes
GATCAGGGATGCAGTACCAC	23	23	yes
GATCATTCACTGCACATGCG	7	7	yes
GATCTTGGTCACTTTCCTGC	9	9	yes
GATCATGTTCACAACGCAGG	111	14	yes
GATCTCTGTGCTGTAAACTA	32	22	yes
GATCATGTGGAGCTTACCTT	3	4	yes
GATCCCTTTTCCATTCTGGA	69	11	yes
GATCCCTTTGGGGTGTGGGA	160	133	yes
GATCCCTTTGGGGTGTGGAA	1740	366	yes
GATCTACAGGAGTGGTGATA	2	2	yes
GATCCCTTTGAAATGTATGT	53	5	yes
GATCCCTTTCTCTGGCCCAG	518	81	yes
GATCCCTTTCCACCTAAAAC	44	8	yes
GATCCCTTGTGAGCCCTAGT	100	16	yes
GATCCCTTGTAGCCAGAGTT	172	42	yes
GATCCCTTGGGCAAGTATCA	10	8	yes
GATCCCTTGCTTGCCTCTTG	226	15	yes
GATCCCTTGCTTCAACCTCC	90	19	yes
GATCCCTTGCTACATCTCCT	735	78	yes
GATCCCTTGCCTCCTGAGTT	58	10	yes
GATCCCTTGCCCTTGCATTC	56	17	yes
GATCCCTTGCATTTGCAACA	67	21	yes
GATCCCTTGCAGTTCTGTGC	163	24	yes
GATCCCTTGCACACAGCCCA	287	41	yes
GATCCCTTGCAACTGGAGTT	1	1	yes
GATCCCTTCTTTTTTGGCAT	16	12	yes
GATCCCTTCTGCTCTACCTC	63	9	yes
GATCCCTTCCTTTGAAGTGA	74	54	yes
GATCCCTTCCTGCCCTCTTT	201	56	yes
GATCCCTTCCCCAGCGGTTC	102	3	yes
GATCCCTTCCAGCTGAGCCC	105	14	yes
GATCCCTTCCAAATCTGCTC	3	4	yes
GATCCCTTAGGTGTAGGTCC	34	9	yes
GATCCCTGTTTGGACATCAG	11	9	yes
GATCCCTGTTCCCCTGAGAA	57	4	yes
GATCCCTGTGTTCTACATGG	93	11	yes
GATCCCTGTGGTCACTTAGC	13	6	yes
GATCCCTGTGGATTTTGAAA	37	10	yes
GATCCCTGTCTCGGGAGGTC	8	8	yes
GATCCCTGTCTAGTCCCTGT	67	19	yes
GATCCCTGTCCTTTCTGTTT	13	4	yes
GATCATGGGTTGGGAGCTCA	128	15	yes
GATCAGGAGCTGGAGAGGAA	16	24	yes
GATCCCTGTACACTATGTCT	3	3	yes
GATCCCTGGTTGCATCTTCG	30	6	yes
GATCCCTGGTGGCTGCCCTT	466	33	yes
GATCCCTGGGTGCCAGTTTT	112	15	yes
GATCCCTGGGGGCTGTGATG	188	11	yes
GATCCCTGGGGCTGCCTGTC	359	32	yes
GATCCCTGGGGCCCCGTGAG	11	8	yes
GATCCCTGGGGCATGTTGTA	66	4	yes
GATCCCTGGGAGGATATGAG	4	1	yes
GATCCCTGGCTCAGTGAACA	19	6	yes
GATCCCTGGCGTCCCTATCA	136	24	yes
GATCCCTGGCCCCTGTGCCA	13	5	yes
GATCCCTGGCCAGAAGTACA	89	17	yes
GATCCCTGGCACTGCTGCCT	65	8	yes
GATCCCTGGCACCCAGCATC	63	14	yes
GATCCCTGGAGTGACCAGAG	1088	83	yes
GATCCCTGGAGTCTCTGAAG	3	4	yes
GATCCCTGGAGGCTGGAGAG	14	10	yes
GATCCCTGGAAGCTGTGATG	3	3	yes
GATCCCTGGAAGCAGGGACA	87	18	yes
GATCCCTGGAACAGAGTTAT	2	3	yes
GATCCCTGCTTTTGTGGCCT	538	82	yes
GATCCCTGCTTCCTGCCCAG	68	8	yes
GATCCCTGCTGTTGGCAATA	23	30	yes
GATCCCTGCTGTGGGCCTTC	4	3	yes
GATCCCTGCTCTTAGGTGCT	19	5	yes
GATCCCTGCTCTGGACCCTC	487	34	yes
GATCCCTGCTCCCCTCTGGG	104	18	yes
GATCCCTGCTCCAGGTCCTC	293	36	yes
GATCCCTGCTAATGGAAGAA	203	7	yes
GATCCCTGCTAAAACCATGT	205	44	yes
GATCCCTGCCTGTGGGGGGT	376	11	yes
GATCCCTGCCTGTCCTGAAA	58	13	yes
GATCCCTGCCTCGTCTGCCT	40	3	yes
GATCCCTGCCGAGGTGCTCA	228	24	yes
GATCCCAGGGACTCTGTTTT	14	1	yes
GATCATGGCTTTGAGGCCAG	16	13	yes
GATCATGGCGGTCAGCAGAA	58	31	yes
GATCATGGCCTGGTGCAGTA	12	3	yes
GATCATGGCCGACACCAGTG	47	16	yes
GATCATGGCAGGGATACGCA	2	3	yes
GATCATGGCAGGCCTTTAAC	85	12	yes
GATCTTGATGCGGGTGGAAC	16	13	yes
GATCCCAGAGTGCTTGATGC	3	4	yes
GATCCCTGCCCTTTGGCCTG	36	30	yes
GATCCCTGCCACCTCATTGG	155	24	yes
GATCCCTGCATTTCCTCAAG	252	20	yes
GATCCCTGCATAGGACTGTT	36	8	yes
GATCCCTGCAGTACCATCTG	366	26	yes
GATCCCTGCAGGTCGCTCAG	171	44	yes
GATCCCTGCAGCTGGGCGAG	18	15	yes
GATCCCTGCAGCGCTGTTTG	369	4	yes
GATCCCTGCAGAGGCTTCCA	78	15	yes
GATCCCTGCAGAAGGGGGGT	23	5	yes
GATCCCTGCACAAGGTGTTT	168	18	yes
GATCCCTGCAACAGCAAGGG	46	16	yes
GATCATATTCTTTCCCCTCC	10	3	yes
GATCCCTGAGTTTACCAGCG	29	2	yes
GATCCCTGAGTTCAAGGCTA	12	14	yes
GATCCCTGAGTTCAAGGCCA	100	26	yes
GATCCCTGAGTAAACTTCTT	5	4	yes
GATCCCTGAGGTCTCCTGCC	158	20	yes
GATCCCTGACATAGCAGGAC	25	21	yes
GATCCCTGAATAGAAATTGG	44	30	yes
GATCCCTCTTCTGGTGTGTC	68	10	yes
GATCCCTCTTACCTGCAACG	767	114	yes
GATCCCTCTGTACAGCATCC	5	4	yes
GATCCCTCTGGTGACTCCAC	43	7	yes
GATCCCTCTGGGTCATGTCT	415	89	yes
GATCCCTCTGAACCGCCGAG	8	8	yes
GATCCCTCTCTTTTCCTTCT	22	8	yes
GATCCCTCTCTTCAATGATG	41	7	yes
GATCCCTCTCTCTGGGGAAT	5	7	yes
GATCAGAGCTCCTCCAAGGC	3	2	yes
GATCCCTCTAAGCCCCCTCC	47	12	yes
GATCCCAGAACTGCAAGACG	3	3	yes
GATCCCACTTCTGCGTCTTA	39	12	yes
GATCATGCAACTGATGGAGA	75	30	yes
GATCCCTCGGTGACCACATT	44	4	yes
GATCCCTCGACGGCCAAGCC	594	273	yes
GATCCCTCCTTGTGAGCAGC	163	23	yes
GATCCCTCCTGTCACTGCAG	12	3	yes
GATCCCTCCTGGGCATTGCT	26	7	yes
GATCCCTCCTCAGGCATCTG	997	15	yes
GATCCCTCCCTTGGGCCTCC	69	13	yes
GATCCCTCCCTCCGAGGCCA	25	17	yes
GATCCCTCCCAGAAACCTGC	1950	523	yes
GATCCCTCCCACTCTGGCTC	46	5	yes
GATCCCTCCAGCCTCTACTG	1	1	yes
GATCCCTCCAGACACCAAGG	86	13	yes
GATCCCTCCACAAGATTCTG	33	16	yes
GATCCCTCAGGGTGTGTGCC	151	37	yes
GATCCCTCAGGAACAGAGGG	291	53	yes
GATCCCTCACCTCCTTCATC	248	43	yes
GATCCCTATGCTGACCCCAA	24	5	yes
GATCCCTATGAAGTGTCTTA	44	4	yes
GATCCCTAGTGGCCCATCAT	4	4	yes
GATCCCTAGGGAGAAGGTGG	174	30	yes
GATCCCTAGCATTCTGTACT	445	32	yes
GATCCCTAGAGCCAGCACAT	114	45	yes
GATCCCTAGAAACTCTCTGG	3	3	yes
GATCCCTACTGCACCACCTT	92	8	yes
GATCCCTACTCGTTTCAACA	13	9	yes
GATCCCTACTATTGATTCTG	69	14	yes
GATCCCTACTACGTGCTGGA	1105	53	yes
GATCCCTACCTACAACCCTA	227	64	yes
GATCCCTACCCCACATGCTG	98	16	yes
GATCCCTACCCATGGGAATG	125	20	yes
GATCCACATCTCCAAGAAGT	44	44	yes
GATCCCACCAGCTCAGCAGA	4	1	yes
GATCATGACCTCAAATCAGA	18	14	yes
GATCATGACAGTCCCCCCAC	27	23	yes
GATCCCAAGTGGCACTGTTT	21	6	yes
GATCTCACAGGACAGATGGA	38	38	yes
GATCCCTACCCATGGACCCT	382	20	yes
GATCCCTACCCATACAAAAA	58	14	yes
GATCCCTACCACCTGCCCGA	11	8	yes
GATCCCTAATGAGAGCAGAG	48	21	yes
GATCCCTAAAGGGTGTGCTA	42	12	yes
GATCCCTAAACTACCTCTTG	20	15	yes
GATCCCTAAACATAATTGTG	2	3	yes
GATCCCGTGTGACACATTTT	12	6	yes
GATCCCGTGTCCCATAGTTG	4	3	yes
GATCAGTTTTTGGTGTCATC	64	59	yes
GATCCCGTGGACTGTTTGCT	27	10	yes
GATCCCGTCCTTGAAAGTAG	24	12	yes
GATCCCGTCCAAGGAGCATC	355	30	yes
GATCCCGCGAGGCCCGGAAG	2629	81	yes
GATCCCGCCTGCCCAGCTGA	324	45	yes
GATCCCGCCGTTCCACCCTC	32	7	yes
GATCCCGCCAAAAGAATTAC	307	24	yes
GATCCCGCACATCCACAAGT	279	77	yes
GATCCCGAGATTGCCAGCCT	333	14	yes
GATCATCTGCTAGGGTGTGG	60	15	yes
GATCCACAAACTTCCTGACA	45	9	yes
GATCCATTGCGTAGCTGTCC	5	4	yes
GATCCCGACACCAAGGAGAT	4789	429	yes
GATCCCGAATAAATGAGTGT	19	2	yes
GATCCCGAAAACCAGAACTT	74	27	yes
GATCCCCTTTTTGAACAGGT	81	10	yes
GATCCCCTTTCTTTACCTTC	86	22	yes
GATCCCCTTTACCTTCTGGG	678	68	yes
GATCCCCTTGGTTGCTGGAT	61	12	yes
GATCCCCTTCTCAGGGTCTA	154	12	yes
GATCCCCTTCCTACCTCTAG	37	27	yes
GATCCCCTGTTGACTTACAA	120	38	yes
GATCCCCTGTATATGTTGAA	82	4	yes
GATCCCCTGGGTTGAGAGAT	3	3	yes
GATCCCCTGGGGCAAGCTGC	492	94	yes
GATCCCCTGGGAGGAGACAG	770	33	yes
GATCCCCTGGATACATGGTC	76	12	yes
GATCCCCTGCTACACTGATG	18	4	yes
GATCCCCTGCTAATGAAAAT	5	4	yes
GATCCCCTGCCTCAGCTCCT	379	65	yes
GATCCCCTGCCCCCCAACCA	42	12	yes
GATCCCCTGCAACAGACATT	57	5	yes
GATCCCCTGAGATGGAATTA	20	1	yes
GATCCCCTCTTCCCAAATAA	139	7	yes
GATCCCCTCTGTGGGTATGA	5	2	yes
GATCCCCTCTGGGCCTCCGA	42	5	yes
GATCCCCTCTCCTGCCCACA	474	22	yes
GATCCCCTCGGACCCCCTTG	593	53	yes
GATCCCCTCCTTTCTGCCTG	56	2	yes
GATCCCCTCCTCCAGGCAGT	42	13	yes
GATCCCCTCCCTTGCTTTCT	57	4	yes
GATCCCCTCCCTCTGATTTT	15	11	yes
GATCAATTTACCCGACTTCA	31	22	yes
GATCCCCTCCCAGGCTGTCC	8	6	yes
GATCCCCTCCCACAGAATAG	4201	138	yes
GATCCCCTCACATGTGCTAT	84	8	yes
GATCCCCTATGGGGAGGAGG	169	40	yes
GATCCCCTATGCAAGCTGTG	37	24	yes
GATCCCCGTTGTACCTGGTG	4	6	yes
GATCCCCGTGTGTTTGCAGG	277	16	yes
GATCCCCGTGCCCCTGCCTA	838	100	yes
GATCTTCACTGCAGATGTGG	5	5	yes
GATCAAACTGAATGAAACAC	91	14	yes
GATCAAGAAGAGTCAAATGG	6	6	yes
GATCCCCGTCTGTGTCTGTG	659	22	yes
GATCCCCGGTGCTCTTCGTG	205	18	yes
GATCCCCGGGAAAGTGTAGT	15	7	yes
GATCCCCGGCGTCTGTCTGA	16	24	yes
GATCCCCGCAGAATCAGGAA	32	13	yes
GATCCCCGCAAAGTGAGCGA	22	9	yes
GATCCCCCTTTGCTGCCTCC	52	17	yes
GATCCCCCTGATGGAGAGAA	58	18	yes
GATCCCCCTCCCTGCTCTCA	27	4	yes
GATCCCCCTCCCCCCAGTGG	173	45	yes
GATCCCCCCCTTTTTTTGTC	90	25	yes
GATCCCCCCCAGCACACTCT	10	5	yes
GATCCCCCCACCCCACCACC	632	83	yes
GATCCCCCCAACTGTGTGCC	114	24	yes
GATCCCCCAGGTCTCAGAGG	368	18	yes
GATCCCCCAGGGAAAGACTT	26	18	yes
GATCCCCCACATCCTGGGGC	187	21	yes
GATCCCCATTTGCAGTAAGA	47	8	yes
GATCATCACCTGACCCACTT	2	2	yes
GATCTTATCACGGTGACTGG	8	8	yes
GATCAGCCAGCCGACCGAGG	16	16	yes
GATCATATGGGTGATTCAGT	11	11	yes
GATCGAGGCCGGCGGGAGGT	2	2	yes
GATCCCCATGTTGAGCTCTG	93	16	yes
GATCCCCATCTGCAGTACAA	46	13	yes
GATCCCCATCTGACTCAGTA	5	7	yes
GATCCCCAGTGCCCACACTG	17	22	yes
GATCCCCAGTCTTTAGTCCC	232	39	yes
GATCCCCAGGGGCTCCCGGT	25	19	yes
GATCCCCAGGAGATGAGGTC	1	1	yes
GATCCCCAGCTCCTTTCAAA	9	13	yes
GATCCCCAGCCTTGGATAGT	201	28	yes
GATCCCCAGCATTAGGCCAT	6	3	yes
GATCCCCAGCAGTAACACTT	50	9	yes
GATCCCCAGCACCACAAAAA	19	7	yes
GATCCCCAGCACAGGAAGGC	116	14	yes
GATCCCCAGAGTCCCCTGTG	485	33	yes
GATCCCCAGAATCCCCAATA	53	15	yes
GATCCCCACTTTTGTGACTT	27	19	yes
GATCCCCACTGTGCCTTTTT	375	21	yes
GATCCCCACCAGCCACCCCC	346	66	yes
GATCCCCACAGGTGTAGTCT	10	6	yes
GATCCCCACAGCTGCGTATG	691	49	yes
GATCCCCAAGTCTGTGACAC	57	9	yes
GATCCCCAAGGGCTGGAATG	1	1	yes
GATCCCCAACAATGTGAAGA	1582	80	yes
GATCCCCAAAGGGCAGGTCC	12	8	yes
GATCCCCAAAGCCTGGAGCC	206	47	yes
GATCCAGTGTGGGGCAGCGC	48	5	yes
GATCATACCCACGTTGCCCA	20	14	yes
GATCATAAGTTCAAGGTCTT	10	8	yes
GATCTGTTTTTAGTGCCAGC	33	31	yes
GATCATAAACCTTGCCTGGA	5	6	yes
GATCCCATTTTTGACAGCAA	48	36	yes
GATCCCATTTACTATTTGAA	2	3	yes
GATCCCATTGGAGCTCTGTT	227	75	yes
GATCCCATGTTCAAGCTGGT	144	41	yes
GATCCCATGTGTTTAGTAAT	102	29	yes
GATCCCATGTGTCTTTTTGC	125	4	yes
GATCCCATGTGTCTCCCCCA	125	13	yes
GATCCCATGTGCCACCATCA	91	4	yes
GATCCCATGTCCTGCTTTCT	90	10	yes
GATCCCATGTCCTGCTAAAA	5	7	yes
GATCCCATGCTTTGAAAAAT	82	9	yes
GATCCCATGCTAGCCTCTTG	302	66	yes
GATCCCATGCCTGGAATTTG	57	12	yes
GATCCCATGCAGAGCGGCCT	329	35	yes
GATCCCATGATGGAAATATT	90	28	yes
GATCCCATGAATCATTTGCC	5	5	yes
GATCCCATGAATACAAACAG	2	2	yes
GATCCCATGAAATCCCCAAA	89	6	yes
GATCCCATCTCCTGGAAGGA	272	38	yes
GATCCCATATCCCTGTGAAA	169	33	yes
GATCCCATACCTGACATGAC	94	3	yes
GATCCCATACAATGCCGCCC	127	14	yes
GATCCCAGTTTGCTTCATGA	209	46	yes
GATCAGTTTCTAAGATTGCC	4	2	yes
GATCCAGTCACACCCCACCC	24	31	yes
GATCAGTTACTTACCCACTC	45	10	yes
GATCCAAACTTCTACAGCAA	33	14	yes
GATCCAGGTGCTATGTCTCG	2	2	yes
GATCAGTGGGTGCCCGTGAT	8	8	yes
GATCAGGCCATAATGTCTCC	33	26	yes
GATCAAGGCCACGGGGAGGA	79	7	yes
GATCCCAGTTCATAATGAAC	69	18	yes
GATCCCAGTGTTGCTACGTG	28	4	yes
GATCCCAGTGTGAATCATGG	178	31	yes
GATCCCAGTGGTATTCCGCC	57	20	yes
GATCCCAGTGGATGAAGTGT	58	44	yes
GATCCCAGTGCTGTGGAAGT	26	6	yes
GATCCCAGTGCTGGTCAGTT	281	20	yes
GATCCCAGTGAGATGCTGGT	30	9	yes
GATCCCAGTGAAGGGTTTCT	227	9	yes
GATCCCAGTCTGAGTGATTA	42	34	yes
GATCCCAGTCCTCCTGGGCA	32	9	yes
GATCCCAGTCCGAAATGGGG	1	1	yes
GATCCCAGTAATGTAAACAA	34	25	yes
GATCCCAGGTGTCCCCATTT	221	18	yes
GATCCCAGGTGGAGCAACCC	128	35	yes
GATCCCAGGTCCCTCTGGGA	44	4	yes
GATCCCAGGGTTTTCTTGGT	4	2	yes
GATCCCAGGGGTCCTAGGGG	135	13	yes
GATCCCAGGGGCTCTTCTGC	100	14	yes
GATCCCAGGGAAAGTGCTAT	201	37	yes
GATCCCAGGCTCCACCAGCG	24	8	yes
GATCCCAGGCTAGCAAGCAA	197	20	yes
GATCCCAGGCGTCAAGCTCG	8	5	yes
GATCCCAGGCAAGGGATGGT	83	2	yes
GATCCCAGGAGTCAAGCTCT	3	4	yes
GATCCCAGGAGAGAGGCTTC	23	13	yes
GATCCCAGGAAGGACCATCA	253	44	yes
GATCCCAGGAAAGTTCTAAT	128	24	yes
GATCCCAGCTATGATGTAGC	65	12	yes
GATCCCAGCGCTTAGCCACC	14	10	yes
GATCCCAGCCCTGGCTCCCC	40	33	yes
GATCCTCTTTGACTTCACGT	74	5	yes
GATCCTACTATGAGCAAAAA	95	60	yes
GATCCCAATAATTCTGGAGG	18	4	yes
GATCCTCAGAGGAACAGGGC	5	4	yes
GATCACTGTCAAAATACAGG	17	25	yes
GATCAATGTCTCCACCTTCC	24	6	yes
GATCAAGGTGAGACTCAAGC	1	1	yes
GATCTGTCAATCAGTTCTCA	26	26	yes
GATCACCTTCTTCTAAATCT	8	2	yes
GATCTCTGTCTTTCCCTGGT	278	34	yes
GATCTCTGTCACATCCGATG	155	155	yes
GATCTCTGTATGTTCGAGCC	4	2	yes
GATCCTATATTCGGCTGAAT	5	2	yes
GATCAAGAGGTGAGGAGAGG	40	3	yes
GATCTCTGGCTCTTCATCCT	9	13	yes
GATCTCTGGCCTGTGGAGTA	61	19	yes
GATCTCTGCTGTGGGAAAGG	774	34	yes
GATCTCTGCTGTCGGTTTCT	12	4	yes
GATCTCTGCCCCAAATCCAA	37	27	yes
GATCTCTGCCCAAACCAGGC	355	30	yes
GATCTCTGCCACCCACCCAC	51	8	yes
GATCTCTGCAGCTGGAGTCT	9	9	yes
GATCCCTTATTGGATTAGTC	17	7	yes
GATCTCTGCAAGCAGTTGTC	46	6	yes
GATCTCTGATGGCTGGGGAG	42	41	yes
GATCAAAAGGTAAAGGCCAG	9	9	yes
GATCTCTCTTGTTGGAAGGA	14	14	yes
GATCTCTCTTCCCAGAGGAA	2430	361	yes
GATCTCTCTTACATACTGTT	43	1	yes
GATCTCTCTGGAACTATCTA	18	18	yes
GATCTCTCTGCTCATACCCT	14	14	yes
GATCTCTCTCCTTGGCCTTC	89	22	yes
GATCTCTCTCATTCAACTTT	30	2	yes
GATCTCTCTCATCGAGAGCA	10	13	yes
GATCCTTTGGAGATGACTCT	7	10	yes
GATCTCTCGTGTGCCTTTGG	5	5	yes
GATCTCTCGGATGTAAATGT	1	1	yes
GATCTCTCCCGTTCTCAGCA	2	1	yes
GATCTCTCCATATCAAGCGA	1328	109	yes
GATCTCTCATTCCCAAGTAA	2	2	yes
GATCTCTCAGTTGAATACAT	45	11	yes
GATCTCTCACTGGACCAGCG	1	1	yes
GATCTCTCAAATCTTGGATT	8	5	yes
GATCTCTATGTACAAGTGGA	5	5	yes
GATCTCTATCCTAACGTCCA	13	10	yes
GATCTCTATCACCGCAGGAA	2	2	yes
GATCTCCCGCTCAACCTTCT	6	6	yes
GATCTTTTACAGTGTACAGT	9	6	yes
GATCCTTATTCGTTTCTTGT	29	16	yes
GATCTGCTCAGCTCTGGCTG	10	9	yes
GATCCCATAGCGGTGGAGCA	2	3	yes
GATCCTTTTCAGACTGGCTT	2	3	yes
GATCAAGATAACGGTGGCTT	24	6	yes
GATCTCTAGAAAAGTCGTTT	2	2	yes
GATCTCTACTTTGGAGTCCT	9	8	yes
GATCTCTACTGGCAGGCCAT	20	20	yes
GATCTCTACTGCTGTTAGGT	114	32	yes
GATCTCTACTCCCAGGAGAT	35	10	yes
GATCTCTACCCTTCATGATT	20	15	yes
GATCTCTACCATTTGATTAA	198	132	yes
GATCACGTGTACTATTTCCT	24	3	yes
GATCTCTACCAATATTCTCA	2	3	yes
GATCTCTACAGTATTGTGCT	8	12	yes
GATCTCTACAGACAAAATCT	112	4	yes
GATCTCGTTTTTCAAAAGCA	14	10	yes
GATCTCGTTCATTGGCAAAA	25	9	yes
GATCTCGTTCAAAAAAAAAA	53	33	yes
GATCTCGTGCAACTGTTGTC	163	13	yes
GATCTCGGTTTCGTTTCGCT	40	18	yes
GATCTCGGTGTCATCAGAGG	18	18	yes
GATCTCGGTCTGTGCCGGGG	94	10	yes
GATCTCGGCCTCACAAATCC	5	5	yes
GATCTCGGAGTCCTGGCCCC	11	11	yes
GATCTCCTTTGTGAATGGTG	2	3	yes
GATCTCCTTTCCGGAAGCAA	31	12	yes
GATCCATTGTACCCAACATC	3	2	yes
GATCCAGAGGTCGAACTAGA	2	4	yes
GATCCATGAGAATGAGAAGC	17	6	yes
GATCACCCTTTGTAAATAAG	5	4	yes
GATCTCCTCTTCGGGGTTCT	25	2	yes
GATCTCCTCGCTGGAAAAAG	31	23	yes
GATCTCCTCCTTATTCCCCA	99	12	yes
GATCTCCTCAGAGAAGTCTG	2	3	yes
GATCTCCTATTTTGGTGTCA	72	49	yes
GATCGGGCCTGAAACCTTGG	1	1	yes
GATCTCCGTCTCATTCTTTC	17	13	yes
GATCTCCGTCCCTCAGCTCC	243	73	yes
GATCTCCGCCTGGCACCCAG	33	13	yes
GATCCATCTGTCTTAGCCTC	1	1	yes
GATCGCAGAGAGGCGAGAGC	79	13	yes
GATCCATACAAACTCGCAGG	16	14	yes
GATCTTACTTAGCATGCACA	5	5	yes
GATCCCTGTTCTGCAGGATG	6	5	yes
GATCCCTGCCACCTCATGGC	10	15	yes
GATCCTTGAGGGTCTGAGTG	2	2	yes
GATCTCCGACGAAATGGAAG	1	1	yes
GATCTCCCTTTGTACTGTCT	6	8	yes
GATCTCCCTTTCCTGTAGAG	28	20	yes
GATCTCCCTGTTCTGGACTC	79	6	yes
GATCTCCCTGAGTTCGAGGC	126	5	yes
GATCTCCCTCTAAATATTTC	17	17	yes
GATCCACCGTACCTGAAGTC	2	2	yes
GATCTGTCTTATTTGGAAAC	1	1	yes
GATCACTTTCAATTGAAGTC	8	8	yes
GATCCTTTCCTCCGAATAAA	38	24	yes
GATCCTTTCAACTCAAAAGC	119	14	yes
GATCTTATTGGACAGTATTG	11	11	yes
GATCTTATTGCCAAGTTCCT	3	2	yes
GATCTTAGAGAAGGAGACAG	2	2	yes
GATCTTAGAGAAAGGCCAAC	85	29	yes
GATCTTAGACAGGCGATGTG	25	21	yes
GATCGCAGCACTGAAAACAA	7	7	yes
GATCTCCATCGTGCAGGGAT	187	39	yes
GATCTCCATAGTTTAGCTCT	2	3	yes
GATCTCCAGCACAGCAGAGG	45	33	yes
GATCTCCAGACCGTTCCACT	13	19	yes
GATCTCCAGAAATCTCCTGC	8	8	yes
GATCTCCACTTTCTACAACA	24	8	yes
GATCTCCACTCTCCCTCTGG	34	3	yes
GATCTCCACGGGTGCTTAGT	6	9	yes
GATCTCCACATCCTAACCCT	18	7	yes
GATCTCCACAGGCCAGCCTT	36	30	yes
GATCTCCACAGCGTGTTCAT	3	4	yes
GATCTCCACACAACAGGTGA	24	4	yes
GATCTCCAATGTTGTGCTAA	20	17	yes
GATCTCCAACATTTTGGAGG	44	65	yes
GATCTCATTTTAACATCCAC	219	29	yes
GATCTCATTTCTGAATATCT	3	4	yes
GATCTCATTTCTAGTTTCCA	3	5	yes
GATCACAGCCCTGTCGCAGG	3	4	yes
GATCACAGCAGTAAATGTGA	664	33	yes
GATCACAGCAGCTGAGCTGT	144	35	yes
GATCACAGATTTAAGGGGAG	26	39	yes
GATCACAGATTGCTTCTCTG	54	21	yes
GATCACAGATGATACTGAGT	5	6	yes
GATCACAGAGAACACAGAGG	5	5	yes
GATCACAGACTTCGGCCTTG	1	1	yes
GATCACAGACTGTTGGCCCC	34	22	yes
GATCACAGACATTAACAAAA	27	27	yes
GATCACAGACACCTGCACTG	143	17	yes
GATCACAGACAAGAAATACC	33	23	yes
GATCACAGAAGTGAGCGGAT	116	43	yes
GATCCTTCTGCAGACACCGA	78	56	yes
GATCACCATTCCGGTTACTG	8	13	yes
GATCCTTCTCAGAAGAGTCT	58	11	yes
GATCACACTTCCCACAACCC	254	20	yes
GATCACAGGGAGCCTGTGTT	10	8	yes
GATCTTACCGTCTATGGATT	59	4	yes
GATCTTACAGCACAAGGATG	37	37	yes
GATCAGACCCAAACATTTTA	2	2	yes
GATCTTAAATGGCGTAGTAT	64	44	yes
GATCACAGCAGAGATGGCCA	208	53	yes
GATCTTAAACATCTGTCAGA	28	20	yes
GATCTGTTTGGCTTGATGGA	51	9	yes
GATCTGTTTCCCTTCTGTTC	170	19	yes
GATCTCATTTCAGGAAAGGA	22	14	yes
GATCTCATTTACTGATTTAT	11	7	yes
GATCTCATTGTTCTTGGAGA	8	6	yes
GATCTCATTCTTTCATGGAT	2	3	yes
GATCTCATTCCGGATGAAGC	24	19	yes
GATCTCATTCCCGAGAGAGG	64	9	yes
GATCTCATGTTCCTTTACAC	2	2	yes
GATCTCATGTGTGGGAACCA	20	14	yes
GATCTCATGGAAAATGAAAC	39	11	yes
GATCTCATGACCTGTAAAAA	11	7	yes
GATCAATTTTCATAGCAAGA	17	15	yes
GATCTCATCCTCTCACCTCC	3	2	yes
GATCTCATCCATTGAATTTG	5	8	yes
GATCTCATCCAGTCTGCTGT	7	4	yes
GATCTCATCAGACAGTAGAA	22	16	yes
GATCTCATCACAGGAGCATC	18	14	yes
GATCTCAGTTTTCATCAAGT	72	5	yes
GATCTCAGTTTCGCTGATGT	27	6	yes
GATCTCAGTTCTGTGTTTAC	141	98	yes
GATCTCAGTTCACGGGGTGG	60	43	yes
GATCTCAGTTCAACAGCTCC	104	23	yes
GATCTCAGTGTGGAGAGCAT	4	4	yes
GATCTCAGTGGGGGTGGGAG	67	46	yes
GATCTCAGTGCTGGGGAGGT	11	11	yes
GATCACACTGATGGAGCTGT	5	3	yes
GATCACACTGAGCAACACCC	63	8	yes
GATCACACGGCAAAACAGTA	61	4	yes
GATCACACCTTGCTGTTCCC	7	4	yes
GATCACACCTGTCCCTACAC	483	42	yes
GATCACACCTGCAGTTTGGG	125	20	yes
GATCACACCGTTTCTTCCTA	51	8	yes
GATCACACCGAGATTCTTTT	17	1	yes
GATCACACCGAGACCAGTGG	28	1	yes
GATCACACCATTGAGTTCCG	40	9	yes
GATCACACCAGTCCTGTGAG	3	3	yes
GATCACACCACCGTGTCAAA	2	2	yes
GATCACACATTTGCAAGGGA	21	4	yes
GATCACACAGATGTTTTCTA	16	11	yes
GATCACACACTCAGTCCTTG	88	18	yes
GATCACACACGGCAACCGAC	5	1	yes
GATCACACAAGTGTGGGTTT	148	40	yes
GATCACACAAAACTGTCAGC	582	186	yes
GATCACAATCAGGAACTCAC	15	5	yes
GATCACAATACAACTTTATG	178	40	yes
GATCACAAGTTTGCATTCAG	38	27	yes
GATCACAAGTTAAGGTCAGC	42	6	yes
GATCACAAGTGCAGCATTCT	17	25	yes
GATCACAAGGTTTACATCTG	3	4	yes
GATCCTTCATGTTGAGCCAG	252	41	yes
GATCACAAGGGGGTAATCAA	30	7	yes
GATCACAAGAGTTACTAGTT	9	9	yes
GATCTGTTGTGCTTGAATGA	39	12	yes
GATCTGTTGGTGGTATAGGC	117	19	yes
GATCCTTGACTCTCAAGCCC	39	25	yes
GATCCTTCTGTCGGCTTCCT	3	4	yes
GATCTGTTCATGGAAAAAAA	192	31	yes
GATCTGTTCAGCACACCTGA	139	90	yes
GATCTGTTACTTTGGCGAGG	57	11	yes
GATCTGTGTGTGGGAGAGAC	12	12	yes
GATCCTTCTCTGCCCTTCCC	61	6	yes
GATCTGTGTGGGACCAAGGC	30	10	yes
GATCTGTGTGGCTCCTCTGC	29	5	yes
GATCCTTCCTTTCCCTTGGC	48	13	yes
GATCCTTCCTTCTTCTCTTC	43	4	yes
GATCTCAGTATCTCTTTCTC	11	7	yes
GATCTCAGTAACTGTCGAGC	132	19	yes
GATCTCAGGTGTTTGGTCAT	4	6	yes
GATCTCAGCTTGCATAGCAT	168	17	yes
GATCTCAGCTGGCCTGGTTT	10	5	yes
GATCTCAGCTCCACTGTGAA	52	33	yes
GATCTCAGCTAAACTTTCAA	2	2	yes
GATCTCAGCCATAGTCGTTG	268	39	yes
GATCTCAGCATTTATTACTG	8	10	yes
GATCTCAGCACTGTGGCTGT	274	17	yes
GATCTCACTGTTTCATGCTG	8	5	yes
GATCTCACTGCCTCCCTCTC	17	12	yes
GATCTCACTCAGCAACAAGT	87	10	yes
GATCACAAGAGGCCCGTTTG	20	20	yes
GATCACAAGAGAGTTGCAAC	8	8	yes
GATCACAAGAAGTTAGTTTG	70	20	yes
GATCGGGGGGATGACCAGCT	30	30	yes
GATCACAAGAAAGACGTGGT	5	5	yes
GATCACAACTTTTGATTTTT	8	2	yes
GATCACAACTTCTGAAACAC	33	12	yes
GATCACAACTGTAGGGAATA	150	21	yes
GATCACAACTGAGCCTACAG	33	8	yes
GATCACAACTATTAGCAAAA	18	12	yes
GATCACAACGGCTTGCGTGT	70	13	yes
GATCACAACCCTGATGGCAG	286	13	yes
GATCACAACCCCCAAGTCAG	21	15	yes
GATCACAACCCAGATGAAAT	58	10	yes
GATCACAAATACAGATTCTG	307	14	yes
GATCACAAATAAATGGTGCT	52	4	yes
GATCACAAAGTTTGAGAATG	652	194	yes
GATCACAAAGGTGGAATGTT	19	14	yes
GATCACAAAGAACAAGTGTA	46	8	yes
GATCACAAACTTCTGCAAAA	5	3	yes
GATCACAAACATCACAGAAG	9	7	yes
GATCACAAAATGAGTCACTC	27	13	yes
GATCCTGTGCCTGGCCTTTG	14	21	yes
GATCAATGTGTAGTTACTGT	145	11	yes
GATCAATGGGCAGCAGCAAT	45	29	yes
GATCTGTGTCCCAGCGAAGC	1	1	yes
GATCTGTGTATACCCCACTC	70	13	yes
GATCTGTGTAGAACACACAT	21	14	yes
GATCTGTGGAGTTTTTCTCC	79	10	yes
GATCCTGTGTGTTCCCTTCT	37	28	yes
GATCTGTGCGATGTTGTGGC	3	4	yes
GATCTGTGCCATCCCATACA	50	35	yes
GATCCTGTCTCCCGTGGACA	4	1	yes
GATCTCACCCTGTAACACCT	8	8	yes
GATCTCACCCAGAAGCATGA	9	16	yes
GATCTCAATGAAGTAGCTAA	9	9	yes
GATCTCAACTGACTCCTCTT	568	91	yes
GATCTATTTTTTCTTGCGAT	12	8	yes
GATCTATTTTTGGAAGAAAG	11	11	yes
GATCTATTTTGGCTTAATGT	3	4	yes
GATCTATTTTCCTAACCGTT	93	17	yes
GATCAATGCTGAAGTCATTT	38	25	yes
GATCAATGCAGGCCATGAGG	20	17	yes
GATCAATGCAATGACGTGGG	52	53	yes
GATCAATGCAAAAATCACCG	9	9	yes
GATCAATGATGAGGACAAAC	747	59	yes
GATCAATGAGGCCTTTGCAA	11	20	yes
GATCAATGACAGAGTGAGGT	15	11	yes
GATCAAGTCCGGGAACTCTC	111	13	yes
GATCAATCTTCTGGTTCATC	83	13	yes
GATCCTGGGTACTGCACAGT	1698	100	yes
GATCCTGGGGGTGGACTGCA	28	19	yes
GATCAATCCAGTTGGTTTTG	9	9	yes
GATCAATCCAGGAGTCTCTG	139	32	yes
GATCAATCATTTCTGCATTA	4	7	yes
GATCAATCACATGGACACTA	58	7	yes
GATCTGTGAGATGGGTGCCC	4	4	yes
GATCCTGGGAAGCCTCCTCA	53	10	yes
GATCCCTGTCTAACCTTGAT	25	5	yes
GATCTGTCTCAACAGTCTGG	3	3	yes
GATCAATATGGGGAAAGCAG	92	19	yes
GATCAATATCACCCAAACCT	173	51	yes
GATCAATAGCTTGAGTCACT	4	6	yes
GATCAATACTTGATGTGTAT	8	8	yes
GATCAATACTCCTTTGGAAA	8	5	yes
GATCAATACCAGCAAAACAA	82	56	yes
GATCCTGCCCTTCCATCCTC	2	1	yes
GATCAATAAAGTGGGTTTTT	139	10	yes
GATCAATAAAGTCAATGTTT	26	18	yes
GATCAAGTTTGTGGTGTGTT	11	7	yes
GATCAAGTTTGGTGTTTCCT	1	1	yes
GATCAAGTTTCAGGAAGGCT	87	6	yes
GATCAAGTTTCACATCCTTC	52	11	yes
GATCCTGCATATCTCAAAGA	72	23	yes
GATCTGTCTACAGGGAAATG	3	3	yes
GATCCTGGAGGGCTTCGGGC	78	17	yes
GATCCTGGAGGCTGGCCTAG	29	10	yes
GATCCTGCAGCAGGAGTGCA	74	9	yes
GATCTGTCCTGATGAAGGCT	98	69	yes
GATCCTGCAAACTTCCCTGG	14	8	yes
GATCCTGATTTAGGAAGTGT	23	14	yes
GATCTGTCCATCTTGGAGTT	30	7	yes
GATCTGTCCAGGGTGCAACA	38	10	yes
GATCTGTCAGTGTTATGGAA	52	4	yes
GATCTGTCAGCTGTGCTCTC	4	4	yes
GATCCTGCTCAGACCATACC	16	7	yes
GATCCTGCCAGCCAGACCAA	97	5	yes
GATCCTGCAGACACTCAGAG	11	11	yes
GATCAAGTTGCCAGCATTTG	2	1	yes
GATCAAGTTGAAAGAGTGTG	86	57	yes
GATCAAGTTCAGTGCGCAGG	8	12	yes
GATCAAGTTATGTGTGGTTT	1	1	yes
GATCAAGTGTTTGCAGGACG	3	4	yes
GATCAAGTGTCGGATGGAAT	52	3	yes
GATCAAGTGTAAATGTGCTG	92	23	yes
GATCAAGTGGATTCGGCGGT	92	27	yes
GATCAAGTGCTTTGCCAAGT	7	7	yes
GATCAAGTGAGCTGTATCAG	98	7	yes
GATCAAGTGAGAGGACAGAG	13	3	yes
GATCAAGTCTTGTCAGTTTG	59	19	yes
GATCAAGTCGTGCTTCTGGC	3196	643	yes
GATCAAGTCCTTTGTGAAAG	892	41	yes
GATCAAGTCCGAGGTCCCCC	7	5	yes
GATCCACTTGCCTCTCTGCC	2	4	yes
GATCCTGAGGGCTGCATACC	21	21	yes
GATCAAGTCATTTGCTAGTT	12	3	yes
GATCCTGAGGAGTCAAATAT	6	9	yes
GATCCTGAGGACATTTGTGC	17	10	yes
GATCCTGAGGACATTCTAGA	42	42	yes
GATCCTGAGGAAGGCCAGGC	197	17	yes
GATCAAGTATGGGGAGAGCC	28	19	yes
GATCAAGGTTTCCATTTTGA	4	5	yes
GATCAAGGTTCTATGCAGAT	2	2	yes
GATCCTGAGAGCATCTTCGA	15	10	yes
GATCAAGGTGTTGCCTGGTG	270	27	yes
GATCAAGGTCCAGGTGGAAG	20	4	yes
GATCTGTACCTGCGGCTCCA	36	11	yes
GATCCTGACACCATGCAAGC	35	25	yes
GATCTGGTTTTAAGTGCCTC	131	23	yes
GATCCTGAATGGGCAAGAGT	47	5	yes
GATCTGGTTTCGCCCCAGCC	2	2	yes
GATCTGGTTGGCAAGCATGT	214	22	yes
GATCCTGAAGCTCTGGCTGA	30	29	yes
GATCTGGTGTACAGAGAGTT	8	8	yes
GATCTGGTGCTGATAGGAAG	11	9	yes
GATCTGGTGAATGACGGGCC	60	42	yes
GATCTGGTCTGCAGTCAGAC	2	3	yes
GATCTGGTCTCCCCGGCAGA	8	5	yes
GATCTGGTCACTGGTCAGAG	5	7	yes
GATCTGGTATGAACATCGGC	39	25	yes
GATCTGGGTTTGTCAACAGG	13	9	yes
GATCTGGGTTGTGAGGAGGT	1	1	yes
GATCTCTGTGAAAGTAGTAC	8	8	yes
GATCAAGGTCCACTTAGTGG	4	6	yes
GATCAAGGGAATCTTAAAGG	4	4	yes
GATCAAGGCTTTCCTCGGGC	11	1	yes
GATCAAGGCTCTGGAGATAA	135	19	yes
GATCAAGGCTCCCGGTTTTG	650	64	yes
GATCAAGGCCTTTCTGTCCT	252	22	yes
GATCAAGGCCTTTCTGCCCT	9	12	yes
GATCAAGGCCACTGTGTAAC	14	8	yes
GATCAAGGCAAAAGGAGGAT	2	3	yes
GATCAAGGATTGAAGGAATG	7	7	yes
GATCAAGGAGGCTGTTGCTG	4	4	yes
GATCAAGGAGAGAAGCAGGA	4	7	yes
GATCCTCTGGCAGATGTTTG	50	35	yes
GATCAAGCTTAGCAGTCAAG	137	32	yes
GATCAAGCGTCCACTCCTCA	3	3	yes
GATCAAGCGGGCTTTCCTTA	561	64	yes
GATCTGGGTGGGACAGTCAC	3	3	yes
GATCCTGAAAGTGACTGGGG	42	4	yes
GATCTGGGGTGAGCTGGGGG	8	12	yes
GATCTGGGCTTCCAGAGTGC	3	4	yes
GATCTGGGCTGAGCTTGGTT	15	11	yes
GATCTGGGCAGTTGTTTTGC	69	18	yes
GATCTCGCAGGAGAGGAGAG	4	3	yes
GATCTGGGCACCGAGGCTGG	16	16	yes
GATCTGGGATAAGGAGAGCG	27	27	yes
GATCGGCGATGTGATGTGCA	2	2	yes
GATCAAGCCCTTCTTCCATT	453	125	yes
GATCAAGCCCATGTGAACCA	1	1	yes
GATCAAGCCATCCATCAACT	405	40	yes
GATCAAGCATCATGATGCTC	58	9	yes
GATCAAGCAGTTTCTGGAGT	41	13	yes
GATCAAGCAGTAGAGTTTTT	25	15	yes
GATCAAGCAGCGAGAGGCTG	231	31	yes
GATCAAGCAGCAGCACGGGG	36	2	yes
GATCTTTTTTGTCTTTACCT	1	1	yes
GATCAAGCAGAACCTGGAGA	194	41	yes
GATCAAGAGTTTATTGCATT	157	21	yes
GATCCTCCTCACTTAGCACC	88	19	yes
GATCAAGACTGTGACTTTTG	48	34	yes
GATCAAGACTCTCCTGGAGA	112	8	yes
GATCAAGACGCCTGTCATTT	11	7	yes
GATCAAGACCACCACTGCAT	9	17	yes
GATCAAGACAGCTTGTTGGT	30	5	yes
GATCAAGACAGCCAGTACAT	2	4	yes
GATCCTCCCAAAAGCCATCT	35	24	yes
GATCAAGACAACCAAGGCTA	2	2	yes
GATCCTCCAGCTCCATCAGC	42	37	yes
GATCAAGAACTTCAGAAAAC	4	4	yes
GATCAAGAACAGAATGGGCT	5	5	yes
GATCAAGAAATCATAAGATT	3	3	yes
GATCAAGAAATACACATAAT	29	29	yes
GATCCTCAGTGAGAGTGTGG	3	3	yes
GATCCTCAGGTTTGTGTTGC	3	3	yes
GATCCTCTCCACCAATCTGA	18	13	yes
GATCCTCTAGTGTTTGTTCT	32	32	yes
GATCCTCAGCCACTGCTACG	1	1	yes
GATCCTCTAAAACAGGAGAG	27	23	yes
GATCCTCACTGGCAGCAGCT	15	15	yes
GATCTGGGACGTGAACAAAA	14	14	yes
GATCCTCACCCACCTGCTGG	29	19	yes
GATCTGGGAAGACTTCTCTA	31	31	yes
GATCTGGGAAAATGGCAGTT	11	4	yes
GATCTGGCTTTTGTTTTCCA	24	11	yes
GATCTGGCTTTACTTCTCTG	89	10	yes
GATCTGGCCTGAGCCTGTCC	35	9	yes
GATCTGGCCGGTATCCCCAA	58	44	yes
GATCTGGCCCTTTTGTCCTT	8	6	yes
GATCTCGCCTGGAAACAGAG	35	7	yes
GATCCTGTGAGTTCTAAATC	3	4	yes
GATCAACTTGCTGGGACCTA	83	123	yes
GATCAACTTAATTCCCTTTT	23	34	yes
GATCAACTGTGCAGACAACA	3009	431	yes
GATCAACTGCTACGATGTGT	5	5	yes
GATCAACTCTTTGTTTTGGC	89	13	yes
GATCAACTCTTGGCTTTGAC	145	10	yes
GATCAACTCTAAGTCCCCTG	4	6	yes
GATCAACTCGGTGATGGCAA	7	9	yes
GATCAACTACCTGCAGGAAG	27	23	yes
GATCAACGGAGGACTATCAT	13	13	yes
GATCTGGCCAACACAAGAAC	14	6	yes
GATCTGGCATAAACCCTACT	1	1	yes
GATCCTCCTGAGACAGGTCA	12	10	yes
GATCCTCCCTGTTCTCATCT	10	6	yes
GATCTGGCAGATGTGAGGTT	55	15	yes
GATCCTCACTGGCACAGATG	44	7	yes
GATCTGGAGGTGGAAGTGGT	11	7	yes
GATCTCCTTTGCCCATGTTT	20	8	yes
GATCAACGCGATTTAGCTGA	9	8	yes
GATCAACCTGAGAGGGAGAT	12	9	yes
GATCAACCTGAACTTGGGAC	30	6	yes
GATCAACCTCCTGGGCTTCA	9	9	yes
GATCAACCGACAGCTGGAGG	22	33	yes
GATCCCAGCATCATCTTTGC	3	5	yes
GATCAACCACTGCAAATTCG	1063	266	yes
GATCAACCACTGACCTGCCT	73	7	yes
GATCAACATGAACTGAGATT	93	60	yes
GATCAACAGTGAGGCAAGCA	15	15	yes
GATCAGAGCTCCTCAGTGTG	3	4	yes
GATCAACAGTAGTTGTCTTT	14	5	yes
GATCAACAGCGTTGCCTTCC	61	12	yes
GATCAACACTTACGTTAGGA	11	16	yes
GATCAACACGAACACGTTTT	4	3	yes
GATCAGAAAAGCTCAAAGCT	2	2	yes
GATCATTGTCAACCAGGCAT	70	36	yes
GATCATAGTCTTAATCGTCA	1	1	yes
GATCAGCTCCAACTATGGTG	22	15	yes
GATCCTTTCAATGTACGCTC	2	2	yes
GATCCTGCGGGAGGCCTATG	5	4	yes
GATCTCCCCGTCACAGAACC	12	8	yes
GATCAGTGCAAATGTTTTTG	22	5	yes
GATCAGTGAATGGGTCAAGA	11	9	yes
GATCAGTGAATAAAACCATC	14	5	yes
GATCCAGGCTATCTCCTCTG	1	1	yes
GATCCAGGAGGCTCTGCACG	63	12	yes
GATCAGTTTCAAGAAGCGTG	2	2	yes
GATCCCAGCATCGGCAAGCG	221	35	yes
GATCCCAGCAGTTCCAACAC	46	7	yes
GATCCCAGCAGCTGTTACCT	177	27	yes
GATCCCAGCACTGCAAAAGA	68	48	yes
GATCCCAGCACACACCGTGA	179	37	yes
GATCCCAGATGATACCCACT	33	24	yes
GATCCCAGAGGAAAGGGTTT	34	6	yes
GATCCCAGAGACAATCTCAT	224	76	yes
GATCCCAGAGAAGTGGGGCC	3	2	yes
GATCCCAGACGCCTCAAATG	27	8	yes
GATCCCAGAAGCCGCACAGG	33	4	yes
GATCCCAGAAGCACACTGGC	71	9	yes
GATCCCAGAACCATTGCCTG	161	58	yes
GATCCCACTTCACCTGTTAT	77	5	yes
GATCCCACTGTTGATAAGGA	1	1	yes
GATCCCACTGCTCATTTGAC	72	32	yes
GATCCCACTAACCTGCAGTG	48	11	yes
GATCCCACGGTAGAACCTGA	83	36	yes
GATCCCACGAGCCAGAGAAC	226	36	yes
GATCCAGGAAAAAGTGTTTC	5	5	yes
GATCCTAGCGGACCTCAACC	46	9	yes
GATCTGTCTCCCTTTTAGCT	4	4	yes
GATCAGGTTTCTTCTTTTCC	30	1	yes
GATCTTCCTGCCCTGTGTAT	18	12	yes
GATCAGGTTGTGTGAGACTG	15	10	yes
GATCTGTCCAGGGGACATTA	2	2	yes
GATCAAGTACACAGGTCCTG	2	4	yes
GATCCAAGTCAGGGAGAAAG	36	8	yes
GATCAGCCTGTGCCTGAAGT	8	8	yes
GATCCCACCTCACGTGTGAT	96	12	yes
GATCCCACCGGTCCAGTGGA	2	3	yes
GATCCCACCGCAGCTACCAG	99	15	yes
GATCCCACCCCAGTAGGAAG	13	17	yes
GATCCCACCATTCTCCTTGG	76	53	yes
GATCCCACCATCCTACCTAC	120	19	yes
GATCCCACATTTCCCTTGCC	18	1	yes
GATCCCACAGTTCAGAAATA	15	11	yes
GATCCCACAGTGTGACTGAT	102	38	yes
GATCCCACAGGCCGGTGGAG	7	6	yes
GATCTGCATGCCCTGGGTTT	20	34	yes
GATCCCACAGCCAGGCTCAC	173	28	yes
GATCCCACAGATGTAGTTTG	107	11	yes
GATCCCACACTTAAGACTTC	82	16	yes
GATCAGGTGGATGTGCAGGA	41	9	yes
GATCAGGTCCTAAACATGGC	114	6	yes
GATCCCACACAGCAGACAGA	9	7	yes
GATCCCAATTGGTGGAAAGG	10	7	yes
GATCCCAATTCTGTCCCAAT	399	29	yes
GATCCCAATTACAACCCACT	132	32	yes
GATCCCAATGGTCACACACC	28	0	yes
GATCCCAATGCTGCCCCATC	43	5	yes
GATCCCAATGATAGATTCAA	98	12	yes
GATCCCAATGAGCCCACCTA	1	1	yes
GATCCCAATAAACCCATGAG	55	37	yes
GATCCCAAGTTCAAAGCCAG	19	14	yes
GATCCCAAGTGCTGGGAAAG	25	11	yes
GATCCCAAGTCCAACACCCA	8	6	yes
GATCCCAAGCCTCACCGGCT	4	5	yes
GATCCCAAGAGGAAGGGTAT	122	13	yes
GATCTGACTTCATTTAAAGG	9	9	yes
GATCCCAAGAAAGGATGGAA	36	8	yes
GATCCCAAGAAACTACTTGA	314	74	yes
GATCCCAACTGTCAGTGCCA	3	3	yes
GATCCCAACTGTAACAGCAA	33	10	yes
GATCCCAACTCTGCAAGAGC	3	4	yes
GATCCCAACATTTGAGAGGC	81	2	yes
GATCCCAACATTGTTGGCAA	46	18	yes
GATCCCAACACCCATATCCA	5	2	yes
GATCCCAACACAGCGATATG	185	14	yes
GATCCCAAATTGGGTTGTCA	5	7	yes
GATCCCAAATCTGTGGTGTG	76	22	yes
GATCCCAAAGCACAATGGTG	36	6	yes
GATCCAGATGTTTGTGGCTG	1	1	yes
GATCTCATCCAAGCAAATGG	42	11	yes
GATCAGGGCTCCAGTGGTCC	5	3	yes
GATCCCAAACTGTATCCTTG	60	9	yes
GATCCCAAACTGAGGCAGCA	150	13	yes
GATCCCAAACTACTTAATAG	104	11	yes
GATCCACGTGCCTTTGTCTC	100	6	yes
GATCCCAAACAGCTAATATG	4	6	yes
GATCCCAAACAACTAAGAAT	726	44	yes
GATCCCAAAATGCTGCGGAG	107	17	yes
GATCCCAAAATAGGTGTTGA	73	7	yes
GATCCCAAAAGGGACATTGT	20	7	yes
GATCCCAAAAACCGTGCAGC	22	6	yes
GATCCCAAAAAATCTGTGCC	177	20	yes
GATCCATTTTTCTGTGACAT	9	11	yes
GATCCATTTGTACCAATAAA	29	18	yes
GATCCATTTGCTTACACTGT	268	22	yes
GATCCATTTGATGCTTCCAG	58	8	yes
GATCCATTTCTTCTGCATGA	59	15	yes
GATCCATTTCTAGAAAAGAT	32	12	yes
GATCCATTTCCTCAAAAAAA	8	6	yes
GATCCATTGTGTGGTTTAAC	354	49	yes
GATCCATTGTATGGCTTTAT	118	90	yes
GATCCATTGGTTTCTCAGTC	42	14	yes
GATCCATTGAGACGTATGAA	6	5	yes
GATCCATTAGTGTTTGCTGG	10	9	yes
GATCCATCTTTTTCTTTGGA	79	15	yes
GATCCATCTTCTGTTTCACC	1	1	yes
GATCCATCTTCAGCTGACTG	251	26	yes
GATCCATCTTCAAACCTCAA	54	21	yes
GATCCATCTTACCTGGAGAT	8	8	yes
GATCCATCTGCTTTCTTTCT	1	1	yes
GATCCATCTCTTTCCTTCTG	53	13	yes
GATCCATCTCCTCTGGCTCT	213	27	yes
GATCCATCTCCAGCACATGC	71	14	yes
GATCTGGTGTGTCTGAAGAC	6	9	yes
GATCTGGTATGAGTGGTGGC	2	2	yes
GATCTGGGTAGGGGACCAGG	9	9	yes
GATCCAGAATGTCAGCTGGA	31	5	yes
GATCCAGAATGTAATGAACT	12	14	yes
GATCCAGAAGGGTCTCTCTC	25	17	yes
GATCAGGCCGGGGCGGCAGG	37	55	yes
GATCAGGCCCTAAAGCATTG	73	4	yes
GATCCATCGGCAACATCAAG	34	15	yes
GATCCATCGACTGTGATAGG	71	19	yes
GATCCATCCTTACTTGGTTT	107	11	yes
GATCCATCCTATCCATCCGT	22	7	yes
GATCCATCCCCGGCAAAGAG	66	6	yes
GATCCATCCCAGAGGGACTG	940	67	yes
GATCCATCCAGCATTTATGT	2	1	yes
GATCCATCCAGCAAAGAGGA	19	15	yes
GATCCATCCACCAGCAGGAG	43	12	yes
GATCCATCCAATGGCTTACC	331	29	yes
GATCCATCAGTTCTGTTCTG	3	2	yes
GATCCATCAGGTATGTTGAA	4	6	yes
GATCCATCAGGGCTGAGCCT	4	3	yes
GATCCATCACAGGACTATGT	132	35	yes
GATCCATCACAGCTGCCAAG	6	4	yes
GATCCATCACAAGGCAAAAC	38	11	yes
GATCCATCAAGTGGGTAAGT	27	12	yes
GATCCATATCACTGGATGTA	19	13	yes
GATCCATATACCCATTAATA	12	16	yes
GATCCATAGCACAAAGCCAC	27	20	yes
GATCCATACTGTAAACTTGT	29	9	yes
GATCAGGCACACGAATGTGT	13	8	yes
GATCAGGATGGTGCTTCCAA	7	7	yes
GATCTGGCTGTTTTTATTGA	5	4	yes
GATCAGGAGCAGGCAACACC	301	69	yes
GATCAGGAGATTTGTACACC	11	7	yes
GATCCACTCCCTGTTCCCTT	3	4	yes
GATCCATACTCCCCAGTATG	20	6	yes
GATCCATACCCACCACTGTG	30	7	yes
GATCCATACCATAGCCAAAA	12	12	yes
GATCCATACAGCATTTTGCG	99	34	yes
GATCCTATCACCCATTTAAC	6	4	yes
GATCCATACAATTTGTGCCA	713	88	yes
GATCCATAATGGCTCAGTAT	2	2	yes
GATCCATAAGTTTGCCCAGT	70	11	yes
GATCCAGTTTTGGGAAAGGA	100	9	yes
GATCCAGTTTCTGACTCGGG	22	7	yes
GATCCAGTTTCATTCTCTAA	47	9	yes
GATCCAGTTGTTTGAAGATT	4	6	yes
GATCCAGTTGTGCAGTAGAG	53	18	yes
GATCCAGTTGGAGAGATTTG	10	9	yes
GATCCAGTTGCTCTAAGTTT	35	2	yes
GATCCAGTTCTGCTCAACTA	179	11	yes
GATCCAGTTCTACGAGCGGC	59	14	yes
GATCCAGTTCTAAAACTTGT	396	80	yes
GATCCTTGACCAGAAGTCTC	1335	166	yes
GATCCAGTTACCAGAAGATG	406	114	yes
GATCCAGTGTGTTGCTGGCA	159	9	yes
GATCCAGTGTGCTGGTCTTT	7	5	yes
GATCCAGTGGCAGCCTCAGC	192	8	yes
GATCCAGTGCTGGGGAGATG	1	1	yes
GATCCAGTGCCTCATTGTTG	135	18	yes
GATCAGGAGAAGGAATTCCT	6	6	yes
GATCAGGACTACCTTATGGC	4	4	yes
GATCTCAACTGACTCCTCTA	8	12	yes
GATCCAGTGAGAGCCAGACA	102	22	yes
GATCCAGTGACGTCAGACGC	51	10	yes
GATCCAGTCTGTCCTAGATG	156	34	yes
GATCCAGTCCTGGAGGACAG	438	39	yes
GATCCAGTCCATTCAGCAGT	115	6	yes
GATCCAGTCAGGACATATGA	64	13	yes
GATCCAGTCAGCCCCTGGGG	215	77	yes
GATCCAGTCAGCAGCGTGGA	7	5	yes
GATCCAGTATCTGAAAGACC	302	35	yes
GATCCAGTATCTACAAAGAC	2	3	yes
GATCCAGTACTTGGTTTGTG	30	10	yes
GATCCAGTACTATTTTTGAG	3	4	yes
GATCCAGTACTACCAGAATG	37	5	yes
GATCCAGTACCTGTAATACA	28	9	yes
GATCCAGGTTCAGTAAATTA	5	4	yes
GATCCAGGTTCACCACCGGG	66	13	yes
GATCCAGGTTCAATTTCCAG	31	23	yes
GATCCAGGTGTGCTGAGTGG	176	21	yes
GATCCAGGTCCGTGAACCCC	123	36	yes
GATCCAGGGTGTGCAGTGGG	230	25	yes
GATCCAGGGTGCCCCTCCAA	121	2	yes
GATCCAGGGGGGACACCTGC	14	21	yes
GATCCAGGGCTCAGGAGCAC	3	4	yes
GATCCAGGGCGATGTTGGGG	52	14	yes
GATCCAGGGCCTGTGAATCA	11	9	yes
GATCCAGGGCCTGGTGGAGG	159	3	yes
GATCCAGGGCCTCTGCGCCT	28	5	yes
GATCCAGGGCCACTTTGTCT	11	4	yes
GATCTGGCACTGCTTTAGCC	62	11	yes
GATCAGCCTGTCCTATTCCC	5	1	yes
GATCCTTCAGAACACTGCTG	9	7	yes
GATCCAGGGAATCAAGGAAT	2	2	yes
GATCCAGGGAAGCCTGTGCT	2	1	yes
GATCCAGGCTCTGATGTTTC	14	1	yes
GATCCAGGCTCGGGAGCTAA	120	7	yes
GATCCAGGCTCACAGTGTGA	63	9	yes
GATCCAGGCGGCCAAGAACT	55	4	yes
GATCCAGGCGGAGGATGACG	6	3	yes
GATCCAGGCCTCCCTTCTTG	94	9	yes
GATCCAGGCCTACTTCGCGT	29	3	yes
GATCCAGGCAGCTGTGTACA	20	18	yes
GATCCAGGCACGTGATTCTC	29	7	yes
GATCCAGGAGTTCAAAGAGG	187	179	yes
GATCCAGGAGGGGTTTGCTC	36	10	yes
GATCCCCTGGAATGGAGCTA	3	2	yes
GATCCAGGAGCACGTGAAGA	28	20	yes
GATCCAGGACCTGGAAGTAT	75	2	yes
GATCCAGGAAGTTTTGTTGT	131	10	yes
GATCCAGGAACTACTCCACA	55	6	yes
GATCCAGGAAAGCAGCCTGT	265	17	yes
GATCCAGCTTTTTCCTAATA	8	6	yes
GATCCAGCTGGGCGAGGATG	91	14	yes
GATCCAGCTGGGCAAAATTC	7	6	yes
GATCCAGCTCCTAAACTGTT	68	16	yes
GATCCAGCTCAGGCGGTGTC	26	2	yes
GATCCAGCGCTCTCGGGACT	28	19	yes
GATCCAGCGAGAAAGAAGAA	41	61	yes
GATCCTGTGTCCCCTGGGCG	138	25	yes
GATCCAGCCTTACTGGACTA	2	3	yes
GATCCAGCCTGAGCTCAGTG	141	25	yes
GATCCAGCCTGACCTGCACA	276	59	yes
GATCCTGTCATTACAGCAAA	5	3	yes
GATCCAGCCCATACAGAAGA	5	3	yes
GATCCAGCCAGTCTTCAAAG	4	6	yes
GATCCAGCCAGTCTCTCATT	22	16	yes
GATCCAGCATTTAAATTTCT	264	16	yes
GATCCAGCAGTTAAAGCAGT	101	75	yes
GATCCAGCAGTATTTTTTGT	15	11	yes
GATCCAGCAGAGAGGGCAGG	8	6	yes
GATCCAGCACCGTGTGTACC	229	50	yes
GATCCAGCACATACAAGTCT	25	5	yes
GATCCAGCAAACTTGGTTGG	23	7	yes
GATCCAGCAAAACTACTGCT	2	1	yes
GATCCAGATGGCCTCAAACT	3	4	yes
GATCCAGATGATGGTTCTTT	261	33	yes
GATCCAGATACAACGCTCAC	67	23	yes
GATCCAGAGTGGCACAGGGT	251	30	yes
GATCCAGAGTGGAACTGTCC	40	12	yes
GATCCAGAGTGACGTGCTCA	48	6	yes
GATCCAGAGGGGGTGCCTTT	4	6	yes
GATCCAGAGCTTCTGCAAGG	8	5	yes
GATCTGGACCTGAAGAAGCT	4	4	yes
GATCAGCAACTCCTGCTTCA	45	15	yes
GATCCAGAGAGATGGGTCAG	3	3	yes
GATCCAGAGAGACTTGGTTG	85	15	yes
GATCCAGAGAACTCAGCTGT	98	28	yes
GATCCAGAGAAAGCAAAGGC	38	7	yes
GATCCAGACTTGCCTTATAA	112	78	yes
GATCCAGACGAATCTTGTCA	2	3	yes
GATCCAGACCTGCCACAGAC	104	5	yes
GATCCAGACCCGGGAAGGGA	124	4	yes
GATCCAGACAGAATGTCAAG	1	1	yes
GATCCAGAATTGCTTTCCCA	134	24	yes
GATCCAGAAGTTGGGAAAAC	46	11	yes
GATCCAGAAGCAGTGGAATC	2845	102	yes
GATCCAGAAGAACCTACCAC	3	4	yes
GATCCAGAACGACCTGAACC	9	6	yes
GATCCAGAACCTCTCAGCCA	8	7	yes
GATCCAGAACATTCTAGAAA	72	50	yes
GATCCAGAACAGTACAGCGT	217	43	yes
GATCCAGAAAGAACGATTTG	75	55	yes
GATCCAGAAAGAAAATGTCA	30	24	yes
GATCCACTTTGTGATATTTG	5	4	yes
GATCCACTTGGGCTCTGTCA	79	10	yes
GATCGCCACCTACCGCCGCC	9	16	yes
GATCAAGGCTGCCCAATACC	3	2	yes
GATCAATTTGTCTTTACCTC	11	11	yes
GATCTATGCTGGTGACGTAG	14	2	yes
GATCTTGTGTTTTGCTATCC	1	1	yes
GATCTTGTGTTCTTTGTGCC	10	6	yes
GATCAAGTTTGCCGTCCATG	22	4	yes
GATCGCCTTAACTACTGTAA	1	1	yes
GATCCTGTGCGCACAAACTT	27	19	yes
GATCGATTATTTCAGGGAAG	3	3	yes
GATCTTGCTGTTGTGGATGT	24	17	yes
GATCCTGTAAGGCACTGGTG	5	4	yes
GATCAAACATCTGTCTGTCT	17	11	yes
GATCCACTGGTGGGAGAACG	5	7	yes
GATCAAGATAAGTGGGGAAG	6	6	yes
GATCTGATTTTAAGGGAAAT	114	26	yes
GATCGACTTGGATTACAGAA	32	12	yes
GATCCTCAACGAGGATGGCA	373	42	yes
GATCCTATGTTGCTGGAGCT	48	31	yes
GATCCTATCAGACATGGTGA	3	2	yes
GATCCTAGTGGGTCTACCAG	52	33	yes
GATCCTAGTGCTGCTCTGGC	121	10	yes
GATCCTAGGTGTCTTCTGTT	2	2	yes
GATCCTACTGGGGAAGGCCA	137	48	yes
GATCCGACAGCGACGTGACC	20	2	yes
GATCCTACCGCCTTTAACAA	89	56	yes
GATCCTACAGAAGGCCCACT	7	9	yes
GATCAAGAATTTGGTGTCGA	144	179	yes
GATCCTAACTAGCAAGGGTT	51	8	yes
GATCTGGAGCTCCTGGGATG	6	9	yes
GATCTGGAGCCTCCACGATG	63	7	yes
GATCCTATTGCTCTGTCTTT	4	3	yes
GATCTGGAGAAGCGACGTAT	77	30	yes
GATCTGGACTTCTGAATCTG	29	10	yes
GATCTGGACTGTCCATGTAC	51	43	yes
GATCTGGACCTCACCTCTGA	17	11	yes
GATCCACTTGTGCATGTAGT	20	4	yes
GATCTGGAAGTTTCGTAGGC	516	13	yes
GATCTGGAAGTTGGCAGATG	14	11	yes
GATCTAAAACTCACTCCATG	9	4	yes
GATCGTATTTGGAGTTTGCT	3	2	yes
GATCAACACATTCTGGTTCC	30	4	yes
GATCAACAAGGAAGAGGTTT	2	2	yes
GATCAACAAATCTCCTAGGC	19820	4142	yes
GATCAACAAAGAAACAACTA	33	33	yes
GATCAACAAAACTGTACCTG	11	11	yes
GATCAAATTGGTCTTCACCT	15	10	yes
GATCAAATTGGTACAGAAAT	54	16	yes
GATCAAATTCTACTAAATGG	1	1	yes
GATCAAATGTGCCATAGCAC	132	13	yes
GATCCGTGTCCCTGCGTGCA	179	112	yes
GATCAAATGCTCTTATCATT	5	5	yes
GATCCGTGGGCCTGGCCTCC	86	58	yes
GATCCGTGGACAGTCTTCAC	2	3	yes
GATCAAATGAGAACACTGCT	70	21	yes
GATCAAATCCAGATGCAGCA	2	4	yes
GATCTGGAAGAGACTTTGGC	125	30	yes
GATCTGGAACAGTTTTTGGC	10	7	yes
GATCTGGAAAGCTCTGGGGA	37	25	yes
GATCTGGAAACACTGTAGCA	3	3	yes
GATCTGGAAAACGCTGGAGA	23	22	yes
GATCTGCTTTGGACCATTTG	338	18	yes
GATCTGCTTGCCAGGCCACT	7	5	yes
GATCAAGAATTTGGTGTGGA	27980	4230	yes
GATCTGCTTCCAGGTCCTCA	103	32	yes
GATCTGCTTAGCTCCAAGGA	2	2	yes
GATCTGCTGTCCAGAGCAAG	60	39	yes
GATCTGCTGGAGGGACTTCA	26	7	yes
GATCATCCCCACAGCGGAGC	2	3	yes
GATCTGCTGCTGGTGCTTGC	23	16	yes
GATCCTAGAATGTTTGTAAG	12	8	yes
GATCCCCTTTCTCTATGTCT	92	60	yes
GATCAAATCACTGGCAGACA	51	35	yes
GATCAAATCAAAGACCTACG	14	14	yes
GATCAAATATGTGGAGATTT	15	4	yes
GATCAAAGTTGTTTCACTGT	95	11	yes
GATCAAAGTGCCAACAGCGG	30	23	yes
GATCAAAGTGAGGGAAGCGG	38	8	yes
GATCAAAGTCTCCATAGTTG	65	16	yes
GATCAAAGTCATTGCGGTTA	21	5	yes
GATCCGGGCAGCCCAGGAAA	16	12	yes
GATCAAAGTACTTGTTAGGG	55	38	yes
GATCAAAGGCTTCAATCACA	26	21	yes
GATCAAAGGAGACTGGCAGC	48	15	yes
GATCAAAGGACTTCTTACAA	10	10	yes
GATCCGGCCCTACTGTGTGT	94	6	yes
GATCAAAGGAAAGGGGAGGG	257	168	yes
GATCAAAGCTGGCAAGGTTC	186	51	yes
GATCAAAGCTGGCAAGGTAC	75	19	yes
GATCAAAGCCGTTCTTTTCC	33	10	yes
GATCAAAGCCCGGAAAGGCA	1645	196	yes
GATCAAAGCCATTTTTCTGG	23	15	yes
GATCAAAGCCACGGGGTCAG	21	21	yes
GATCAAAGCCAAGTATCCTG	55	12	yes
GATCAAAGCAGCTGCCTTAC	5	5	yes
GATCCGCTGTACTCTCCTCC	99	6	yes
GATCCGCGCTGAGGAGCAGC	4	4	yes
GATCTGCTGCAGGACCTGGG	4	6	yes
GATCCGCGAATGCTCGGAGG	392	7	yes
GATCTGCTGAAGGAGAAAGC	49	12	yes
GATCTGCTCTTCAATGTTGT	51	13	yes
GATCTGCTCTCTGGCCTCCC	28	18	yes
GATCTGCTCTCGGGCCTCGC	114	22	yes
GATCTGCTCCCTGTATGTGC	91	11	yes
GATCCGCAGTGGCATGTTCT	356	34	yes
GATCCGCAGCGCCTCTTCTT	9	9	yes
GATCCCTGTCTAAGCTAGAT	22	22	yes
GATCTGCGTCTCAGCTCAGC	12	5	yes
GATCCTAACTTACTCCATTT	79	9	yes
GATCCGTTGCTGACCTTGCG	14	9	yes
GATCTAAGGAAAAGCAGTCC	4	4	yes
GATCCAGGACCCCCATCCCC	43	8	yes
GATCCCAGCCCACAGGATGT	1	1	yes
GATCAAAGAGTTCAGCAAGA	36	4	yes
GATCAAAGACTTGGAGCCTG	5	5	yes
GATCAAAGAAATTTTGAGTT	1	1	yes
GATCAAACTGAGTCTGAAGG	335	36	yes
GATCATATCTGAGAGGGGCT	9	9	yes
GATCAAACTAATCAGGCATC	24	5	yes
GATCAAACGAGTTGTGTGTC	41	4	yes
GATCAAACCAGCCTGTTTTT	42	12	yes
GATCAAACAGTAAAGGTGTG	42	16	yes
GATCCGACTGCAAAATTCAT	6	3	yes
GATCAAAATGTTTGTTGCTT	34	18	yes
GATCCCTTTCACACACCTGC	3	4	yes
GATCAAAATGTGGTGCCAGA	95	23	yes
GATCCCTTGGCATAGGGCCC	357	249	yes
GATCCGTGTGTGAACTAAAA	35	5	yes
GATCCCTCCCAGAAACCTGG	5	9	yes
GATCCCTGTGCCTAGCTGCT	85	61	yes
GATCACATGATAATTTGCTG	30	22	yes
GATCCGTGACATCGAGGAAG	10	9	yes
GATCTGCCTCCCCCAGCATG	79	52	yes
GATCTGCCTCCCAAGTGCTG	29	14	yes
GATCTGCCTCAGTCCACAAG	46	16	yes
GATCTGCCTATCTGTCTATC	6	4	yes
GATCCGTCACAGAGAGCAGG	2	2	yes
GATCTGCCGTGCCCACCAAT	11	8	yes
GATCCGTACAGCGGCAAAAC	515	76	yes
GATCTGCCCTTTCTTCAGCA	66	5	yes
GATCTGCCCTGTATTGTTAA	4	3	yes
GATCCGGGTTCCTGACCCCA	76	59	yes
GATCTGCCCCTGACCCTCCA	80	15	yes
GATCTGCCCATAAGACTTCC	52	6	yes
GATCACGGCAGTGTGCAATT	3	4	yes
GATCAAAATGCTTGGAGAAA	19	28	yes
GATCAAAATGCCTGAGCTGT	6	6	yes
GATCAAAATGAGGCAGAGGA	88	66	yes
GATCAAAATCGCAGTTACTG	19	12	yes
GATCACAGTCTTTCAGCTAT	4	7	yes
GATCAAAATATGCTGCAGAC	70	62	yes
GATCAAAAGATATGGTCCTT	34	22	yes
GATCCCTGGTCCTTAGGTGG	148	27	yes
GATCAAAACCTGTGACGGAG	2	1	yes
GATCAAAACCTCTGAGGCTG	2	3	yes
GATCAAAACAGGTCCAGAAG	8	7	yes
GATCAAAACACGATGTCCAA	7	7	yes
GATCCGGGGCCTCTGGAAAG	46	12	yes
GATCTGCCCACCATATTCCT	44	18	yes
GATCTGCCCAAAGAAACCCT	5	5	yes
GATCTGCCAGGGCATGGCAT	139	7	yes
GATCTGCCAGGAACATGAGA	2	2	yes
GATCTGCCAGCCGTACATCC	26	6	yes
GATCCCTGATTGCCTCCATG	755	147	yes
GATCCCTGATGCAAAAGAGA	349	78	yes
GATCCGGCTCCAGATTCAGG	5	7	yes
GATCTGCAGTTGCTCCAGCA	5	5	yes
GATCTGCAGGTGGGGCTCGG	24	19	yes
GATCTGCAGGTGCCTGGGAA	17	11	yes
GATCAACTTGACACAACTTT	1	1	yes
GATCCCTCTGCAAACCAAAC	296	92	yes
GATCCCTCTCCCAGCTCTTC	141	93	yes
GATCATGAGCAAAAGAAGAA	165	119	yes
GATCTGCAGGAGGATGTTGA	1	1	yes
GATCTGCAGGAGGATGCCTG	257	115	yes
GATCTGCAGGAGCCGTTTGC	32	5	yes
GATCCGCGCCTGTGGGGAGC	54	36	yes
GATCTGCACAGAGATGCTTC	6	6	yes
GATCCAAGTCGCTCAGTTGA	1	1	yes
GATCACCACTCAGGTGACTA	16	4	yes
GATCCCTCAGTGTAGCATAG	30	13	yes
GATCCCTCAGCTTTCTCCAA	143	18	yes
GATCTGCAAACGGGAAGGAG	7	7	yes
GATCTGATTTTGACCAAGAT	104	5	yes
GATCCCGTCAACTTCAAGCT	2318	1136	yes
GATCTGATTTTACAGCTCAG	3	3	yes
GATCCGCAGACGTCACTCTG	25	14	yes
GATCCCGGGGCAGTCCAGCC	45	5	yes
GATCAAATTCCCACTGCCCC	1515	124	yes
GATCTGATTCCCGCAGGTTC	123	4	yes
GATCCTTTGGACCGGGGCTT	108	138	yes
GATCCCGGGCAATGCTTTCA	33	22	yes
GATCTGTGAGATGAAGCTGG	95	64	yes
GATCGGCCCCAACGATGGCT	4	4	yes
GATCCCCTTGGGATTAAAGG	25	25	yes
GATCTGTGCATGTTATTTTT	41	7	yes
GATCCGACTTTAATCACTCA	6	6	yes
GATCCTGTCGTACCTGAAGT	2	2	yes
GATCTGAGTTTTTTGTGCAG	25	37	yes
GATCTGAGTGTCGGCACCAG	35	35	yes
GATCTGAGTGGGCAGCAGCC	53	20	yes
GATCCTGGCAGGCTACCTAG	2	3	yes
GATCCCCTGAGAAGCTGTAT	45	4	yes
GATCATAAAGTGAGACTCCT	14	9	yes
GATCCCCTCCCCCAGCTAAA	24	24	yes
GATCCCCGGCGTCTGTTTGA	2854	2008	yes
GATCTGAGGCTGAGGGTATA	12	12	yes
GATCTGAGCCCCCTGAGGTT	39	25	yes
GATCCCTGGAGCCACCAGCT	4	4	yes
GATCTGAGATGAGCAGTGAC	10	6	yes
GATCCCTGCTTTCATGGAAG	53	39	yes
GATCTGAGAAACGGGGAAGC	12	12	yes
GATCCTCACCCTTCTGTGGC	14	10	yes
GATCCCTGAGAAGTTCCAGC	4	3	yes
GATCCCAAGGAATGGGCAGC	7	5	yes
GATCTGACTCCCTCTTCTGT	39	24	yes
GATCTGACTCCACTGCCCAG	219	167	yes
GATCTGACGCCGAGGAGGTA	31	19	yes
GATCTGACCTGTTAACCCAT	6	8	yes
GATCTGACCTGGGTCCTGAC	18	11	yes
GATCCCTCAACCCACACATT	5	5	yes
GATCCCTATGGACACTGACA	138	16	yes
GATCCCTAGTGACTCGTTTA	35	22	yes
GATCAAAAGAAGTGTTCCTA	15	15	yes
GATCAGCACCTGCATCCTGC	22	5	yes
GATCTATTTTTGCACTGGAA	267	66	yes
GATCAGACTTTTAGCTGCTA	22	5	yes
GATCGCAGCATGGAAGGCAA	19	6	yes
GATCGAGGTAGAGAGAAGCC	15	15	yes
GATCCCGCTCCCATCTGTTT	2	3	yes
GATCCAAGGGAAACCACCGT	4	4	yes
GATCCAAGAGGACATGGACT	3	3	yes
GATCCAAGAGCAGGAGCAGG	23	18	yes
GATCCACTTCAGAAGCAGCC	91	6	yes
GATCCACTGTTGTCCAGAGG	41	6	yes
GATCCACTGTGTGTCTGGTA	40	11	yes
GATCCACAACAATGGCCAGT	2	3	yes
GATCCACTGTCTTCCTAGAG	135	20	yes
GATCCACTGTAATGTATTAT	37	13	yes
GATCCACTGGGCCAAGGAGC	28	20	yes
GATCCACTGGCTGGATATAG	110	26	yes
GATCCACTGGAGATACAGGT	15	11	yes
GATCCACTGGAAGCAGCACG	7	6	yes
GATCCACTGCTGGAAGTACC	571	46	yes
GATCCACTCTTTTCATACCC	80	10	yes
GATCCACTCGGGGGCTGTGA	63	22	yes
GATCCACTCCTGCAGAGCAC	83	16	yes
GATCCACTCCAGGCTGCGAG	202	19	yes
GATCCACTCAGACGAACAGT	67	3	yes
GATCCACTACCAATCTCGTA	6	3	yes
GATCCACTAATGCAGCTGGT	66	11	yes
GATCCACGTCTCGTCGTCAG	586	38	yes
GATCCACGGGGCACCCGCAC	35	24	yes
GATCCACGGACACCAAGTTA	139	11	yes
GATCCACGACAGAGTGGAGA	18	14	yes
GATCCACCTGTTTCTATCTC	4	4	yes
GATCCACCTGTGGTGCTAGT	60	11	yes
GATCCAACTGCCTTTGCCTC	74	2	yes
GATCAGAGCTACACAATGGC	14	3	yes
GATCAGAGCCTCCTGAGAGA	3	4	yes
GATCAGAGCCGCCTGACTTC	134	4	yes
GATCAGAGCATAGCCTATGT	13	9	yes
GATCAGAGCAGGAAGTTTTC	7	3	yes
GATCAGAGACACGGAGCTGG	8	8	yes
GATCATGTTCCGCCAGCGGT	24	17	yes
GATCCACCTGCTTCTCCCTT	66	18	yes
GATCCACCTGCTGCTGCCTC	61	5	yes
GATCCACCTGCCTGTGCCTC	230	24	yes
GATCCACCTACTTTTTCAGC	1	1	yes
GATCCACCTACCTGCCTCTC	6	6	yes
GATCCACCCCTATCTGAGAA	14	12	yes
GATCCACCCCTAAAATCCTG	4	4	yes
GATCCACCCACCCTGGGCAT	92	23	yes
GATCCACCATCTGTAATGTC	108	8	yes
GATCCACCAGTGCTTCTGCT	149	4	yes
GATCCACCAGTCCTTGAAGC	35	25	yes
GATCCACCAGGATGTTTGAT	20	12	yes
GATCCACCACATGTGCCAAA	65	48	yes
GATCCACCAAGTCCTGGCCC	81	12	yes
GATCCACATTTGCTGGTTTG	689	80	yes
GATCCACATTGCTGTCCTAT	62	24	yes
GATCCACATTCTCCATTCTA	4	3	yes
GATCCACATTACCATCAAGC	23	4	yes
GATCCACATGTGCTCGCAAA	73	18	yes
GATCCACATGTACCATCAAC	46	2	yes
GATCCACATGCGTGTAGCAG	320	23	yes
GATCCACATGAGGAGATACT	168	32	yes
GATCCACATCTCCCTCCCCT	51	20	yes
GATCAGACAGTTAAACTGTG	15	15	yes
GATCTGCCTTGGGAGAGGGC	31	9	yes
GATCGCCCTTCCCAACAGTT	1	1	yes
GATCCACAGTCAGCAAATCC	16	2	yes
GATCCACAGGGTACCTCCCT	289	33	yes
GATCCACAGGCAGTTGTGCC	38	14	yes
GATCCACAGGAGGGTTCCAA	130	19	yes
GATCCACAGATTCTGCCTGT	160	14	yes
GATCCACAGAAGCACTGCAG	34	7	yes
GATCCACACTTCTGAAGACT	28	20	yes
GATCCACACTGCCACTAAAA	253	30	yes
GATCCACACGGAAGGGGAAA	13	9	yes
GATCCACACCTGAAATGCTA	7	3	yes
GATCCACACCCTAACTCCCA	71	22	yes
GATCCACACACGACTCTCCA	152	18	yes
GATCCACAAGTCTTAGCTGT	197	9	yes
GATCCACAAGCGACTCATTG	3578	173	yes
GATCCACAACCTGATTCCCG	242	18	yes
GATCCACAAATGCATGGATT	8	5	yes
GATCCACAAAACCAATAAAA	1044	89	yes
GATCCAATTGTGGTGTTCTG	36	10	yes
GATCTGGCTCTAAGTTTTCA	11	6	yes
GATCATTTTTCTCCCAAAAA	61	7	yes
GATCAGAAGGCTGAGCACTG	18	18	yes
GATCTGCCATCCCCTTCAGA	45	30	yes
GATCAGAACACCCCACATTT	10	10	yes
GATCTGCCACTGAAGTAGAC	16	6	yes
GATCATTGCCAAGCCAGGCT	5	7	yes
GATCCAATGGTTTTGCCTCA	24	17	yes
GATCCAATGCTCTATCAAAC	17	0	yes
GATCCAGAGGCAGGTGCAGA	103	23	yes
GATCCAATCTTTGTCTTAGG	111	5	yes
GATCCAATCGACTGGGTTTC	252	19	yes
GATCCAATCCCTGTGCAGCA	5	5	yes
GATCCAATAGTGAACAAAAA	32	32	yes
GATCCAATACTGTCTGGAAA	8	10	yes
GATCAGATGTTGGCTTTGTA	10	6	yes
GATCCAAGTTTGGATAATGA	528	31	yes
GATCCAAGTTGTACATGAAT	52	8	yes
GATCCAAGTTCGAAACATGG	8	7	yes
GATCCAAGTGTTTAACCATA	718	100	yes
GATCCAAGTCCAGGAACCCT	158	25	yes
GATCCAAGTCATGATTTGAA	748	26	yes
GATCCAAGTATTGGCACCCA	36	8	yes
GATCCAAGTACTACCATAGG	56	22	yes
GATCCAAGTACACCTAAGGG	148	8	yes
GATCCAAGGTCAAGGCAGAG	111	11	yes
GATCCAAGGCCTCAGGTCAC	422	36	yes
GATCCAAGGAGTGGTACCCA	36	14	yes
GATCCAAGCTCTGGGAAGCA	2	3	yes
GATCCAAGCTCATCATTTGC	60	18	yes
GATCATTCGTAGACAAAGTT	23	5	yes
GATCATTCCCACAGCCAAAA	3	2	yes
GATCCTAACAAAGGCCGGGA	34	22	yes
GATCACTTGGAAAAATATCT	2	2	yes
GATCACTTCTGTTATCAAAG	7	5	yes
GATCCAAGCGTGAGCCAGTC	35	11	yes
GATCCAAGCAGGTGCTTCCT	1	1	yes
GATCCAAGCAGGCTTGAATA	41	12	yes
GATCCAAGCAGGCCCCTTAT	44	11	yes
GATCCAAGAGGAGGAGCACA	49	16	yes
GATCCAAGACCAGGGTGGCT	155	7	yes
GATCCAAGAAGTCAGTCGGC	24	8	yes
GATCCAAGAAGAAAAGCAAG	19	14	yes
GATCCAAGAAAGGAAGAAGA	32	21	yes
GATCCAACGTGTTAGCCTTG	73	9	yes
GATCCAACGTGGTCTTTAAG	90	9	yes
GATCCAACGTAATCTTTAGG	14	5	yes
GATCCAACGAGTAGGAGTGT	39	9	yes
GATCCAACGAAAAACACTTG	85	5	yes
GATCCAACCCCACCTCAAGT	47	32	yes
GATCCAGCACGCTCAACATC	5	5	yes
GATCCAACCAACCTGAAGAA	10	9	yes
GATCCAACATTGTCTTCTGG	5	6	yes
GATCCAACATTGACTTTCTT	59	12	yes
GATCCAACATGGAAGGTGTA	75	57	yes
GATCCAACAAAGGTTGTGAG	395	54	yes
GATCACTTCCTTCTGGAATC	7	6	yes
GATCACTGTCGTGTTTGGTA	96	8	yes
GATCCTTCTTTGTCTTCAGA	35	6	yes
GATCACTGGCCCCGATGGTG	16	4	yes
GATCACTGGAGCAGGCCTCC	90	8	yes
GATCATGCTTACCCTGGACT	7	8	yes
GATCCAAATGGGATTTCCCT	25	22	yes
GATCCAAATATTGTCATAGC	318	20	yes
GATCCAAAGTTGGCCAGCAT	207	40	yes
GATCCAAAGTGTTATGTCAA	7	10	yes
GATCCAAAGTCACACCTCCA	163	32	yes
GATCCAAAGGCAGCAAGAAG	14	21	yes
GATCCAAAGCTTTCCCATTT	15	6	yes
GATCCAAAGCTGCTTAAATC	256	50	yes
GATCCAAAGCTCAGGAGACA	9	3	yes
GATCCAAAGCCCCAGTAGAA	12	5	yes
GATCCAAAGCAGTGCTCCCA	190	25	yes
GATCCAAAGAGAGAAAGAGC	63	18	yes
GATCCAAAGACTCAGGTGTT	5	5	yes
GATCCAAAGACACAGTCTGT	566	67	yes
GATCCAAAGAAGACAAAATG	69	18	yes
GATCCAAACTTAACGAGCCC	113	24	yes
GATCCAAACCCCAGTGTACC	158	27	yes
GATCCAAACCCAGAGACCAA	3	0	yes
GATCCAAACACTTTTATTTT	8	10	yes
GATCCAAACAAGAAGACTGA	11	10	yes
GATCCAAACAAAGACACAAG	101	10	yes
GATCCAAAATGTGGCATTTT	23	17	yes
GATCCAAAATGCTACTGTTA	19	7	yes
GATCCAAAAGGTTACTGAAA	294	40	yes
GATCACTGCAGCCCCAAACT	18	13	yes
GATCTGATTGACATTCCTCC	8	7	yes
GATCATGCACAAACCACTAC	2	3	yes
GATCATGACTCTTTGAGATT	7	6	yes
GATCTGATGCCCTCTTCGGG	27	40	yes
GATCACTCTCTCACACCACC	58	31	yes
GATCCTGAGGTTTAGGAAGG	8	6	yes
GATCCAAAAGCCTGCTCGGT	41	13	yes
GATCCAAAAGCAGCGTTTGC	58	10	yes
GATCCAAAAGAGCCTGATGG	47	10	yes
GATCCAAAAGAAGAAAAAAA	5	7	yes
GATCCAAAACAGCAAATAGG	126	9	yes
GATCCAAAAATGGGGATGTT	97	27	yes
GATCCAAAAATACAGCCTGC	9	13	yes
GATCCAAAAAGCTAATAAAA	137	105	yes
GATCATTTTTTGTCTTACTA	2	2	yes
GATCATTTTTTACTGTGGGT	4	4	yes
GATCATTTTTCTGTAGCCAT	34	10	yes
GATCATTTTTCCAGAACTCT	36	7	yes
GATCATTTTGTTTCCATTTA	18	3	yes
GATCATTTTGTCGAGTGAGT	231	26	yes
GATCATTTTGTAAAGTACAG	102	7	yes
GATCATTTTCTTGGTTGACC	14	14	yes
GATCATTTTCTGACTTTTGT	67	10	yes
GATCATTTTCCCAACGTTAC	39	3	yes
GATCATTTTCAAGTTACCCA	1	1	yes
GATCATTTTACTGGTGACTT	8	8	yes
GATCATTTGTGTGGCCGTTT	14	2	yes
GATCACTCCTTGCTTTGCCA	3	5	yes
GATCACTCAGGGTGGGCAGT	11	11	yes
GATCACTCAGGACGGTACCC	3	2	yes
GATCACTCACGAGAACATCT	42	8	yes
GATCACTAGCAAGCCAAAAT	15	14	yes
GATCACTAAGTTGAGCAGTT	40	5	yes
GATCATCGATGTGGACCTCG	39	27	yes
GATCACTAAAGGGTTTCCTG	42	3	yes
GATCACGGTCACTTTCAACA	98	32	yes
GATCATTTGTCCAGGAGTGT	44	9	yes
GATCATTTGCGTTTGGAGGT	63	29	yes
GATCATTTGCCTCTTATTTG	11	11	yes
GATCATTTGATTCCCCTCCC	2	2	yes
GATCATTTGAAAACTGAGAA	17	11	yes
GATCTGCGCTTCCAGAGTGA	16	28	yes
GATCATTTCTTTCTGGCCTG	153	9	yes
GATCATTTCTCGCTCAGATT	59	38	yes
GATCATTTCGGTGACTGAAG	15	16	yes
GATCATTTCAGTGAGATTGG	2	2	yes
GATCATTTCACTGGTGGCTG	71	8	yes
GATCATTTACAAACTCCAGA	72	17	yes
GATCATTTACAAACTCACAT	14	8	yes
GATCATTTAACTGGCATTTT	29	10	yes
GATCATTTAAAATTCTGTGC	2	3	yes
GATCACGGCATCGAAAGGAA	330	55	yes
GATCTGAGTGGCATCCAGCT	13	13	yes
GATCACGCTGAGGGTGTCTG	2	1	yes
GATCATCAGTACCCACCGTC	5	5	yes
GATCCCGGACAAGGAGTTCC	4	1	yes
GATCCTAACACATGTTTCTT	5	4	yes
GATCATTGTGGCCCCGCCCC	33	33	yes
GATCATTGTGAACACCTCGT	5	5	yes
GATCATTGTCAACTAAGTGC	2	2	yes
GATCATTGTAATGTTGACAT	5	3	yes
GATCATTGCCACGGAAAACA	4	4	yes
GATCATTGCATTTGTTGTCT	9	5	yes
GATCATTGATGTTGTCTACA	20	20	yes
GATCATTGAGAGCAAGCGAG	12	12	yes
GATCATTGACAAACTGGAAG	2	2	yes
GATCATATTGCCCTGCATCT	15	10	yes
GATCTGAGATACCAAGTCAG	1	1	yes
GATCACCGCTGCCGCCTGGG	4	4	yes
GATCACCGCCTGCACCGCAG	163	45	yes
GATCATACCCGTCCCTCTCT	2	1	yes
GATCACCCTGTCTCTTTACC	4	4	yes
GATCACCCTGGGCCTGGTCA	67	43	yes
GATCCCTGGAACCTGCAGTT	4	3	yes
GATCATTGAAATCGTATCTT	6	6	yes
GATCATTCTTGGCTACATAG	55	11	yes
GATCATTCTCCAAAGGCAAC	168	19	yes
GATCATTCCATAGGAAACAT	11	7	yes
GATCATTCAGGACAAAGGAG	182	20	yes
GATCATTCAGACAGTACATT	5	4	yes
GATCATTATTTGTGTCAGAA	2	2	yes
GATCATTATGTGCTGAAAAT	17	11	yes
GATCATTAGGGGTTTGGTCT	117	16	yes
GATCATTAGCCCACATACCC	16	24	yes
GATCATTAGCATGCCAGGAA	46	8	yes
GATCATTACTGTGTGAGTGT	17	5	yes
GATCATTACACGGAGAACAC	8	6	yes
GATCGCTCGAACTTAACCAG	2	2	yes
GATCAAGCTTGAAAAAGTTT	17	7	yes
GATCATCTCTCCCAGTAAAT	1	1	yes
GATCTCACTTTCTTGGTATT	2	2	yes
GATCAGGAAAACCATCCATT	24	14	yes
GATCCTTGTCCTCACTCTCC	180	26	yes
GATCAGCGAGCCCACGGTGG	69	52	yes
GATCTCTCCATATCAAGCGT	13	22	yes
GATCCTTCTGAATGCCTGCT	35	7	yes
GATCTGGATTTTAGGTGGTA	44	28	yes
GATCCTTCATTTGGGTGGAG	109	10	yes
GATCCTTGCAATACCCTGTC	15	28	yes
GATCTGTTTACAAGGTTTGT	23	15	yes
GATCCTCACGTCCTTTGTGG	4	2	yes
GATCCTGTCAAAAAAAAAAA	61	16	yes
GATCCCCACTTATGTGACTG	3	4	yes
GATCCCCAATATGCTGTTGA	87	11	yes
GATCCCCAAGGCAGCTACCA	27	27	yes
GATCCCTTCTCTGACCTTTG	9	5	yes
GATCCCTTCTCATACTTGGC	74	2	yes
GATCCAAAGCTGGCTGAAGG	4	6	yes
GATCCCGGATTTGCTCCTGT	4	4	yes
GATCCACGATTAAAGAAGCA	2	2	yes
GATCCCAGTGGATGAGCATG	65	8	yes
GATCTGACCCACCACGGAGA	79	27	yes
GATCTGACCAACTAGCTTTT	6	6	yes
GATCTGACAGGACCGCAGAG	7	7	yes
GATCTGACACTCTTCTGGAG	17	17	yes
GATCCCAGCACCGAGGGGAA	65	10	yes
GATCCCGGACGCGAACCCGG	5	5	yes
GATCTGAAGTTCAAATTCCG	6	9	yes
GATCCACAAAAATTTAACAG	16	15	yes
GATCATTGGGGTCATCTTGT	2	2	yes
GATCCCAGAATCCAAGAAGT	3	2	yes
GATCCCACTGCACATAGGAC	10554	2026	yes
GATCCCACGGGGTGCAGTGA	225	37	yes
GATCCCACGAAGAATTCTTC	26	7	yes
GATCCCACCTAGCAGCCACC	163	38	yes
GATCAAACTGGCCTGCAAAA	5	5	yes
GATCTGAAGGAGTCCAGGGT	7	7	yes
GATCTGAAGAGGAATCTGTA	3	3	yes
GATCTGAAGAATTTTGAAAG	69	53	yes
GATCTGAACTTTGTACAGGA	204	15	yes
GATCTGAACTGTAGAGACCA	10	15	yes
GATCAAACAACCCAACAGGA	7316	1953	yes
GATCCCCGTGTCTGTGGAAA	33	10	yes
GATCTGAAAGTAGACTCTGC	148	105	yes
GATCTGAAAGATAACTGAAA	4	4	yes
GATCCCAAAGGCTGCACCTT	5	5	yes
GATCTGCATGAAACAGCATA	8	5	yes
GATCACTTTCTGAGCTGTAA	17	13	yes
GATCCCAAGTTTTTCCTTAA	76	14	yes
GATCTGAAAATTCTAAACTG	9	9	yes
GATCTGAAAATGTGTCTAAG	44	14	yes
GATCCCAAGACCACCCACCT	13	9	yes
GATCTCTTTTCCTGACCCTC	303	14	yes
GATCCCAAAGCCTCGTATGC	137	34	yes
GATCTCTTTGCCGAGTTTGG	4	3	yes
GATCCACAACACCCGAGTAT	2	3	yes
GATCTCTTCGTCGCCATCGT	138	51	yes
GATCTCTTCGTCGCCATCGC	85	44	yes
GATCTCTTCGTCGCCATCGA	177	65	yes
GATCCCCACGTGAGTATCGG	13	10	yes
GATCATGGTCTCACACGGTA	3	4	yes
GATCGAAGCCTATGCCCTGC	2	4	yes
GATCCATTCTTCACCCTTGA	8	3	yes
GATCTCTCTTCATTTCACCA	11	8	yes
GATCCATTCTGACGTGTGGA	87	5	yes
GATCCATTCGCTGTAACATG	41	5	yes
GATCCATTCCAGAGGGACAT	7	5	yes
GATCCATGTTTTCCAGGTAT	59	6	yes
GATCCATGTTGGGGGTTGGG	70	28	yes
GATCCATGTTGACCAAATGC	75	5	yes
GATCCATGTGTTGGTTGAGA	59	10	yes
GATCCATGTGATTGGAAAGT	107	22	yes
GATCCATGTGATGGACTGCA	11	9	yes
GATCCATGTCCTTTGGCTCC	61	14	yes
GATCCATGTATCGTTACTTC	5	6	yes
GATCCATGGTGGGGCCATTT	33	8	yes
GATCCAAAACCACAGAAGCA	19	4	yes
GATCCATGGTAGTCAGATAG	30	6	yes
GATCTCTGTCCGAACTGTGA	47	40	yes
GATCTCTGTCCACTGTATGC	113	21	yes
GATCCATGGGCTCCTTTGTG	11	11	yes
GATCCATGGGCCTTAGGGCT	2	2	yes
GATCCATGGGACTAAACAAC	1	1	yes
GATCCATGCTCTGATGAGCG	34	27	yes
GATCAGTTTGGGGAGAAGTT	11	7	yes
GATCCATGAAGTTTTCAGTC	78	19	yes
GATCCATGAAGTTTCCCTAC	3	2	yes
GATCCATGAACTCTAACTCC	36	23	yes
GATCCATCTGCATTTGCGGC	7022	1676	yes
GATCCATCTGCACATGGCTC	12	7	yes
GATCCATCCTCTGTCCTCTT	4	3	yes
GATCTCTGGGAAGGGCTGCG	17	17	yes
GATCACAGGGAGTTGAGAGG	26	5	yes
GATCTCTGCTTAGGTGACAG	5	7	yes
GATCTCTGCTCCCTACCCTT	80	22	yes
GATCTCTGCTCCAATCACAG	203	36	yes
GATCTCTGCTATGAGGCTAC	177	16	yes
GATCTCTGCGGTTTGCTTTT	5	5	yes
GATCCCAGGAAGTCCCACGA	28	20	yes
GATCTTGACATGCAAAAGTC	6	6	yes
GATCTCTCTGTTCTCCTGTG	19	15	yes
GATCTCTCTGTGACGCCCAT	51	8	yes
GATCTCTCTGGAGTACTGCT	3	3	yes
GATCTCTCTGCTTTCCAGTT	46	4	yes
GATCCATAGGGAAATTGTCC	8	6	yes
GATCTCTCTCCCTCTACACA	9	9	yes
GATCTCTCGCCTGGACCCCT	17	17	yes
GATCTCTCCTGGATATGGAA	16	10	yes
GATCTCCACTTTTCTAAAGA	2	2	yes
GATCTCTCCAGCTGGCTCCC	336	22	yes
GATCTCTCCAAAGCACACGC	49	11	yes
GATCTCTCAGGCCATGGGTC	170	15	yes
GATCTCTCACAACATCCGAC	88	16	yes
GATCCAGTGTGGAAGAGGTG	27	12	yes
GATCTCGGTACCTATCATCT	1	1	yes
GATCTCGGGAGATTGGCTGG	15	15	yes
GATCCCACTCTCTCAGTCCT	19	5	yes
GATCTCGGGAATCAGAGTTC	14	14	yes
GATCTCGCTTACAAGAAACC	30	3	yes
GATCCCACCTCCCCCCAGTC	190	80	yes
GATCTCGCCCTGTCAAGCAT	14	4	yes
GATCTCGCAGCCTTCCCCTC	76	7	yes
GATCTCGCAAGCACAAAGCC	65	8	yes
GATCTCGACCAGTTATACCT	5	5	yes
GATCAAAGCATGCACCTGTA	58	2	yes
GATCTCGAATCAGGTCTTTT	7	7	yes
GATCTCGAAGGGAAGTGGCG	10	10	yes
GATCCCACACCCACCTGCTC	51	33	yes
GATCTCCTTCACCTGAACCA	23	23	yes
GATCCAGGGTGGGAAGGAAG	96	18	yes
GATCCAGGAGACTCGAAGAT	100	17	yes
GATCCAGCTTCCCTCCGAGA	457	62	yes
GATCCAGCGAGGGAGCTGCC	39	14	yes
GATCTCCGCCCGAGCCTACG	15	10	yes
GATCTCCCTGTTTCTCACTT	8	8	yes
GATCCAGCCAGGAAACCCCA	6	7	yes
GATCCAGCATGGGTGTCCCG	4	6	yes
GATCCAGCATCACCCAGACA	148	27	yes
GATCCAGCAGACCCAGCACA	74	15	yes
GATCCATTTTGTTCGTGGAC	17	6	yes
GATCTCCCCTCTTCCTGGAT	43	33	yes
GATCCAGAGTAAAGACAGCT	27	18	yes
GATCCATTGTACTACAAGTT	20	16	yes
GATCTCCCCACCACCCCAGG	39	32	yes
GATCAGCTGGAAAACAGGCT	11	11	yes
GATCCATTAGCTTTGTCTGA	21	14	yes
GATCCATGTCATCGTTCATT	2	1	yes
GATCTCCATAATTCCAACTT	13	19	yes
GATCCATGCTTTGCCCGAGA	2	2	yes
GATCTCCAGGGTGGATTTCT	6	9	yes
GATCCTTCTCTGTGTCAGCT	5	5	yes
GATCTCCAGCCTCGCCGTGA	1	1	yes
GATCTCCACCCTATGCGAGT	13	19	yes
GATCTCCACACAGCACACAG	296	47	yes
GATCTCCAAGTCTCTCAGTC	14	9	yes
GATCTCCAACTGTGCTTTCA	98	68	yes
GATCTCCAAAGTCCTGCTAG	7	10	yes
GATCTCCAAAGAGTTACTCG	2	3	yes
GATCTCCAAAATCAACAACA	38	29	yes
GATCTCATTTTCTGTATTGA	34	8	yes
GATCCATATCCTGCTCCACC	24	6	yes
GATCCATTCATCTACTTTTT	10	9	yes
GATCGAATCATCAAGGTAAA	1	1	yes
GATCGCCTCACATTTTCATT	1	1	yes
GATCAAGTTTTAGACTCTGT	12	12	yes
GATCCAGTTCTAAAACTTGG	6	11	yes
GATCGGCGTGGGCCTGTCCA	2	3	yes
GATCACCCAGGAAGAGAAAT	37	24	yes
GATCTGAGAATTCTCCCTGG	13	13	yes
GATCACCATCCTGATTATAT	105	96	yes
GATCAGTTCTCACATCCTTG	17	17	yes
GATCAGTTCCTCTTCAGAAT	13	5	yes
GATCACCAGAAGCCATGCTC	114	19	yes
GATCATTAAGACCCTGTATC	29	2	yes
GATCATTAAGAAAGTACTTT	8	8	yes
GATCATGTTTCAGGAAGGAA	20	16	yes
GATCATGTTGATTCTGAAAT	110	16	yes
GATCATGTTGAAGGAATCCA	4	4	yes
GATCATGTTCTTTCCGCAGG	695	74	yes
GATCATGTTCGCCTGGACAC	390	113	yes
GATCATGTTCCTGGAGGTCA	23	6	yes
GATCATGTTACACTTGCCAG	67	50	yes
GATCATGTGTAAGTGTCAAA	12	18	yes
GATCATGTGGCGTTCTCTCT	14	14	yes
GATCATGTGGATTCCAGGAA	9	7	yes
GATCATGTGGATGCCTTCCC	33	23	yes
GATCATGTGGAAGGTGAGAT	58	40	yes
GATCATGTGCTCACCTGCAT	14	11	yes
GATCACATTTTGCCTTTGGT	10	4	yes
GATCACATTCGTTCATCAAG	4	6	yes
GATCACATTCCTTCCGAGGT	6	5	yes
GATCACATGGTGACTCTAGC	26	25	yes
GATCGTTTTGTTTTGTTTTG	10	10	yes
GATCATGTGAGCATCGTGGA	404	91	yes
GATCATGTGAGAACAGGCAT	8	6	yes
GATCATGTCTTCTCCATGTT	979	114	yes
GATCATGTCTGTGAAATGAC	27	11	yes
GATCATGTCTCAAGGTGGCA	21	7	yes
GATCATGTCTATCTCAGGGG	94	37	yes
GATCATGTCCCACAGGCATT	19	14	yes
GATCATGTCATTGCCTGTTA	64	27	yes
GATCATGTCAGAGGGAGATG	44	27	yes
GATCATGTACAGAGGTCTTT	11	8	yes
GATCCAAATAAGTCTCCTCC	278	413	yes
GATCATGTACAAGCTGATGG	296	51	yes
GATCATGTAAAGACGCTGGG	8	12	yes
GATCATGGTTCTGATGAAGC	6	9	yes
GATCATGGTTCAAGTGACAA	651	510	yes
GATCATGGTGTCTTGTGGTT	16	21	yes
GATCATGGTCTTCGGAAAAC	4	4	yes
GATCATGGGTGTTGCTACCA	3	4	yes
GATCATGGGTGTGCCAGGGG	27	8	yes
GATCATGGGGATGGACGGGG	166	127	yes
GATCACATCTACCACATGTA	4	6	yes
GATCAGGTAATGTATGTGGA	17	12	yes
GATCACAGTTCATGTAATGC	67	48	yes
GATCACAGGCCTGAGCTGGG	31	9	yes
GATCTGTCTACTTTTCCTAT	20	7	yes
GATCATGGCCTTTACGATGC	37	5	yes
GATCATGGCCTTCAGATATG	199	68	yes
GATCATGGCCCAGACCTGAG	10	8	yes
GATCATGGCAAAGGATGACC	174	4	yes
GATCATGCTTTCTTCTCTAT	22	3	yes
GATCATGCTGTGTTCGTGAT	11	4	yes
GATCATGCTCCTGCAGCTGA	82	7	yes
GATCATGCTCCTGAGTGGCA	27	5	yes
GATCATGCTCATCTTCACTG	108	29	yes
GATCATTGGGGGAGGGTAGT	19	19	yes
GATCATGCTACGTTTTGTCT	21	15	yes
GATCATGCTACCACTGCATC	8	12	yes
GATCATGCGCCTTTCTAAGC	34	24	yes
GATCATGCCTTCTGTAAAGC	82	18	yes
GATCACAGTGGCTATATCTC	32	5	yes
GATCACAGCTGTGATGGGAG	152	31	yes
GATCACAGCTATGCCCTTTC	84	7	yes
GATCAGGAAAATCTCTCATT	10	5	yes
GATCGTGTGTTGCCATTTTG	2	3	yes
GATCACAGCAGCCAAGGGAC	1	1	yes
GATCACAGAGATACTACAGT	6	6	yes
GATCATGCCGTGCTACGCTC	104	24	yes
GATCATGCCGCCCCTTAGTG	41	30	yes
GATCATGCCCCAGGACACAA	7	9	yes
GATCATGCCCACTGTTGAAA	1	1	yes
GATCATGCCCAAAACAACCA	30	4	yes
GATCATGCAGTAGTTCACAG	58	28	yes
GATCATGCAGACTGTTCCTT	277	176	yes
GATCATGCAGAAGAACGGTG	264	69	yes
GATCATGCACTGTATTCACA	64	10	yes
GATCATGATTTCCGAGCTAC	4	3	yes
GATCATGATTCTCCCTCAGC	47	8	yes
GATCATGATAGCAGCACAGA	78	96	yes
GATCATGATACTGTTTGTTC	44	4	yes
GATCATGAGTGTCCCACTAC	35	12	yes
GATCATGAGTGACCACAGTT	13	11	yes
GATCATGAGGGAGTTCCGGT	154	14	yes
GATCATGAGCCATTTTTAAC	41	33	yes
GATCATGACTCAGTATCAAC	30	8	yes
GATCATGACGCTGGTAGATG	75	17	yes
GATCATGACCCTTAGACTCA	6	9	yes
GATCATGACATTCCTCAGAT	57	4	yes
GATCACAGACCATGGTCTCA	43	32	yes
GATCACAGAATGGAAACAGC	17	6	yes
GATCAGCTGAAACTGAAGGC	103	22	yes
GATCAGCTCGTCTTTCGCCA	4	5	yes
GATCACAGAAACATAATTTC	115	12	yes
GATCTGAAAATTGTATTTGA	3	3	yes
GATCATGAACATCATCCAGG	104	48	yes
GATCATCTTGTTGCGTTTCT	26	9	yes
GATCATCTTGGTGTGAGGCT	30	20	yes
GATCTTTTGTAAGAACAGCA	5	5	yes
GATCATCTTGCTGCTTGACA	19	13	yes
GATCATCTTCATCCTGGGTT	22	5	yes
GATCATCTTCAATTCTATCC	5	4	yes
GATCATCTGCCCTTTCTATC	64	3	yes
GATCATCTCTTCTGAGAGTG	100	16	yes
GATCATCTCTCACCACAGGC	120	7	yes
GATCATCTCCTGTAAATCTT	18	6	yes
GATCATCTCACAGGACAGGG	515	13	yes
GATCTCTTCTTGACCAGTGA	11	11	yes
GATCACACCACTCTCAACCA	17	6	yes
GATCGTTTCTAGTTCCATCC	1	1	yes
GATCACACATCTGGGCAGTG	84	18	yes
GATCAGCCTGGCTCCAGGGA	12	12	yes
GATCATCTCAAAGCCTGTTT	4	5	yes
GATCATCTACGACAGAAAGT	43	30	yes
GATCATCGTGTCGGGATGAT	184	55	yes
GATCATCGTCTGCCTCTTTG	3	0	yes
GATCATCGTCAGTGACGTTT	68	47	yes
GATCATCGGCATGGCATACG	327	67	yes
GATCATCGGAAGGATAGATG	17	17	yes
GATCATCCTTGTGTTGTGAA	182	17	yes
GATCATCCTTCAAAGGGGAT	5	10	yes
GATCATCCTGCTTCCAGCTC	9	12	yes
GATCATCCTATTTATCCCAT	1	1	yes
GATCATCCGCAAAGTTGTGA	12	9	yes
GATCATCCAGGGCTGCCCCT	16	10	yes
GATCATCCACCTGCTCACTG	1321	378	yes
GATCATCCACAAACTTCCAG	4	3	yes
GATCATCCAAGCTGTTGTAA	46	17	yes
GATCATCATTTTAAAACACA	29	21	yes
GATCATCATGCTTCCAGATG	268	61	yes
GATCACGTACAGCTGACCAG	2	2	yes
GATCACAAGATGGCGTTATC	9	6	yes
GATCAGGTCATCGCCTCCTT	171	21	yes
GATCAGGGTTAAGGAGGAGC	69	7	yes
GATCAGGGATATGAGGTTGC	35	11	yes
GATCAGGGAGCTTCGTGTGT	12	8	yes
GATCAGGGAAGCAGACATTG	348	79	yes
GATCAGGCTGTCTGGAGACT	13	13	yes
GATCTGTTGAAGAACTCAGC	38	4	yes
GATCAGGCGAGACATGTTCT	28	6	yes
GATCAGGCACAGGGACAGCC	132	11	yes
GATCAGGACTTGAGGGTTAT	13	8	yes
GATCAGGAATCAACTGATAC	2	2	yes
GATCAGGAAGCAAAGAAAGA	38	26	yes
GATCAGGAAAAGAAAAAGCA	7	5	yes
GATCAGCTTCTTTTGGACAC	9	9	yes
GATCAGCTTCTTGGTTTCCT	56	18	yes
GATCAGCTGTGGGCTCTGGG	73	24	yes
GATCATCATCTTGACAGCTT	32	22	yes
GATCATCATATTTCTCACCT	15	19	yes
GATCATCAGTATCTCTATCA	9	10	yes
GATCATCACTGCTGCCCTAT	14	10	yes
GATCATCACTCACGGACATA	4	4	yes
GATCATCAAGTGTCCTGGCG	6	6	yes
GATCGAAACCAGCTGTAACT	45	29	yes
GATCATCAACAAGACTATCT	29	8	yes
GATCCTCTTTGCCAACCCCC	26	45	yes
GATCTGTGTTTTCATTTGCA	11	9	yes
GATCATAGGATTCTGATTTT	25	16	yes
GATCTCTCCCAGGCTTGCTG	8	5	yes
GATCTCTCCCAAACGGTGAT	3	4	yes
GATCACAAACATAGCCAATG	15	15	yes
GATCGAGCTGGCACGTTCAA	1	1	yes
GATCTCTATGACACGCTGAC	2	2	yes
GATCAATGCCTGGACGGCTC	92	7	yes
GATCAGCTCTGTAGCAGCAG	10	10	yes
GATCAGCGTGCGCCTAGCGG	63	4	yes
GATCAGCGGTGGGAATGACG	50	65	yes
GATCAGCGACCTTCCAGCAG	12	9	yes
GATCAGCCTTCAATAGCCAT	24	16	yes
GATCAGCCTCTTTCCCATCA	8	4	yes
GATCAGCCTCCTGCCTCAGC	87	24	yes
GATCAGCCTCCTGCAGCCCA	51	12	yes
GATCAGCCCTGGCAAGGAAG	35	22	yes
GATCAGCCCCATTGCGGTGC	5	5	yes
GATCAGCCCAAAATGAGCGA	19	13	yes
GATCAGCCAAGCCAGACTTG	55	10	yes
GATCAGCATTCCACCCCGGA	3	4	yes
GATCATAGCTGATGGCCTTC	48	14	yes
GATCATAGCTCTAGCAGAAC	35	9	yes
GATCATAGCTACTTTGTGCT	85	13	yes
GATCATAGCAAAGATGGACG	74	50	yes
GATCATAGATTGGGCTACAT	79	79	yes
GATCATAGATGACTTTGCCT	97	54	yes
GATCATAGACCAGAGCGAGG	128	17	yes
GATCATACGTAGTTGTGAAA	91	3	yes
GATCATACCCTCTCTGGCTT	51	2	yes
GATCATACCAAGAGGTGAGG	228	20	yes
GATCATACAGTTAGTGTGAT	8	8	yes
GATCATACAATCCCAGAAGG	3	3	yes
GATCATAATTTGAATAAGCA	8	8	yes
GATCGCCACCTACAGGAACC	31	57	yes
GATCATAACAGTTCTGTGAA	14	10	yes
GATCCTTTGGACCGGGCTTT	47	43	yes
GATCTCGCTGCTGTGGAACG	5	5	yes
GATCAATCAGAGGGATTACC	191	18	yes
GATCACTAAGACTTGAATCC	9	4	yes
GATCAGCAGGTGGTTATCAA	1	1	yes
GATCAGCAGGACATCCATCA	10	10	yes
GATCAGCAGCCGGAGACGAC	48	12	yes
GATCAGCAGATGTTGGTGGC	3	2	yes
GATCAGCACTGGGGTCAACG	30	29	yes
GATCAGCACTCTCGGTATGC	170	9	yes
GATCAGCACGCTGACTCTTT	230	17	yes
GATCAGCACCACACTGGACT	19	19	yes
GATCAGCACAGCCTCCTTAG	17	17	yes
GATCAGCAAATTCAGAGATA	10	10	yes
GATCAGATTGGGAGTATGTA	26	16	yes
GATCAGATGGAGTTTATTAA	14	9	yes
GATCCCAGAGGAGTCAGAAG	4	3	yes
GATCAGAGCCCTGTCGATGG	144	47	yes
GATCAGAGAGTTGACCGCAG	7	7	yes
GATCAGAGAAACTGGGTAGA	26	26	yes
GATCAGACTAACCCCGGAGT	46	29	yes
GATCAGACGAGGTTCTCTCT	8	5	yes
GATCAGACGAAAGACATTTG	22	22	yes
GATCAGACCATGGTACTGGC	95	10	yes
GATCAAAATAGTGGAGAATT	21	10	yes
GATCAGTTTTTGGTGTCATT	882	168	yes
GATCAGTTTTGGTCTTGATG	11	11	yes
GATCAGTTTTGACCTCTTAT	48	10	yes
GATCAGTTTGTTTTCACTGT	221	26	yes
GATCAGTTTGCCAATCATCT	67	6	yes
GATCAGTTTCCTTGATTATT	88	5	yes
GATCAGTTTCATGTTTTTTC	8	5	yes
GATCAGTTTCAGCCAGGAGT	41	4	yes
GATCAGTTTATGATTCAGTT	23	10	yes
GATCAGTTTATCAGTCCGTT	39	9	yes
GATCAGTTGGTTGATTCCTA	2	3	yes
GATCAGTTGCCAAATGATTG	37	12	yes
GATCAGTTGATATCTGGGGG	180	87	yes
GATCAGTTGAAACTTGGAAA	174	25	yes
GATCAGTTCTTATCTACTTG	6	6	yes
GATCAGTTCTGAGCCGAGGA	11	2	yes
GATCAGTTCCTGGTATACAG	81	7	yes
GATCAGAACTTTTCCCTATA	13	9	yes
GATCAAGGTGGCGGATTTTG	8	3	yes
GATCAAGGTCGGAAAGAAAT	300	166	yes
GATCAGAATGTCCTTCCAGT	74	12	yes
GATCAGAATGAGGGACCTCC	42	9	yes
GATCAGAAGGTTCTTGCTAA	3	3	yes
GATCAGAAACCCGAGCTGAA	42	4	yes
GATCCCACATCCCCAGGTTT	5	5	yes
GATCACTTTGACTTCATCCT	109	9	yes
GATCACTTGCTGCTCTTGCA	4	3	yes
GATCTGTGCAAAAGCAGTGA	780	43	yes
GATCACTGTGCGCCCCCTCC	4	7	yes
GATCACTGGCAAGCACGAAG	16	11	yes
GATCACTGCTGTAGGAAAGC	35	11	yes
GATCACTGATATTTTGGATT	1	1	yes
GATCACTGATACTTCCTGGG	18	18	yes
GATCAGTTCCATGTTACACA	6	4	yes
GATCAGTTCAGTGTGCATCG	41	14	yes
GATCAGTTCAGACAACTGTG	55	6	yes
GATCAGTTACTGCCACACCC	45	5	yes
GATCGGCGTGACTACCCCTT	5	5	yes
GATCAGTGCTGTACTTCACT	14	10	yes
GATCAGTGCTCTGCTAACGC	462	26	yes
GATCAGTGCCTTTGTTGGCA	221	14	yes
GATCAGTGCATTTCAGAGTT	8	1	yes
GATCAGTGCACACAGCTCTC	9	9	yes
GATCCCTGAGCCTGAATTAC	7	5	yes
GATCAGTGAGTGTGAGTGTG	79	2	yes
GATCTCACTGCCAGTCATCG	35	8	yes
GATCCATTTGCTTACACGGT	36	11	yes
GATCATACGGAGCATGAGAG	2	2	yes
GATCAAGAAAAGCAACTTAT	51	7	yes
GATCACTCAGTAACTGCTGG	61	14	yes
GATCACTCAGGATTTGTTCC	14	5	yes
GATCACTATTCACCAGATTC	19	7	yes
GATCACTAGCAAGGACTAAA	33	21	yes
GATCACTACTCCTTAGACGT	125	3	yes
GATCACGTTTGTGTTGTCTT	5	4	yes
GATCACGTTGAGTTCTATTT	6	1	yes
GATCACGTTCTGATTGAGCT	59	12	yes
GATCACGTTAGCCACAGGAC	57	38	yes
GATCACGTGTCCAAAGGTGA	52	37	yes
GATCACGTGTATGTGTCGTG	67	27	yes
GATCACGTGGGCTGCGTTTC	176	35	yes
GATCACGTGGCTGTTCTTGT	20	7	yes
GATCACGTGACCACCCTTTC	69	6	yes
GATCACGGGAGCTGAGCAAC	18	12	yes
GATCACGCTATGGGCAGGAG	1482	324	yes
GATCACGCAGTCTTAGAAAT	36	9	yes
GATCACGACGACGCCCACGC	198	64	yes
GATCACCTGCTCTAATGTCC	243	33	yes
GATCACCTGCCAGACTGTTA	6	4	yes
GATCTGTCTGTTTAGTGGAT	71	12	yes
GATCACCTCCCAGATTCTGA	49	6	yes
GATCACCGTTCCCATCCCCG	8	3	yes
GATCACCCATAAGAACCAGA	70	32	yes
GATCGCCACTTATGTGACTT	1	1	yes
GATCCCAAAGAAGGCTATGG	1	1	yes
GATCCTCCGGCCAAAACCTC	89	59	yes
GATCACCATCCCTCACAGTG	89	9	yes
GATCACCATCACTGCACCGC	10	10	yes
GATCACCAGGAACTCCTACC	14	5	yes
GATCACCAGATGCTGAGGCT	530	47	yes
GATCACCACTGGTTTTGTTT	34	5	yes
GATCACCAATGTGGAGTCCC	2	3	yes
GATCACCAAGTGGAATGAAA	30	29	yes
GATCACCAAGGAATCCAAGG	17	25	yes
GATCACCAACTCACGTCATG	113	90	yes
GATCACCAACCACCCCAGCA	32	48	yes
GATCACATTGGCTGCGTGCT	21	6	yes
GATCACATGAGAGTCAGAGG	51	12	yes
GATCTATGCTCCTCCATGAT	4	3	yes
GATCACAGTGAGATTCTCAT	15	2	yes
GATCACAGTCACTATTATTG	6	6	yes
GATCACAGGTCTGAGCAAAG	110	19	yes
GATCACAGGATTGGCGTCCC	11	11	yes
GATCACAGACGTGGCTCTGG	11	16	yes
GATCCAAATATGTCTAAACA	70	48	yes
GATCACACTGGAACAGAACC	209	28	yes
GATCACACCTGTGGGGTCAA	27	17	yes
GATCACACCTGTAGACAAGA	69	10	yes
GATCACACCCAAAGCTGTCC	91	13	yes
GATCACACAGGGAGGCCTTG	218	29	yes
GATCACACACTACTGAGGGC	9	9	yes
GATCACAATGTTGTCTATCC	26	9	yes
GATCACAATCATGGGCACAG	3	3	yes
GATCACAACTGATGGCGGGT	372	26	yes
GATCGACTCCAGAGACGATT	4	6	yes
GATCAATTCTAACTGGTCAG	35	25	yes
GATCAATTCCCCACCTACAA	20	20	yes
GATCAATGTTTTCTCATTAA	31	31	yes
GATCAATGTCGTCATCATCC	19	3	yes
GATCAATCTATGGGAAGACT	23	23	yes
GATCAATCACCAGCGCGAAG	82	52	yes
GATCACTGTGCGGATTGAGC	30	30	yes
GATCCCTGTCAGCTAGCTGG	51	6	yes
GATCCCCTCTTCTGGAGTGT	5	4	yes
GATCAAGAATCCAGTCTGCT	7	7	yes
GATCAACTCATGGAGCTGGC	109	70	yes
GATCAACTCAACAGCCACAC	16	24	yes
GATCGGACGCCACCACATTA	24	18	yes
GATCAACGCCATGACCTACC	151	11	yes
GATCAACGATATTTCTCTGC	4	5	yes
GATCAACCTGCTGTGACGCG	25	2	yes
GATCAACCCGTGTGCATTGC	25	3	yes
GATCAACCCCTACCAGCCAG	18	12	yes
GATCAACCAGGTGGCCTTGG	18	15	yes
GATCAACATTCATCAGTTAT	12	9	yes
GATCAACATCGATGTTCTTT	45	20	yes
GATCAACACTTTTCTCTCAG	23	23	yes
GATCAACACTCCCTGTATCT	6	6	yes
GATCAACACACTGGAATGGA	16	24	yes
GATCAACAATAGATGCTGAG	8	8	yes
GATCAACAAGCAGGAGTACG	8	12	yes
GATCAAATTCCCAGGGACAT	26	14	yes
GATCAAATTCACAAGCTTAA	42	6	yes
GATCGAGTAGGACTTTGTGC	26	5	yes
GATCCAGCTGGAATCTAAAG	259	40	yes
GATCCGAATCTGTGCCCAGC	80	26	yes
GATCTGGGACATTCAAAAGC	10	10	yes
GATCATTCATTGAAGCCCCT	21	4	yes
GATCCCTCTCTCACACTCCT	52	22	yes
GATCAAATCTTCACCAGTAT	61	24	yes
GATCAAATCCTGCGTCTTTT	8	6	yes
GATCAAATACTCTGCACATA	23	15	yes
GATCCTCCTGGGCTTGAACT	82	21	yes
GATCAAACTTAAGACCAACC	2	3	yes
GATCAAACAGCTGTACCTCA	109	74	yes
GATCGACACATGTGTGGGGA	72	26	yes
GATCCAAGAAGGAGACCCAG	3	2	yes
GATCCCTTTATGAACCTTGT	238	56	yes
GATCCAGCATGCCAACGTGC	32	13	yes
GATCTGGTCCTGCTCCTACC	19	11	yes
GATCCACTCCATCGAGGAAA	216	18	yes
GATCCCTTCCCCTTCCACTA	5	4	yes
GATCAAGACTACCATGGTCA	3	5	yes
GATCAGGCAGCTGTTGAGTT	6	6	yes
GATCATAGGCCTTAACACAC	4	6	yes
GATCAGCTGATGACTGAGTA	2	2	yes
GATCAGTCTGGTTTTGCACT	3	3	yes
GATCAGTACGAGCGAGAAGG	11	4	yes
GATCCAGAGGCCCTAGCCAG	8	8	yes
GATCTGGATAGGAGAGGAGA	3	3	yes
GATCCAGAGAGCTTCCTAAA	32	20	yes
GATCCAGAACACTTGACACT	17	17	yes
GATCCAGAAATTGGAGATAA	37	9	yes
GATCAGACAGGAAAGGATGT	1	1	yes
GATCCACTGCGTTTCCATGC	141	106	yes
GATCCACCTTGTGGCCTGGC	4	4	yes
GATCCACCTGTCTCTCCTTC	1	1	yes
GATCCACCGTACCAGGAAGC	191	13	yes
GATCTCAGTGTGGTACAAAA	4	4	yes
GATCCAGTCGTTCTGCTGCG	39	13	yes
GATCTCAGTCCCCGCCTGCA	17	17	yes
GATCTCAGGCACCAGGTAGA	6	6	yes
GATCTCAGGAGACTTCACCA	33	23	yes
GATCCAGGTGTTTGGCCTGA	11	9	yes
GATCACAGATGTGATGGGGT	1	1	yes
GATCCTGCCCCCACGCTGGG	10	3	yes
GATCCACCAAGGTAGAAAAC	82	12	yes
GATCCACATAGTGCTGCTGC	11	16	yes
GATCCACAGCAGTTATGCTG	23	23	yes
GATCTCAGAGACTTGAACCT	5	5	yes
GATCCACACGGGCGAGAAGC	17	5	yes
GATCCACACAGGAGAGAAGC	65	4	yes
GATCCAGGAGTCCTGTCAGA	67	13	yes
GATCTCACTGTTACTCTGGC	3	4	yes
GATCTCACTGGTGAATAATC	2	4	yes
GATCTCACTGGACTTGGTGT	224	49	yes
GATCCCGTGTAGCCTTCGTT	13	5	yes
GATCTCACTAACCTGCCACC	12	3	yes
GATCTCACGGCCTGCGGGGT	8	8	yes
GATCTCACGGCCAGACAGAC	66	9	yes
GATCTCACGCCTCTTGGGGA	14	15	yes
GATCAAGCTAAAAACCTCAA	4	4	yes
GATCAAGCCTAGCCAGGACC	7	12	yes
GATCCAAGTTATTGGCACAC	10	7	yes
GATCCAAGTGAATAAAGTAA	5	4	yes
GATCCAAGTCATGATTTGAT	23	42	yes
GATCCAAGTAGAAGCTTCTA	117	82	yes
GATCCAAGGGCCCTGTATGT	11	11	yes
GATCTCACAGGTTGGATTTA	12	12	yes
GATCTCAATGAGAAAGAATC	23	15	yes
GATCTCAAGCGCTTTGCTCT	11	11	yes
GATCCAGCAAATCGGGACAG	99	44	yes
GATCAAATGTATGAGTGTAC	23	8	yes
GATCTCAAAGGGAAACTGAC	12	12	yes
GATCTCAAAGCCATTGATAG	20	20	yes
GATCTCAAAGCAAGATTTTT	7	7	yes
GATCTCAAACCTTCAGAAAA	14	24	yes
GATCAAAGTAACCTCCAAAA	1	1	yes
GATCCTAAAAGGGCCAAAGC	16	14	yes
GATCCCAGGTTGTGGATTCT	2	1	yes
GATCCCTTACAAGATGGTCT	12	4	yes
GATCCCATCCAGCCCTCCAC	2	4	yes
GATCCAACTGACTGGCTAGC	175	63	yes
GATCCAACTGACAGATGAGG	3	4	yes
GATCCAACTCTGTAAAGGCT	14	10	yes
GATCCAACTCAGTTAGGCTT	6	5	yes
GATCCAACTCACCCCATCAG	70	69	yes
GATCCAACGCAGCACCGTCT	27	7	yes
GATCCAACCCCCTCTCCTGA	28	20	yes
GATCGAGCTGCTGCTGCTGA	1	1	yes
GATCGAGCCAAGAGCTGTAA	13	3	yes
GATCGAGCAGGCCCGGCTGC	17	4	yes
GATCTCAAACATTCTATGCA	154	96	yes
GATCCAGAGCACAGCCCACG	175	62	yes
GATCTCAAAACGTGCACAAA	2	2	yes
GATCCAAAGACGCTAGATGT	40	26	yes
GATCTATTCTCCCACTGGAC	13	9	yes
GATCAAAACAAGGTACTGTG	2	3	yes
GATCTATGTCATGGCCACGC	87	21	yes
GATCTATGGAGGACGGCAGA	15	11	yes
GATCTATGAGACAGAACTGG	72	28	yes
GATCATATAGTGAAGGCATA	6	6	yes
GATCCAAACAGATGAAGGCA	7	5	yes
GATCCAAAAGGAAGCAAATT	17	13	yes
GATCCAAAAATCTTAATACG	4	4	yes
GATCCTTTTCCGGTTTTATC	2	4	yes
GATCCACTTGCGTTGTGAGC	127	14	yes
GATCTACTTGTGTGTGTGTG	100	19	yes
GATCTACTTGGGAACTGTGG	4	4	yes
GATCTACTTGCTACCAGTCT	4	6	yes
GATCTACTGTGTGACACCTG	3	4	yes
GATCCACTCCAGGGCTTGGA	2	3	yes
GATCTACTGAAATCATACCT	6	5	yes
GATCTACTCCTTCAGAGCCT	3	2	yes
GATCTACTCCAGTGCCTGAG	244	160	yes
GATCTACTACCAGACAGACA	62	9	yes
GATCCACGGGGTGACTTCCA	7	4	yes
GATCTACGGTTCCCACGCAT	27	20	yes
GATCTACGGCCTGGACTTCT	54	13	yes
GATCATTTCGGGTGACTTAA	21	16	yes
GATCGTTCTCCGGTCATGCA	26	26	yes
GATCTACCTTGAAATCCCTC	121	8	yes
GATCTACCTGACCTTGTTGA	10	6	yes
GATCTACCTCCATAGAGATG	11	7	yes
GATCTACCTACCCGTGGTGT	3	6	yes
GATCTACCTAAAAGCAACAG	1	1	yes
GATCATTGATAAGGACAGCA	8	5	yes
GATCTACCGAAAATCAAGAA	2	2	yes
GATCTACCAGGTGGACACCC	29	6	yes
GATCTACATTCCAGTCATTT	7	7	yes
GATCTACAGGACCCGCCCCT	4	4	yes
GATCTACAGCACTGCCTTTC	5	5	yes
GATCCACCAGCGTGTGCATG	42	27	yes
GATCAGTACCTAGCGCCCAC	2	2	yes
GATCATTCTGAAGTACATTG	39	17	yes
GATCATTCCAAGTTTCACGT	247	35	yes
GATCTACAAAACACAGGGAG	7	7	yes
GATCTAATTGCCATTACTTA	11	7	yes
GATCTAAGTCTGGAAGAACT	305	260	yes
GATCTAACTCTGTATGTCCT	2	3	yes
GATCTAAATGCCCAAGTTGA	35	24	yes
GATCCACACAATGGAGACCT	138	13	yes
GATCTAAATCTTTCCTCAGC	13	13	yes
GATCTAAAGTGCCTCTTTGT	5	4	yes
GATCTAAACTGTGGTGTGAA	33	21	yes
GATCCACCCTTCAGTCCTCC	13	9	yes
GATCAGAGAAGCAGATATTT	13	13	yes
GATCCAGAGGAGAAACTAAG	8	0	yes
GATCCTTCCCATCCCACTCT	4	4	yes
GATCAAGGCGGCTGCAGCGG	2	2	yes
GATCGTTGTGAGCCACCATG	14	14	yes
GATCCAAGTTTAAATCTCTA	5	4	yes
GATCGTGTTCAAGAACCCCC	73	10	yes
GATCGTGTGGAGTGAAAGGC	58	7	yes
GATCGTGTCCGGCATGAAGT	295	21	yes
GATCGTGTAGCAGGGTAAGG	5	7	yes
GATCCAAGGGCGCACGAAGA	29	26	yes
GATCGTGGTGCAAGGAGAGC	42	28	yes
GATCACATCACAGCCAGGTA	1	1	yes
GATCGTGGTCCAGAGGAGCA	38	9	yes
GATCCAAGGCGGCGACCCGA	21	5	yes
GATCGTGGGAACCATTGTCA	5	5	yes
GATCGTGGCTAGTGAGATAG	4	4	yes
GATCGTGGCAGTAGCTCCTG	28	28	yes
GATCCAAGGACTGCGGTGCA	27	17	yes
GATCGTGGCACCTCCGGGCT	30	21	yes
GATCGTGCTGCCTGCCTGTT	1	1	yes
GATCGTGACGGCACTGACGT	12	10	yes
GATCGTGAAGCCGCTGAATC	50	8	yes
GATCGTGAAGCACCTGAATT	10	10	yes
GATCCAACTGGAAGCCTTCT	7	7	yes
GATCGTCTCCGTGCTGGTGA	147	9	yes
GATCGTCTCAGTTACGAGGC	6	8	yes
GATCGTCCCCCAGCCACCTG	52	4	yes
GATCGTATCCCCAGGCGTGG	31	15	yes
GATCGTACGGCTGTAACAGG	15	15	yes
GATCCAACCATGACCAGGTG	21	6	yes
GATCGTAAGTTCTGGGACGC	14	9	yes
GATCGGTGTCGAGCACGGAC	1	1	yes
GATCCGCTGGCTGTGAAGCT	2	2	yes
GATCCGACCTTTGTTGGCCT	18	7	yes
GATCAAAGCAGGGGTGGATG	2	1	yes
GATCAAACCTACCAGCCGGT	23	24	yes
GATCAGTCTAAAGAAAAGGA	37	5	yes
GATCCAAACTCTGCAAGCAG	11	2	yes
GATCATTACCAGTTGTTCCT	2	2	yes
GATCAGTCTTTTCAGTATTT	58	10	yes
GATCAGTCTGAATTGAACAT	48	30	yes
GATCAGTCTATGAGTCAATA	35	22	yes
GATCAGTCGTAAAGGACTCA	100	62	yes
GATCAGTCCTCTGCACACTT	20	35	yes
GATCAGTCCTCTAGCATTTC	102	15	yes
GATCAGTCCTACAAAGTTCC	219	23	yes
GATCAGTCCCTTCCCCCAAC	23	15	yes
GATCAGTCCAGTTTTGGCTG	26	21	yes
GATCAGTCATTGTCTTGATA	5	3	yes
GATCAGTCAGGTCCTAGATG	2	1	yes
GATCAGTCAGCCTTACCTTC	6	6	yes
GATCAGTCACCACTGGCACT	199	74	yes
GATCAGTCACAGGCAAACTC	20	9	yes
GATCGGCTGCTTTTGTCTCT	2	2	yes
GATCGCTTTAGCTTGCCTAC	14	2	yes
GATCATCTTAGGCTTGGCTG	2	2	yes
GATCAGTAGGAAGCACAGGT	565	31	yes
GATCAGTACTACTGTGGTGT	126	15	yes
GATCAGTAAGGATTCCTGTA	82	39	yes
GATCAGTAACAGCTCAGACA	8	8	yes
GATCAGGTTTGGACTCCTTC	31	5	yes
GATCAGGTTTGCACCAAGGT	5	3	yes
GATCAGGTGTTCAAAGTCAC	48	17	yes
GATCAGGTGTCAGTTTTCTA	96	74	yes
GATCAGGTGGAGACTGGAGT	5	5	yes
GATCAGGTGGAAAAAATCAA	10	7	yes
GATCTGCGATGAACTGGGAG	615	72	yes
GATCGCATTTCATGTGTGTG	3	3	yes
GATCGATTTTCATTTCTTTT	2	2	yes
GATCGATGACACTGAGCTGA	12	2	yes
GATCAGTCGTGTCCTTCCCT	5	5	yes
GATCAGGTGAAGACCCTCTC	39	16	yes
GATCAGGTCAGAGATGCGGT	298	44	yes
GATCAGGTACCTTGCCTGCG	5	5	yes
GATCAGGTACAGCAGTGCCT	5	5	yes
GATCAGGGTGTGTGCCCACG	24	20	yes
GATCAGGGTCCTCCTTCCCT	56	6	yes
GATCAGGGGGAAGGGGTCAG	7	7	yes
GATCAGGGCGTGGTAGAGAA	20	15	yes
GATCAGGGCCGTGTGGATGC	17	5	yes
GATCAGGGCCGAGTGATGAG	17	25	yes
GATCAGGGCCAGGGGAGGTC	315	22	yes
GATCAGGGCAGAGATGGAAG	76	17	yes
GATCAGGGCAAGGGCTAGCC	17	13	yes
GATCAGGGCAAGAGGATTGT	27	17	yes
GATCAGGGCAAAGTGGCTTT	22	5	yes
GATCAGGGACCACGAACAGA	84	84	yes
GATCAGGGAAGTTCATTGTG	86	54	yes
GATCTTTTACAGCCTGTGCA	5	5	yes
GATCAGGCTGAGCTGAATGT	31	6	yes
GATCAGGCTACTACAAAGTT	1991	218	yes
GATCCAAACACACACTAGGA	3	0	yes
GATCAGGCCTGGAGCCCCAG	7	7	yes
GATCAGGCCTGAACCCGTCC	140	29	yes
GATCAGGCCTCAGAATGCCA	1	1	yes
GATCAGGCCCACAGCCGAGT	7	4	yes
GATCAGGCCATCAAGTCACA	10	15	yes
GATCAGGCCATACGTAGCCT	27	3	yes
GATCAGGCCAAACACTTGGG	284	39	yes
GATCAGGATTCAGATGTAGA	7	6	yes
GATCAGGATGGGACAGTTCC	40	15	yes
GATCAGGAGTCCTTTGAGTG	10	10	yes
GATCGCTTGTAGAGAAAGCT	6	6	yes
GATCAGGAGGCAGTGTGTGG	8	8	yes
GATCAGGAGGAGAAAGTGAG	1	1	yes
GATCAGGAGCTGGCATTGGC	141	210	yes
GATCAGGAGCCCATTGGTGA	3	3	yes
GATCTTTCTCAAGAGCAGTG	22	6	yes
GATCAGGACTTGGTGGAAGC	27	11	yes
GATCAGGACTCCTGTGACTC	26	9	yes
GATCAGGACCTCATTTCACG	16	16	yes
GATCAGGACCTACTGCCACC	8	8	yes
GATCAGGACAGCAAAGACAG	11	11	yes
GATCAGGACAAAGAAATACC	16	16	yes
GATCAGGAATGTGTGCAGCA	57	38	yes
GATCAGGAATCCAGGCCAGG	94	16	yes
GATCAGGAAGATGGTAGCCT	258	95	yes
GATCAGGAAGATGACTGGCA	30	29	yes
GATCAGGAAGATGAACACTT	13	5	yes
GATCAGGAAGAGGACCAGCG	15	15	yes
GATCAGGAACTCCAGTTCAT	35	23	yes
GATCAGGAAAGAAATGGAGC	159	29	yes
GATCAGCGGTGGGAATGACA	1405	99	yes
GATCAGCGCTATTTCCTGAG	24	6	yes
GATCAGCGCCTCCAGTTCCT	292	26	yes
GATCAGCGAGTAAACTGGTA	29	9	yes
GATCAGCCTTTTCTGTCTTG	61	8	yes
GATCTTGTTCCCCATGGCTT	4	4	yes
GATCAGCCTTATTAATTCAG	4	6	yes
GATCAGCCTGGGCCACCTTG	90	58	yes
GATCAGCCTGCTCCTGGGGC	191	33	yes
GATCAGCCTCCATCCGCTCA	31	8	yes
GATCAGCCGTTCCTCTGGTG	66	8	yes
GATCAGCCGCTCAAGATTCT	344	45	yes
GATCAGCCCTCCCCTGTGTC	67	14	yes
GATCAGCCCTAATCCTCTGG	4	6	yes
GATCAGCCCGACTGTCTGCT	10	11	yes
GATCAGCCCATCCACTCTTT	2	2	yes
GATCAGCCCAGCCCATGTGA	155	25	yes
GATCAGCCATTTCTTGGGGT	17	11	yes
GATCAGCCAGTATCTTGAGT	23	4	yes
GATCAGCCAGGACCCTCAGA	55	42	yes
GATCAGCCACTTAGAATTCA	9	9	yes
GATCCACCTGGGGACCTGAG	40	11	yes
GATCAGCCACAAGATTTCAT	51	12	yes
GATCAGCCAAGGGTTCAGAG	196	18	yes
GATCAGCATTCTTGAGCTGG	83	62	yes
GATCAGCATTCACAAATTAC	24	15	yes
GATCAGCATGGTTGTTCTTC	10	8	yes
GATCAGCATGGGCACACAGC	10	10	yes
GATCGAGTCCATCCTGTATG	2	3	yes
GATCAGCATAGTTGTAGATT	39	39	yes
GATCAGCATAGCACATGAGT	14	10	yes
GATCAGCAGTGTCGGCCATT	55	20	yes
GATCAGCAGTGCCTTGTGTT	50	19	yes
GATCAGCAGGGATTATTCCA	2	2	yes
GATCAGCAGGAACCCCACCT	29	22	yes
GATCAGCAGCCTACGACCTT	7	5	yes
GATCAGCAGAGTGGTTATGG	17	13	yes
GATCAGCACTCTGCCTCCAA	36	6	yes
GATCAGCACTCAACCATTCT	52	7	yes
GATCAGCACTAAGACTGCTA	149	23	yes
GATCAGCACCTTGAAGAAGT	34	7	yes
GATCAGCACCTCTCCAAGAA	20	15	yes
GATCTGGCTTCGTTTAACCC	1	1	yes
GATCAGCACAGACACCATTT	26	18	yes
GATCAGCAAGTGACATTGAT	122	24	yes
GATCAGCAAGTCAGGAGTCA	95	15	yes
GATCATCCCGCGGGACCTCT	12	9	yes
GATCCTCAAGAGAAGCTTCA	117	81	yes
GATCAGATTTGTCCACAAGG	64	25	yes
GATCAGATTTGGTCTATCGG	33	13	yes
GATCAGATTTCACTGAATAC	23	17	yes
GATCAGATTGTCTCTGTTCT	6	6	yes
GATCAGATGGAGGCAGATGT	18	18	yes
GATCAGATGAGGGTGTGAGA	2	3	yes
GATCAGAGTTCTTTTGTACC	1	1	yes
GATCAGAGTGTGTCCTGCTT	1	1	yes
GATCAGAGTGTGGAAACTAA	5	7	yes
GATCAGAGTCGCCCTCCCAT	15	15	yes
GATCAGAGTCATAGGCTGGC	33	7	yes
GATCAGAGTATTCCTGCCAG	8	8	yes
GATCGTGCCCGCCACCTTGC	28	36	yes
GATCAGAGTATGTCTTGTGT	20	5	yes
GATCAGAGGTTCAGAATATC	97	72	yes
GATCAGAGGTTAGGACGTGA	23	6	yes
GATCTCCACTCTTCATGACT	6	7	yes
GATCCCCAGAGACAGAACTT	4	6	yes
GATCGAGGAAAAAGTGCGGA	3	4	yes
GATCTTGAGGACTTTGCTGC	12	12	yes
GATCCATTTATGGGACACTG	14	10	yes
GATCAGAGGCTGTGACTCAA	10	10	yes
GATCAGAGGCTCCCAACTGG	137	102	yes
GATCAGAGGCATTAACGTTT	32	22	yes
GATCAGAGGATGTGCCCTTG	2	2	yes
GATCAGAGGATGCGGAGCTA	5	9	yes
GATCAGAGCCGAACCTACTT	53	22	yes
GATCAGAGCCAAGAAACGCC	130	42	yes
GATCAGAGAGTGTCAACTTA	40	27	yes
GATCAGAGAGAGAGAGTTTC	44	16	yes
GATCAGAGAGAACCACTGGT	11	11	yes
GATCAGAGACAAGTTCATTA	68	7	yes
GATCCAGGTATCGGAGTCAA	34	21	yes
GATCCAGACAACGGAGCTTT	2	1	yes
GATCAGAGAACGGAAGAAGC	11	7	yes
GATCAGACTTATCATTTTTG	5	6	yes
GATCAGACTGGTGAGAAAGC	33	12	yes
GATCAGACCTGTGGCTGAGT	23	2	yes
GATCAGACCTGGGCGTGAAA	33	21	yes
GATCAGACCCAAAGAAAAGT	213	19	yes
GATCAGACACTGACTGGTGA	58	12	yes
GATCAGACACTCCCTCACCA	10	8	yes
GATCAGACAAAGCCTCTCAA	2	2	yes
GATCAGAATTCAGATTCTGA	5	5	yes
GATCAGAATTAGTCCCCACA	1	1	yes
GATCAGAATGTAAATGTGTG	17	11	yes
GATCAGAATGAACTTGCCAA	63	19	yes
GATCCAAACGGAAGCAGGGG	11	2	yes
GATCAGCTCCTCTCGTCTGA	16	12	yes
GATCCAAGGCCTCCACGTCT	8	5	yes
GATCCAAGGAAGAGCCCATG	5	7	yes
GATCACACACACTGACATAT	5	4	yes
GATCTGTTGTATGGATGGCT	2	2	yes
GATCTCTCCCTCATATAACT	6	6	yes
GATCCTAATTGCTTAGGTTT	5	3	yes
GATCCGTTACAGTAACATAA	11	9	yes
GATCCGTCGCCACTGGGGAG	3113	1235	yes
GATCAGTTACACCTGCAGCA	11	3	yes
GATCAGTAGTTGCATAGGGA	3	3	yes
GATCAGTAGGAAGCACAGGG	2	3	yes
GATCTTGTCAACTTCACCAA	2	2	yes
GATCCCTTCCCCACCTAGCT	11	9	yes
GATCCTACTGACAGCCATTG	1	1	yes
GATCTGCTAGAGCTGTAGTA	9	12	yes
GATCCGGGAGCGGCAGAAGT	20	5	yes
GATCAATCCAAACAGTTATT	7	10	yes
GATCTTCTTCCCGTTCTTAA	30	21	yes
GATCAGAAGATGAATCAGTA	9	9	yes
GATCACTTTGCCCTTTGATG	2	2	yes
GATCCCTCGGCCCTTGTCAT	8	8	yes
GATCAGGGTATAACTCAGTG	1	1	yes
GATCCTGCTAGGGAAAGCCA	22	15	yes
GATCCCCTTCCACGAGACAC	3	4	yes
GATCCAGGAGTTCCAAGAAG	6	9	yes
GATCCTCACAGGAGCCCTGT	8	6	yes
GATCCGCAGCTGCTGCAGTT	1	1	yes
GATCGTAAACTACTTGAGCT	39	25	yes
GATCGGCGCCTCCGGAGTAC	22	33	yes
GATCTATACCATGTTCTTTG	43	16	yes
GATCACTCAAAGTATCCCTG	6	6	yes
GATCATTCTGGTTTCAGAAC	14	6	yes
GATCCAAATAGTGCTGTGTG	4	3	yes
GATCCTTGAGAGGCAAGACG	39	10	yes
GATCAGCCATTAAGTCGTTG	4	3	yes
GATCAGGTGGAGTTGAAGGA	36	15	yes
GATCCTGGGTAGCATTTTAG	122	98	yes
GATCACCCTGTAACAATGTA	1	1	yes
GATCACTCATTGTTCAGGTG	20	13	yes
GATCCCTGCCTTACAATTGG	6	3	yes
GATCGGGTCAGTCACCTTTG	4	5	yes
GATCGGGCTGCCTGGCGTGG	17	5	yes
GATCCAAATGCCTTTCTTTT	2	3	yes
GATCGGGAACAGAAAGGGCG	70	11	yes
GATCGGCGTGTGGGCCAGGC	49	19	yes
GATCGGCGCTTTCAGACTAA	67	7	yes
GATCCTGAGAAACCTTTGAC	19	4	yes
GATCGCTGTGGCCGAAACTT	88	40	yes
GATCGCTGGGGAGTCGGGTC	47	2	yes
GATCCAAAGAGCAGGGATGG	837	79	yes
GATCCAAACTAAAGGCAGAG	15	3	yes
GATCCAAACCAAATCCCACC	8	4	yes
GATCTTGAGGTTACGGAAAA	20	35	yes
GATCACAGTGTACCCCACAC	17	11	yes
GATCACAGTCTGCATCCTAG	28	23	yes
GATCGCTCTCATTGCCCTTT	3	6	yes
GATCGCTCCGCAACTCATCA	20	13	yes
GATCGCTCACAAGGACTGAG	5	6	yes
GATCATTGGGACTGAGTGAA	2	2	yes
GATCGCTACCAAGCAGTTCT	41	12	yes
GATCGCGGACGGGCTGTGCC	10	15	yes
GATCGCCTTCTCCACCAATT	50	31	yes
GATCCTCAGGGCCTGAGCCT	6	9	yes
GATCTTAGTAACTACGATGA	11	11	yes
GATCGCCTGCGCACATTACC	8	6	yes
GATCGCCTCCTCCCTCTCTT	140	38	yes
GATCATGTGCCTTCCACTTC	2	1	yes
GATCTGTTTCACCATGGTTA	2	3	yes
GATCACAGACTCCAGCTTCG	1	1	yes
GATCACACTGTGAATCCTGA	5	1	yes
GATCCCTTCCAGGTCAGCTC	19	5	yes
GATCGCCCTGTACATACATA	40	10	yes
GATCGCCATCGGCAGGACTG	51	4	yes
GATCGCCAGGCCTTTTCATT	2	2	yes
GATCGCCACTTACCGGAACC	17	29	yes
GATCATCTTTCTGAGGGCTG	138	21	yes
GATCATCTGGGAGGGGATGC	11	7	yes
GATCCAGCAGTTCTACTTTA	36	3	yes
GATCCGGGTCCTCCTGGCAT	3	2	yes
GATCATTTGGTTCCTCTATA	30	7	yes
GATCAATATAAAAGCGTTCA	7	7	yes
GATCATCTGCTTCAGCATAT	5	6	yes
GATCGCATGCGCCCCATCTG	28	28	yes
GATCGCATGAAGAAACCATG	367	30	yes
GATCGCAGTAGCCAGCGCAG	89	46	yes
GATCGCAGAGTCCGCCAACT	30	2	yes
GATCGCAGAGGAGGGTTTTG	1243	239	yes
GATCATCTCCTTCCTCACCA	2	1	yes
GATCGCAGAGACATCAAGCG	81	10	yes
GATCATCGAGCCCACCAGTC	26	26	yes
GATCGACGAGAACTGGTATG	185	23	yes
GATCCTTTTGGACTTAATTT	3	4	yes
GATCAATCACATGTTCCAAC	54	9	yes
GATCCTGAGAGAGTCCCTGA	62	19	yes
GATCAGGTCTGCTTCAAGTA	6	4	yes
GATCCTTTTCCACTCCCAGG	9	4	yes
GATCCTTTGTGCAATATTGT	13	3	yes
GATCCTTTGCTCCTAGTGGA	32	5	yes
GATCCTTTCTACTATGATTG	332	9	yes
GATCCTTTCCTTGGACTCAC	46	10	yes
GATCCTTTCCATGCAAACTG	37	3	yes
GATCCTTTCATTTTCCAAGT	82	6	yes
GATCCTTGTTGTGCCTCTTC	43	5	yes
GATCCTTGTTCAATGCACGT	2	1	yes
GATCCTTGTGGCTGTGAAAA	8	8	yes
GATCCTTGTCCACCCCTCCC	80	36	yes
GATCCTTGGGGTAAGCAGAA	20	10	yes
GATCCTTGGAGTCTGGATAA	20	1	yes
GATCCTTGATTTTTCTTTGA	8	10	yes
GATCCTTGAGGTCACGTTGC	80	25	yes
GATCCTTCTTGTGGAACAAC	24	8	yes
GATCATATGGAAAGAGGAAA	665	82	yes
GATCCTTCTCTGCTAGTTTA	33	22	yes
GATCCCCAGGGCTCACGCAT	24	22	yes
GATCGACCATACAGTAGAAC	5	4	yes
GATCCCAGCCTCAAAGGCAT	5	4	yes
GATCACCCTGCACCCCGTCA	56	35	yes
GATCCTTCTACCCACATACT	35	20	yes
GATCCTTCCTGCGGGCGGTG	70	5	yes
GATCCTTCCAGGAAGAGGAA	11	11	yes
GATCCTTCAGTCCTCTTAGT	129	23	yes
GATCCTTCAGATAGTGGACA	8	12	yes
GATCAGTTTGTCTGAAAAAA	11	7	yes
GATCCTTCAGAATCTCTGTT	9	4	yes
GATCAGTTTGCCTTCATTCA	38	24	yes
GATCCTTATTAAACACAGCC	13	8	yes
GATCCTTATCGGCATTTCGT	2	2	yes
GATCCTTACTTGGTGCAGGT	39	21	yes
GATCCTTACCCTGTCCCTGT	86	14	yes
GATCCTTACCAGTGAGGCTG	3	4	yes
GATCAGTGTGTCTGTCTATG	39	10	yes
GATCCTGTTGAAAGACAAAA	11	10	yes
GATCCTGTTCCGAGCAAGCT	89	57	yes
GATCCTGTTCAGCCACTTCC	11	4	yes
GATCCTGTTAGTGAGCAGGG	150	45	yes
GATCAGTGCCTGGCGCCAGA	126	16	yes
GATCCTGTGTGGGAGGCTTC	87	9	yes
GATCCTGTGTGCGTTGATGA	446	49	yes
GATCCTGTGGGACCATCTAG	13	19	yes
GATCCTGTGGAAAGGATGCA	4	4	yes
GATCAGTCAGCCGCTGCCCG	13	13	yes
GATCCTGTCTCAAGCACACC	2	1	yes
GATCCTGTCCCAGGGGCTAG	35	52	yes
GATCAGGTCTCTCCAACTCA	16	3	yes
GATCCTGTCACTGGGGAGGC	23	9	yes
GATCCTGTAGCTCAGCAGAC	14	14	yes
GATCCTGTAAAGGCAGGGCA	5	7	yes
GATCCACTCAATTTGGTGTC	19	14	yes
GATCCAGGCTTGAGAGCCCA	2	1	yes
GATCCTGGTTTTATGCTTGT	144	30	yes
GATCCTGGTTGGGGGCAAGG	89	31	yes
GATCAGGCATTGGCTGTAAA	8	5	yes
GATCCTGGTGGTTCACCTCA	52	36	yes
GATCCTGGTGCTTGGCTATG	4	3	yes
GATCCTGGTGAATGAACCAT	10	3	yes
GATCCTGGTCCCCAGCACCT	34	7	yes
GATCCTGGTAGCTCACCAAG	114	71	yes
GATCCTGGGTCCCTCGTAAG	238	14	yes
GATCCTGGGTACTAAGGTCA	968	92	yes
GATCCTGGGGACCCAGAATG	84	26	yes
GATCCTGGGAAGTTGGATTA	145	49	yes
GATCCTGGGAAGTGACTACA	166	30	yes
GATCGCTGCAGAGCAGAGCA	24	5	yes
GATCGCTCTCTGCAGCCATT	2	2	yes
GATCCTGGGAACTATGTAGA	108	14	yes
GATCCTGGGAAATAAAAGGG	16	16	yes
GATCCTGGCTGCCTACCAGC	357	31	yes
GATCCTGGCTGCCCACTTGG	48	33	yes
GATCAGCTTCGAGAGCCAGT	6	5	yes
GATCCACTTTGGCACAGAGG	1	1	yes
GATCCTGGCGCTGGCTGTCC	63	2	yes
GATCCTGGCGCGGGTAGCCA	50	74	yes
GATCCTGGCAGTGGACCGCC	6	5	yes
GATCCACGCACATTCTCACC	2	1	yes
GATCCTGGCAACAGCTGTTT	41	8	yes
GATCCTGGATGTGTAAGAAG	11	10	yes
GATCAGCTGATGTGGGTGCT	26	13	yes
GATCCTGGAGTTTTCTACAG	7	10	yes
GATCCTGGAGGAACCTTCGC	51	39	yes
GATCAGCTCTGCCGTCTCTA	50	7	yes
GATCAGCTCTACCCAGAGAT	3	3	yes
GATCCTGGAGAAGCATGTTC	84	15	yes
GATCCTGGAGAACACTGGTT	14	3	yes
GATCCTGGACGAGGCCACCA	32	23	yes
GATCCTGGACCGCCACAATT	3	4	yes
GATCTTCCTCGGGCTTGGCC	8	8	yes
GATCCTGGAATTGGCTGGTA	66	35	yes
GATCCAGAAGACGAAAGAAG	8902	716	yes
GATCTGCATGTCTTCATTGA	13	13	yes
GATCGAATGTACCAACGGTT	1	1	yes
GATCCTGGAAATGGACAAAG	10	1	yes
GATCCTGCTGTAGCTGCGCC	17	12	yes
GATCCTGCTGCAGGCAGTGG	6	5	yes
GATCCTGCTGACACGGTGCG	42	13	yes
GATCCTGCTCCAGGAGATTG	160	23	yes
GATCCTGCTAAGCACTGAGG	509	85	yes
GATCCTGCCGTGTTTGCGGA	11	7	yes
GATCCTGCCCTGGGGTGAGG	99	12	yes
GATCCTGCAGCGGTTCCTAC	26	10	yes
GATCGCCAAGTTCAAAGCTG	7	10	yes
GATCCATTCGCAACTTGGCT	34	7	yes
GATCCCAACAATGCAGCCAT	157	118	yes
GATCACCATTTCCGACTCTG	26	22	yes
GATCAAGGTGGGAGGGAAGA	21	14	yes
GATCAGCTCAGACTGTGAAC	7	3	yes
GATCAGAAGTTCAGGGTTAT	73	20	yes
GATCAGAAGTTCAGGGTCAA	14	9	yes
GATCAGAAGTTCAATACAAT	16	16	yes
GATCAGAAGTTCAAGGCCAT	54	22	yes
GATCAGAAGTTCAAGGCCAG	39	40	yes
GATCTCGTCGCCAGACCCTC	22	2	yes
GATCAGAAGTGCCTCCTTGT	4	3	yes
GATCAGAAGTAGCCAAGTAG	9	9	yes
GATCAGAAGTACCAGAAACA	176	110	yes
GATCAGAAGGAGATACTCTG	89	30	yes
GATCAGAAGGAAGAGAAACA	26	17	yes
GATCAGAAGCTGTGTGCGTT	62	2	yes
GATCAGAACTGGGTGCCAGC	20	4	yes
GATCAGAACTGGACAGCTCC	92	11	yes
GATCAGAACGCAATAATTTT	2	2	yes
GATCAGAACCCAGCCGAGTG	23	23	yes
GATCAGAACATTTGTTCCAA	2	3	yes
GATCAGAACATCTCTGGCTA	3	4	yes
GATCAGAACAGGTGTCCCTT	41	12	yes
GATCAGAACAGACAATAGGT	70	45	yes
GATCAGAACACTGTTAAATG	2	2	yes
GATCAGAACAACAGACAGTG	74	46	yes
GATCAGAAATGAGGTGTAAC	53	33	yes
GATCAGAAACTGTCCTCTGA	58	6	yes
GATCAGAAACAACTGTGTCT	90	74	yes
GATCAGAAAAGTCTCGACTA	6	6	yes
GATCACTTTTTTCTGACTCT	1	1	yes
GATCACTTTTGTATTTGTTG	15	4	yes
GATCACTTTTGGTCAATATG	21	31	yes
GATCACTTTGTAGTCATGTA	27	27	yes
GATCACTTTGCCAAATAAAT	11	9	yes
GATCACTTTGAGGAAGCCAT	441	97	yes
GATCACTTTCTAGGTTCCTA	263	42	yes
GATCTATAAATGGGGCAGGA	2	3	yes
GATCCATTTTTTTTTCCCCT	2	4	yes
GATCACTTTATTGCTGAACA	177	14	yes
GATCACTTTACTTTATCCAA	47	33	yes
GATCACTTGTTTGTGGTGAG	328	46	yes
GATCACTTGTTATGTACATT	20	3	yes
GATCACTTGTCAGTGTTCAG	376	38	yes
GATCACTTGGGCCTCAGTTC	17	3	yes
GATCACTTGGCTTTTCTGGG	7	10	yes
GATCACTTGGCGGTGACTTT	201	22	yes
GATCACTTGCTGAAATGAAT	46	5	yes
GATCACTTGATTTCTTGTGC	45	9	yes
GATCACTTGAGTTCTGGTAG	2	2	yes
GATCACTTGAAAACTAATCT	20	7	yes
GATCACTTCTGAAGAGCTTC	5	7	yes
GATCACTTCTCTGGTCTCCA	65	23	yes
GATCACTTCGGCCTGTACAC	54	27	yes
GATCACTTCGCCCTTTTTTG	7	10	yes
GATCACTTCCTATAGACCCA	11	11	yes
GATCACTTCCGTGCCTCCCT	14	10	yes
GATCACTTCAGTCTGTGCCA	49	8	yes
GATCACTTAGTGGGGGGTTT	10	6	yes
GATCACTTACTGCCTAATGC	131	35	yes
GATCACTGTTACCTCATTTC	2	2	yes
GATCACTGTGTTGGACACTC	498	112	yes
GATCACTGTGTACACATTGG	142	40	yes
GATCACTGTCTCAGGCCTTT	48	38	yes
GATCACTGTCCCCCTGGGAA	39	18	yes
GATCACTGTATGTTTGAGAG	8	8	yes
GATCGACCACATCCTGGATG	70	32	yes
GATCTGCATGAGAAAAGAAA	2	2	yes
GATCACTGTACTCTTCTTTT	17	14	yes
GATCACTGGTGTTTCCCATT	19	15	yes
GATCACTGGTGGCATCGCTG	9	6	yes
GATCACTGGTCTGTGACCTA	2	3	yes
GATCACTGGGTGTGTTTCAG	137	36	yes
GATCACTGGGGGCTCTTGTG	6	6	yes
GATCACTGGGAACAAACGGC	142	18	yes
GATCACTGGCTGAGTAGATG	65	8	yes
GATCACTGGCACCAAAGAAG	1	1	yes
GATCACTGGAAACGATTGCT	61	3	yes
GATCACTGCTCAAGCCTGGG	4	6	yes
GATCACTGCGTTAATCTTGG	31	14	yes
GATCACTGCGAAGTTTCGTT	158	32	yes
GATCACTGCCTTTCCCCCTC	95	21	yes
GATCACTGCCGAGAAAATCA	8	4	yes
GATCACTGCAGGGGGTGCCA	87	8	yes
GATCACTGCAGGCGCAGCGG	376	27	yes
GATCACTGCAACCTTGTGCT	34	7	yes
GATCACTGATTCAGAGCTCA	24	6	yes
GATCACTGATGGCCAGAATG	33	14	yes
GATCACTGACCTTGGAGCTT	17	5	yes
GATCACTGACCTCTGGAGTC	114	16	yes
GATCACTGAATATTGCCCCT	3	3	yes
GATCACTGAAATTCAAAGAA	117	19	yes
GATCACTGAAATAAGCACTT	6	5	yes
GATCACTCTTGAAAATCACT	14	10	yes
GATCACTCTGTGTGTGGTAG	2	2	yes
GATCACTCTGGCCGCTCTTC	301	93	yes
GATCACTCTGGCCAAGTAAG	44	15	yes
GATCACTCTGGAGTTCAGCG	1709	432	yes
GATCACTCTGGAGCATTTTT	8	4	yes
GATCACTCTGAATGGTTGAA	4	6	yes
GATCACTCTCTGCATCGCTG	19	8	yes
GATCACTCTCATACGATACG	8	3	yes
GATCACTCTACCCTCGAAGA	38	31	yes
GATCACTCCTTTTGAGGAAA	306	40	yes