#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCATCACTTTCTCCCTCT	326	60	yes
GATCACCGTCTAAGCCTCAG	1	2	yes
GATCAGTGTGTGCCAAGGAG	14	1	yes
GATCAAGAGTCTCAAACCCA	7	9	yes
GATCAGTCAGTGACAACCAA	17	17	yes
GATCAGTATGAGGATTGCTA	5	5	yes
GATCAGTAGAGCTTGGACCC	64	63	yes
GATCAGTACACGGTGTATGT	7	6	yes
GATCAGGCTGTTGTAAAATC	4	4	yes
GATCTGGCAGTCATAGCTTG	31	8	yes
GATCTGGCAAAAACTACGGG	53	45	yes
GATCTGGATTTGGTTGAGAT	7	6	yes
GATCAAATACAACCTGCTTT	10	10	yes
GATCTGGACTTTGCTCAACC	22	16	yes
GATCTGGACTCACCTGGGAG	3	4	yes
GATCTGGACGATTCTGAGCC	65	5	yes
GATCAGACTGTTGCTTTCGC	48	47	yes
GATCAGAGACTCTGGGGATT	16	15	yes
GATCTGGACCCAAATAAAAC	388	489	yes
GATCTGGACAATAATCATTC	34	33	yes
GATCTGCTTTGTGCTTGGCT	199	56	yes
GATCTGCTTTCTCAGGACTC	8	6	yes
GATCTGCTTTCCATCGTGTC	40308	7038	yes
GATCTGCTTGTGTTGTGTTG	16	14	yes
GATCTGCTTGGCTGCCATTA	22	22	yes
GATCTCGGACGCTCAGTGGG	55	56	yes
GATCAGAACCTTGCCGAAAC	9	9	yes
GATCAACGTGATGGACGCAC	14	14	yes
GATCTCCTTCCTGGCTGTAT	25	2	yes
GATCACTGACATCTATACCC	5	5	yes
GATCACAAGTGGAAAGCAAT	21	21	yes
GATCACTCTGGTCGTGTGGG	3	3	yes
GATCTCATTGGATTGCCTCC	4	4	yes
GATCACCTGTGGAGTTGTCA	27	27	yes
GATCTCCCTGTGCCGGTGCC	47	46	yes
GATCACATGGGTCGAGGGTT	49	14	yes
GATCACAGAGTGGGAATCTC	8	8	yes
GATCACACTGTCTGAGGCGT	132	28	yes
GATCAAGGACATCCATGTGC	43	42	yes
GATCAAGAGCAGTGCTGCTC	17	17	yes
GATCTCAGAGGCTCGGTATC	5	5	yes
GATCAAACCCAGGGCTTTGT	196	38	yes
GATCACTTTATTTGCTAGGG	107	17	yes
GATCAAACGTGGCTGAGCGC	1426	233	yes
GATCAAACGTGGCTGAGCGA	14	20	yes
GATCATCTTGTGAAAACCCA	391	95	yes
GATCATCTTGGAAGGATTCC	1	2	yes
GATCTTTTCCACCTTCAGAG	87	29	yes
GATCTTTTACTTCGTGGCTG	31	32	yes
GATCAAAATCGCAGTTACTT	27	28	yes
GATCATCCAGAACACAGCCT	1809	336	yes
GATCCATTCACCTACGGCAA	1	1	yes
GATCCAGAAACACAAAAAGG	1	2	yes
GATCTGCGCTTCCAGAGTGC	1164	78	yes
GATCCACTCAGCCGTGGTTT	3	3	yes
GATCCCCACTTTTCTACTGG	4	1	yes
GATCCTGAGCTTTGACAAGA	552	622	yes
GATCCTGAGCCAGATGTCAT	58	15	yes
GATCCTGAGATGCAGCTCAT	13	13	yes
GATCCTGAGAGCCTCATCCT	14	8	yes
GATCCTGAGACAGGGAAAAG	1100	339	yes
GATCCTGAGAACACTGAGGA	43	33	yes
GATCCTGACTTTGCCAGCTG	68	24	yes
GATCCTGACTCTGACACTAC	50	12	yes
GATCCTGACCTGGGCTTCCT	7	8	yes
GATCCTGACCACATGAACAA	214	68	yes
GATCCTGACAGTGCACCTAA	89	64	yes
GATCCTGACAGAGCCTTGGT	113	8	yes
GATCCTGAATGAGCTGTACC	2	2	yes
GATCCTGAATGACGTTCAGG	37	25	yes
GATCCTGAAGGTCATCCGCA	22	5	yes
GATCCGGTCGTGTGACCGCC	14	18	yes
GATCCGCATCCTCAACCCAT	30	24	yes
GATCCTGAAGAACTTTGTCA	247	53	yes
GATCCTGAACGAGAGCCTGC	3	5	yes
GATCCTGAAATCAAAACTGC	266	109	yes
GATCCTGAAAGCCAAGTTAG	59	60	yes
GATCCTGAAACTGACTCGCT	6	4	yes
GATCCTCTTTGCCAACCCCA	27	22	yes
GATCCTCTTTGCACAGAAGA	29	29	yes
GATCCTCTTTCACGCTTCTT	5	4	yes
GATCCTCTTGTCCACTCCAC	5	6	yes
GATCCTCTTGCTGCAGCTTC	48	8	yes
GATCCTCTTGCGGGACAGTC	20	16	yes
GATCCTCTTGATTCCTTCTG	50	40	yes
GATCCTCTTGATGCAGAGAG	34	24	yes
GATCCTCTTCTTCCTCGTGA	8	6	yes
GATCCTCTTCTTCAGCACAC	364	258	yes
GATCCTCTTCTGCTGTTCTG	31	21	yes
GATCCTCTTCCTGCTCCAGC	262	62	yes
GATCCTCTTCATCTTGGGCA	541	59	yes
GATCCTCTGTGGACTCATCT	3	4	yes
GATCCTCTGTGCCTCACTCC	13	17	yes
GATCCTCTGAGGCAGTATTG	40	50	yes
GATCCTCTGAATGTTTTCCC	1606	269	yes
GATCCTCTCTTGTGCTACCT	4	5	yes
GATCCTCTCTGAACCTCCTG	110	5	yes
GATCCTCTCTCGGTGTGGTT	112	31	yes
GATCCTCTCATTCAGTCTTC	28	10	yes
GATCCTCTCATCTTCAGCCT	34	48	yes
GATCCTCTATGAGCTAAGCA	122	25	yes
GATCCTCTAGGGGTTATGGG	190	31	yes
GATCCTCGTCCACCCTAACT	1574	109	yes
GATCCTCGTCACCACAGTTG	8	10	yes
GATCCTCGGGCAAGCCAAGA	1437	792	yes
GATCCTCGGGAGACCACTGG	12	16	yes
GATCCTCGGGAATTTTTACC	37	25	yes
GATCCTCGCAGCTTCTATGA	119	31	yes
GATCCTCCTTTTCTTGGCGG	5	7	yes
GATCCTCCTTGTCAAGTACA	377	98	yes
GATCCTCCTGTGAAGTGCCA	27	6	yes
GATCCTCCTGCGTGCTGACA	37	10	yes
GATCCTCCGTGAGTATGCCT	68	23	yes
GATCCTCCCCTTTACGGACA	69	9	yes
GATCCTCCCCCTCTCCCACC	12	12	yes
GATCCTCCCCAGGGATGGGG	33	42	yes
GATCCTCCCAAGTGAATGAC	31	11	yes
GATCCTCCAGCACCAGGCAT	8	8	yes
GATCCTCATGTTCAGTTTTT	1	1	yes
GATCCTCATCTTCATTCCTT	1	1	yes
GATCCTCAGTTACTCGCTGC	61	14	yes
GATCCTCAGTGGGTAAGTGC	5	4	yes
GATCCTCAGTGCTACTTGCG	13	5	yes
GATCCTCAGGGTCTGCCCTT	18	14	yes
GATCCTCAGGAGTTGCAATG	2027	134	yes
GATCCTCAGCTGGCTGGAGC	23	11	yes
GATCCTCAGCCCCAGATGCT	2081	247	yes
GATCCTCAGCCACCCACAAC	35	5	yes
GATCCTCAGAGACGTGCTCG	61	10	yes
GATCCTCAGAAGGTGAAGGA	27	34	yes
GATCCTCACCATCCACGTTT	13	10	yes
GATCCTCACCAGCCGCGGGC	954	165	yes
GATCCTCACAGCTCTGATGC	1289	282	yes
GATCCAGTGCCTGTGTAGAA	84	15	yes
GATCCTCAACTCCTCCAAGG	109	41	yes
GATCCTCAACATTCCTCGAA	44	18	yes
GATCCTCAACATCCGCCTGC	35	17	yes
GATCCTCAACAAGATGCTAT	38	7	yes
GATCCTCAAACAGACATTGT	3	4	yes
GATCCTATTGAGTTGCTAAG	23	29	yes
GATCCTATTCTCCAAAGACT	11	14	yes
GATCCTATTCCAGCCAAATG	38	48	yes
GATCCTATTAGCCAAACTTT	8	8	yes
GATCCTATGTGTTGGCCATT	41	30	yes
GATCCTATGGTGTCCACACT	13	7	yes
GATCCTATGGTGATTCCAGT	3	3	yes
GATCCTATGGCATATGCAAG	28	9	yes
GATCCTATCTCCCGGTTGGG	20	14	yes
GATCCTATCATTGCTGGTGG	506	16	yes
GATCCTATCACCAGCACTGA	122	27	yes
GATCCTACTTTGGGAACATG	220	29	yes
GATCCTACTGTGGATGACAC	407	46	yes
GATCCTACTGATGAAGTGCC	33	23	yes
GATCCAGGTTTTGTGGTCTT	1	1	yes
GATCCCTCTCCCAGGAACAA	34	3	yes
GATCCAAGCTGTCAAGAAGG	147	12	yes
GATCCAAGCTCCATTGTACC	31	8	yes
GATCACTTGTTTGTGGTGGG	18	25	yes
GATCCTACCTTCTGCTTTCG	114	28	yes
GATCCTACCTGAGTGGCAGC	500	148	yes
GATCCTACCACAGAGCCTTA	23	16	yes
GATCCTACATCCATTCGGCT	778	161	yes
GATCCTACAGTGGCTGGCAA	180	22	yes
GATCCTACAGTCACTTCACA	59	8	yes
GATCCTACACTCCTGGCAGT	52	16	yes
GATCCTACACATGGAGGCTG	15	10	yes
GATCCTACACAGCTAATCCA	127	129	yes
GATCCTACACACCTACCAGA	25	25	yes
GATCCTACACACAGTGGTGA	26	8	yes
GATCCTACAAGCCTGTCCGT	25	17	yes
GATCCTACAACTCAGAAGAC	20	6	yes
GATCCTAAGCAGATTCTGGG	11	8	yes
GATCCTAACTGTGGAACCTC	27	9	yes
GATCCTAACTCTGACCTTTC	14	10	yes
GATCCTAACCTAAGATGCCT	441	30	yes
GATCCTAACCCAGTGGACTC	19	14	yes
GATCCTAAATTTGACCCAGG	65	5	yes
GATCCTAAAGGCCGGTCACA	157	57	yes
GATCCTAAACTCTGTTGCCA	29	10	yes
GATCCTAAACTCCAAGGGGA	5	7	yes
GATCCTAAAACTGAGGAAAG	10	4	yes
GATCCGTTTGGCCTCTCAAT	51	0	yes
GATCCGTTGGAAGGTTTACC	13	2	yes
GATCCGTTGCCAGTTACCTG	44	2	yes
GATCCGTTCCTAGGGTACCT	180	177	yes
GATCCGTGTGTTGTTAAGAT	21	21	yes
GATCCGTGTGTGTGTGGGAG	108	4	yes
GATCCGTGTGAAACTGGATG	969	140	yes
GATCCGTGTATGTCTAAACA	18	23	yes
GATCCGTGGCTGCAGCAGAA	34	8	yes
GATCCAAAGGAGCTACTTAG	52	2	yes
GATCCCGAGCTTCAAATCCC	25	8	yes
GATCCAAACCATGATGAGAA	2	3	yes
GATCCGTGCTGAGCGTCGGC	218	23	yes
GATCCGTGCTGAATTGGTTT	8	6	yes
GATCCGTGCATCTCATTGGC	38	2	yes
GATCCGTCTGTGGGGGCCTC	63	62	yes
GATCCGTCATCTCCAGGACA	166	48	yes
GATCCGTCAGGCTTGCTCGT	5	5	yes
GATCCGTCAAGCTAACTGGA	42	33	yes
GATCCGTATCAGGTTCATGT	4	4	yes
GATCCGTAGTCTGAGTGATG	74	8	yes
GATCCGTACCCTGGTGCTGA	119	29	yes
GATCCGGTCCCAAGACCGCT	322	12	yes
GATCCGGTCCAAGGCTCTTG	74	21	yes
GATCCGGGTGTCCAGTGACA	297	15	yes
GATCCGGGTGATGCGAATCG	29	4	yes
GATCCGGGCTCACGGAGGGA	2	3	yes
GATCCGGGCAAAGCCTGCTC	424	32	yes
GATCCGGGAGGTGTGCGGCT	873	66	yes
GATCCCCTTCTACGTGACCA	2	2	yes
GATCCAAAATGTTCCATGGA	2	3	yes
GATCCAAAAAGCAGTTCAAC	253	18	yes
GATCCGGCAGAAGGATGAGG	42	31	yes
GATCCGCTTGGCAGCCATTC	503	57	yes
GATCCGCTTACAGAGACTTT	30	27	yes
GATCCGCTGCAACCCGGTGC	1008	138	yes
GATCCGCTCTGTGGTCGCCT	73	8	yes
GATCCGCTCTGAGGTTCTGT	241	38	yes
GATCCGCTCAGAGCCCAGCA	121	34	yes
GATCCGCTCACGCCCAGCAG	68	6	yes
GATCCGCCTTCTACTCGGAA	15	2	yes
GATCCGCCGCTAAGACCTGG	35	5	yes
GATCCGCCCTGTGAGTCACC	20	15	yes
GATCCGCCCACACCCACGTG	482	20	yes
GATCCGCCAAGTTATTCAGG	3	4	yes
GATCCGCCAAAAAAATGCAC	2	3	yes
GATCCGCATGGCCTGTGAGG	631	173	yes
GATCCGCATCCGCAAGCCCT	201	135	yes
GATCCGCAGGTCAGATGACA	54	9	yes
GATCCGCAGCTTTTCCAGCA	247	36	yes
GATCCGCAATTATGAAGAAC	52	1	yes
GATCCGCAAGGTGCTGGACG	155	63	yes
GATCCGCAAGGACTTCTTAT	33	42	yes
GATCCAGACTTTAAGGGTTT	6	2	yes
GATCATTTCGGGCCAGTAGG	21	21	yes
GATCCAGACAGCCATCAAGG	46	12	yes
GATCCCCGAAGTCTCTCTCC	34	1	yes
GATCCCCCAAAGGCACATGT	18	19	yes
GATCCGCAACTGTCCGGAAG	183	38	yes
GATCCGATTTCTGATTTTGC	67	18	yes
GATCCGTGCCTGCCCAGGCA	4	5	yes
GATCCGAGGCAGATTTTCTT	27	28	yes
GATCCGAGCGACTGTCACCA	12	12	yes
GATCCGAGCCTGTCTGGATG	110	20	yes
GATCCGAGCCTCACTACCTG	76	30	yes
GATCCGACAGGAGGGTGTAA	48	34	yes
GATCTGCTTCCCATTGTGGT	254	7	yes
GATCTGCTTCCCAACTGTTA	7	8	yes
GATCCCAGCCCTTGAAACTG	10	13	yes
GATCTGCTTAGTAAACCGGT	23	5	yes
GATCCTAGCTCAGAGAGGCT	3	4	yes
GATCTGCTGTTCCTCACGAA	83	20	yes
GATCTGCTGTGGCCATCATT	73	13	yes
GATCTGCTGTCTACTACCTA	6	5	yes
GATCTGCTGTAGCATCAAGC	64	63	yes
GATCTGCTGGTCATTAAGGG	364	115	yes
GATCTGCTGGCAGTAGTAGT	3	4	yes
GATCTGCTGGAAGATAATCT	6	7	yes
GATCTGCTGCCTGCTCCCAC	10	16	yes
GATCTGCTGCAGGGTTCTGT	104	15	yes
GATCTGCTGATGTTACGTCG	104	103	yes
GATCTGCTGATATTCCGGGC	4	6	yes
GATCTGCTCTGTAGAAAGAA	25	22	yes
GATCTGCTCTCCACCTGTCT	21820	803	yes
GATCTGCTCTCAAAAATTCC	22	3	yes
GATCTGCTCCTTCTGTCCCA	45	11	yes
GATCTGCTCCTTAACGTTTT	3	5	yes
GATCTGCTCCCAAGTTATCT	35	13	yes
GATCTGCTCCAACTACAGGA	67	46	yes
GATCTGCTCAGTGACTTGTG	5	3	yes
GATCTGCTCACTCTATTACT	16	2	yes
GATCTGCTCAACAACTCCTT	2	3	yes
GATCTGCTCAAAATCAAGAA	326	19	yes
GATCTGCTATGTACTCCAGG	79	20	yes
GATCTGCTATCTCACCTGGC	184	55	yes
GATCTGCTAGAGCTGTAATA	420	29	yes
GATCTGCTACTGGAGATGTT	33	5	yes
GATCTGCGTATGGCGGCCAT	832	142	yes
GATCTGCGTACACCTGCGTC	2703	184	yes
GATCTGCGGTGACTTGATGT	400	74	yes
GATCTGCGCTATAGAAAAAA	13	4	yes
GATCTGCGCCTGCCTTGTCT	100	75	yes
GATCTGCGCCTGAGCCAAAG	147	111	yes
GATCTGCGAAGCCAGGCTTC	17	12	yes
GATCTGCCTTGGATTTCCTC	10	2	yes
GATCTGCCTGTTGGGTTTGT	162	8	yes
GATCTGCCTGTTACCTCTTC	1	1	yes
GATCTGCCTGCCATTGCTGC	518	92	yes
GATCTGCCGCAGTAAGCGAG	48	8	yes
GATCTGCCCTTTCTGGGTGA	217	4	yes
GATCTGCCCTTACATTCTTG	185	26	yes
GATCTGCCCGAAGCCATGAG	112	40	yes
GATCTGCCATTCCCATCTGT	46	21	yes
GATCTGCCAGTTTTGGTGCC	14	14	yes
GATCTGCCAGTGTGGAGCAG	801	132	yes
GATCTGCCAGTCCGAGGTTC	125	34	yes
GATCTGCCAGTAGTTCTGTA	34	2	yes
GATCTGCCACTTGTTTTAAT	28	15	yes
GATCTGCCACTGCTTCTCTA	85	83	yes
GATCTGCCACAGCAAGAGTG	8	8	yes
GATCTGCCAAGATGAACAAG	76	74	yes
GATCTGATTTCATCTCCTCA	60	47	yes
GATCTGATGTATGCCAAGCG	230	41	yes
GATCCTGGCAGGATGCAGTG	26	27	yes
GATCTGATGCCTTCTGGTGT	13	12	yes
GATCTGATGCACTCGGGAGA	97	65	yes
GATCTATCGGCCTCTGCCTC	30	29	yes
GATCTATCCTAGCCGGGAGG	852	10	yes
GATCTGAGTTCAATCCTGGC	256	131	yes
GATCTGAGGGTTGATTGACA	1975	549	yes
GATCTGAGGCCTTGTTTTTT	87	6	yes
GATCTGAGCTGCCCTCTGCT	14	14	yes
GATCTTTGCCAAAATGTGTG	2	3	yes
GATCTGAGCCCCACTGTTCC	4	4	yes
GATCTGAGCATAGCGTCAGA	10	15	yes
GATCTGAGCATAGAAGAAGG	27	27	yes
GATCTGACCCCATGGCTTCC	6	4	yes
GATCTGACCAACAAGACCAC	47	46	yes
GATCTACCCTTGCTTAAAAC	1	1	yes
GATCTACCACCCTAACATCG	26	26	yes
GATCCTGGCACCTGATATCC	5	8	yes
GATCTACACATGGGGCAACC	874	196	yes
GATCACTGACTGCCCCAAAC	25	11	yes
GATCTGAATTTCTTCCTCTT	5	5	yes
GATCTGAATGTCCGAGAGAG	103	19	yes
GATCTGAATGCTCTGGGGGC	16	20	yes
GATCTGAATCCACTGTGGCT	30	22	yes
GATCTGAAGTCTGAATGGCA	10	13	yes
GATCTGAAGCTGCTGATGAA	67	52	yes
GATCTGAAGATTTCCCTATC	76	59	yes
GATCTGAACTCCAGAGAACA	57	38	yes
GATCTGAACCTGCCTGGAAA	4	4	yes
GATCTGAACACCCAGCGAGG	77	53	yes
GATCTCTTTTGCCAAGAAGT	25	24	yes
GATCTCTTTGTGTTCAAGAC	47	4	yes
GATCTACGCACGCATCAGCA	48	10	yes
GATCTTGTACAAACCGGTTT	8	8	yes
GATCTCTTTGCCCTTGCACT	81	80	yes
GATCTCTTTCTTGTTCCCCC	40	40	yes
GATCTCTTTCTGAGACCTTT	5	5	yes
GATCTCTTTCCTGGACATTT	9	9	yes
GATCTCTTGCTGGGGATTGT	110	7	yes
GATCTCTTGAGTGTTTGAGG	50	70	yes
GATCTCTTCTTCCGCCCTAT	104	56	yes
GATCTCTTATCTGGCAAGGA	11	16	yes
GATCTTGGCTCTGTGGAATG	115	10	yes
GATCTGCATGCCATGGGTTC	26	26	yes
GATCTCTGTGTTCAGGCTCT	13	10	yes
GATCTTGCTCTTCCTCTCTG	5	7	yes
GATCTTGCGTGTTCTGTCCG	3	4	yes
GATCTTGCCTCGAGGCCCTC	16	15	yes
GATCACCTTTTTTGACGAGT	1	1	yes
GATCGTCTGCTGTGAAACGT	145	48	yes
GATCGTCCCCAAAATTGCCT	10	10	yes
GATCGTACGGGGCTGGAAAC	50	49	yes
GATCTTGACCTTATCCAGTC	3	5	yes
GATCGTGGGCTTCAGCACCC	29	22	yes
GATCGTGGCACAAAATAGCT	1	2	yes
GATCGGTCTGAGATGACTCC	51	16	yes
GATCACACTGAAGATGCCTC	34	33	yes
GATCGGCTTTGAGAGAGGGT	218	34	yes
GATCGGCCAGTTCCAAGTTT	820	81	yes
GATCGGCAAGCTGGAAGGCT	40	40	yes
GATCCAGAGGAAGTCTGACC	1	1	yes
GATCAGTTGACAGTGGCAAT	179	116	yes
GATCTTCCTGCCTCTGCTTC	5	5	yes
GATCACCAGCCTTTTGCAAA	6	7	yes
GATCGCTCATTGGAACAGCT	115	27	yes
GATCGCCCTTGCTGGTCTGC	5	5	yes
GATCTTCAGTAGTCTCTCCT	16	15	yes
GATCTTCAGCCTCTTGGGGA	8	12	yes
GATCTCTTTTCAGAAGTGTC	5	5	yes
GATCTGGCCACTTTGCTGGG	2	3	yes
GATCTGTTGCTCCAAGACCC	12	12	yes
GATCTCTGTGCTGTAAACTA	18	13	yes
GATCCCTTTTCCATTCTGGA	158	26	yes
GATCCCTTTGGGGTGTGGAA	699	46	yes
GATCCCTTTCTCTGGCCCAG	61	60	yes
GATCCCTTTCCACCTAAAAC	72	26	yes
GATCCCTTGTGAGCCCTAGT	74	53	yes
GATCCCTTGTAGCCAGAGTT	24	18	yes
GATCCCTTGGGCAAGTATCA	4	5	yes
GATCCCTTGCTTGCCTCTTG	26	21	yes
GATCCCTTGCTTCAACCTCC	77	25	yes
GATCCCTTGCCTCCTGAGTT	29	11	yes
GATCCCTTGCATTTGCAACA	2	3	yes
GATCCCTTGCAGTTCTGTGC	87	22	yes
GATCCCTTGCACACAGCCCA	312	212	yes
GATCCCTTCTGCTCTACCTC	3	3	yes
GATCCCTTCCTTTGAAGTGA	153	74	yes
GATCCCTTCCTGCCCTCTTT	140	41	yes
GATCCCTTCCCCAGCGGTTC	21	0	yes
GATCCCTTCCAGCTGAGCCC	67	5	yes
GATCCCTTCCAAATCTGCTC	44	9	yes
GATCCCTTCATTGGGGACCC	111	31	yes
GATCCCTTAAGTAGGGAGTA	25	18	yes
GATCCCTGTTCCAAGATGTA	20	4	yes
GATCCCTGTGTTCTACATGG	167	13	yes
GATCCCTGTGAGTTCAAGGC	105	75	yes
GATCCCTGTCTAGTCCCTGT	69	1	yes
GATCCCTGTCCTTTCTGTTT	50	5	yes
GATCTTGCTGCTGTAGGAAG	7	6	yes
GATCATGGGTTGGGAGCTCA	9	12	yes
GATCCCTGGTTGCATCTTCG	10	8	yes
GATCCCTGGTGGCTGCCCTT	96	72	yes
GATCCCTGGTGGAAAAGCGG	190	194	yes
GATCCCTGGGTGCCAGTTTT	44	12	yes
GATCCCTGGGGGCTGTGATG	100	7	yes
GATCCCTGGGGCTGCCTGTC	37	26	yes
GATCCCTGGGGCATGTTGTA	6	7	yes
GATCCCTGGGGAGCCTGCGG	5	4	yes
GATCCCTGGGAGGATATGAG	46	5	yes
GATCCCTGGGAACGAAGCTG	3	4	yes
GATCCCTGGCTCAGTGAACA	180	3	yes
GATCCCTGGCGTCCCTATCA	103	20	yes
GATCCCTGGCCCCTGTGCCA	11	14	yes
GATCCCTGGCACTGCTGCCT	7	8	yes
GATCCCTGGCACCCAGCATC	34	37	yes
GATCCCTGGAGTGACCAGAG	1093	82	yes
GATCCCTGGAGGCTGGAGAG	108	20	yes
GATCCCTGGAAGCTGTGATG	20	20	yes
GATCCCTGCTTTTGTGGCCT	349	59	yes
GATCCCTGCTTGCCCCGCAC	128	54	yes
GATCCCTGCTTCCTGCCCAG	109	16	yes
GATCCCTGCTGTGGGCCTTC	1245	167	yes
GATCCCTGCTCTTAGGTGCT	79	18	yes
GATCCCTGCTCTGGACCCTC	253	180	yes
GATCCCTGCTCCCCTCTGGG	141	21	yes
GATCCCTGCTCCAGGTCCTC	94	8	yes
GATCCCTGCTAATGGAAGAA	49	10	yes
GATCCCTGCTAAAACCATGT	5	8	yes
GATCCCTGCCTGTGGGGGGT	93	21	yes
GATCCCTGCCTGTCCTGAAA	48	6	yes
GATCCCTGCCTCGTCTGCCT	34	4	yes
GATCCCTGCCGAGGTGCTCA	171	30	yes
GATCCCAGGGACTCTGTTTT	3	4	yes
GATCATGGCTTTGAGGCCAG	41	4	yes
GATCCCAGATTGCCAGCGTC	27	7	yes
GATCCCAGAGTGCTTGATGC	8	10	yes
GATCCCTGCCCTTTGGCCTG	20	17	yes
GATCCCTGCCCATGCTGTTC	113	3	yes
GATCCCTGCCACCTCATTGG	5	8	yes
GATCCCTGCATTTCCTCAAG	81	7	yes
GATCCCTGCAGTACCATCTG	236	21	yes
GATCCCTGCAGCGCTGTTTG	296	24	yes
GATCCCTGCAGAGGCTTCCA	101	16	yes
GATCCCTGCAGAAGGGGGGT	14	5	yes
GATCCCTGCACAAGGTGTTT	121	30	yes
GATCCCTGCAACAGCAAGGG	9	11	yes
GATCCCTGAGTAAACTTCTT	9	10	yes
GATCCCTGAGGTCTCCTGCC	3	2	yes
GATCCCTGACATAGCAGGAC	11	3	yes
GATCCCTGAATAGAAATTGG	3	4	yes
GATCCCTCTTACCTGCAACG	90	16	yes
GATCCCTCTGGTGACTCCAC	41	6	yes
GATCCCTCTGGGTCATGTCT	113	18	yes
GATCCCTCTGAACCGCCGAG	23	15	yes
GATCCCTCTCTCTGGGGAAT	5	6	yes
GATCCCTCTAAGCCCCCTCC	14	14	yes
GATCATGCCATCGCAACTCA	1	1	yes
GATCCCACTTCTGCGTCTTA	8	5	yes
GATCCCACCTGTAACTGAGG	22	5	yes
GATCCCTCGGTGACCACATT	154	42	yes
GATCCCTCCTTGTGAGCAGC	95	12	yes
GATCCCTCCTGGGCATTGCT	36	26	yes
GATCCCTCCTCAGGCATCTG	781	127	yes
GATCCCTCCCTCCGAGGCCA	151	17	yes
GATCCCTCCCCTCCCTGGCT	61	4	yes
GATCCCTCCCCACCCTGCTC	8	10	yes
GATCCCTCCCAGAAACCTGC	1146	282	yes
GATCCCTCCCACTCTGGCTC	582	117	yes
GATCCCTCCAGACACCAAGG	74	10	yes
GATCCCTCCACAAGATTCTG	43	11	yes
GATCCCTCAGGAACAGAGGG	158	27	yes
GATCCCTCACCTCCTTCATC	64	20	yes
GATCCCTATGCTGACCCCAA	1117	442	yes
GATCCCTAGGGAGAAGGTGG	8	10	yes
GATCCCTAGCCCCATCCCAA	2	2	yes
GATCCCTAGCATTCTGTACT	310	34	yes
GATCCCTAGAGCCAGCACAT	28	21	yes
GATCCCTACTGCACCACCTT	20	14	yes
GATCCCTACTCGTTTCAACA	11	4	yes
GATCCCTACTATTGATTCTG	60	8	yes
GATCCCTACTACGTGCTGGA	384	182	yes
GATCCCTACCTACAACCCTA	69	27	yes
GATCCCTACCCCACATGCTG	230	114	yes
GATCCCTACCCATGGGAATG	56	9	yes
GATCTTCGGTGCCACCGGCA	83	28	yes
GATCATGACAGTCCCCCCAC	56	40	yes
GATCCCTACCCATACAAAAA	6	4	yes
GATCCCTACCACCTGCCCGA	3	2	yes
GATCCCTACAACCAGAGATT	1768	95	yes
GATCCCTAATGAGAGCAGAG	7	5	yes
GATCCCTAAGATGACAGTAA	10	7	yes
GATCCCTAAACTACCTCTTG	55	11	yes
GATCCCTAAAAGCTCCAAGA	1011	83	yes
GATCCCGTGTGACACATTTT	3	2	yes
GATCCCGTGGCTTGTGGAAG	29	21	yes
GATCCCGTGGCTTGTCCTCT	10	8	yes
GATCCCGTGGACTGTTTGCT	50	6	yes
GATCCCGTCCAAGGAGCATC	229	10	yes
GATCCCGCGAGGCCCGGAAG	726	277	yes
GATCCCGCCTGCCCAGCTGA	275	22	yes
GATCCCGCCGTTCCACCCTC	3	3	yes
GATCCCGCCCACCCAAAGCT	737	750	yes
GATCCCGCCAAAAGAATTAC	20	19	yes
GATCCCGCACATCCACAAGT	89	30	yes
GATCCCGAGATTGCCAGCCT	509	43	yes
GATCCCGAGAGCTTGCTGGC	5	5	yes
GATCCACAAACTTCCTGACA	32	6	yes
GATCCCGACACCAAGGAGAT	1781	119	yes
GATCCCGAAAACCAGAACTT	14	15	yes
GATCCCCTTTTTGAACAGGT	167	24	yes
GATCCCCTTTACCTTCTGGG	254	26	yes
GATCCCCTTGGTTGCTGGAT	50	24	yes
GATCCCCTTCTCAGGGTCTA	98	5	yes
GATCCCCTTCCTACCTCTAG	73	30	yes
GATCCCCTTACCCTTGGTCC	1	2	yes
GATCCCCTGTTGACTTACAA	10	8	yes
GATCCCCTGTATATGTTGAA	7	4	yes
GATCCCCTGGGTTGAGAGAT	28	8	yes
GATCCCCTGGGGCAAGCTGC	108	77	yes
GATCCCCTGGGAGGAGACAG	655	58	yes
GATCCCCTGGATACATGGTC	79	7	yes
GATCCCCTGCTACACTGATG	42	12	yes
GATCCCCTGCTAATGAAAAT	19	7	yes
GATCCCCTGCCTCCACCTCC	29	20	yes
GATCCCCTGCCCCCCAACCA	72	8	yes
GATCCCCTGCAACAGACATT	11	1	yes
GATCCCCTGAGATGGAATTA	3	4	yes
GATCCCCTCTTCCCAAATAA	15	5	yes
GATCCCCTCTGTGGGTATGA	14	10	yes
GATCCCCTCTGGGCCTCCGA	39	18	yes
GATCCCCTCTCCTGCCCACA	110	24	yes
GATCCCCTCGGACCCCCTTG	1360	277	yes
GATCCCCTCCTCCAGGCAGT	102	1	yes
GATCCCCTCCCTTGCTTTCT	31	6	yes
GATCCCCTCCCTCTGATTTT	203	22	yes
GATCCCCTCCCAGGCTGTCC	1	1	yes
GATCCCCTCCCACAGAATAG	2289	91	yes
GATCCCCTCACATGTGCTAT	219	33	yes
GATCCCCTATGGGGAGGAGG	30	21	yes
GATCCCCTATGCAAGCTGTG	53	54	yes
GATCCCCGTTGTACCTGGTG	25	8	yes
GATCCCCGTGTGTTTGCAGG	82	7	yes
GATCCCCGTGGTCTCATGAA	31	5	yes
GATCCCCGTGCCCCTGCCTA	74	53	yes
GATCCCCGTCTGTGTCTGTG	23	24	yes
GATCCCCGGTGCTCTTCGTG	20	6	yes
GATCCCCGCAGAATCAGGAA	16	4	yes
GATCCCCGCAAAGTGAGCGA	36	24	yes
GATCCCCCTTTGCTGCCTCC	3	3	yes
GATCCCCCTGATGGAGAGAA	22	4	yes
GATCCCCCTCCCTGCTCTCA	9	9	yes
GATCCCCCTCCCCCCAGTGG	528	291	yes
GATCCCCCCACCCCACCACC	476	45	yes
GATCCCCCCAACTGTGTGCC	30	26	yes
GATCCCCCAGGTCTCAGAGG	92	37	yes
GATCCCCCACCTCCTCGGCC	13	13	yes
GATCCCCCACATCCTGGGGC	110	30	yes
GATCCCCATTTGCAGTAAGA	90	10	yes
GATCCCCATGTTGAGCTCTG	58	12	yes
GATCCCCATCTGCAGTACAA	18	9	yes
GATCCCCAGTTGTGTCAATG	29	1	yes
GATCCCCAGTCTTTAGTCCC	242	10	yes
GATCCCCAGTATGCAGTAAT	49	22	yes
GATCCCCAGGTCCCCTTCAA	1	1	yes
GATCCCCAGGGGCTCCCGGT	24	17	yes
GATCCCCAGGGAGGGAATGT	35	9	yes
GATCCCCAGGAGATGAGGTC	10	2	yes
GATCCCCAGCCTTGGATAGT	24	1	yes
GATCCCCAGCCCAATCTTTC	38	28	yes
GATCCCCAGCATTAGGCCAT	32	2	yes
GATCCCCAGCACCACAAAAA	15	11	yes
GATCCCCAGCACAGGAAGGC	69	18	yes
GATCCCCAGAGTCCCCTGTG	2190	136	yes
GATCCCCAGAGCCTTGGGGA	80	15	yes
GATCCCCAGAATCCCCAATA	2	2	yes
GATCCCCACTGTGCCTTTTT	61	15	yes
GATCCCCACCAGCCACCCCC	295	159	yes
GATCCCCACAGCTGCGTATG	167	23	yes
GATCCCCAAGGGCTGGAATG	309	64	yes
GATCCCCAAGGCCCCACCAT	1158	133	yes
GATCCCCAACCCCCCAAAAA	6	9	yes
GATCCCCAACAATGTGAAGA	703	92	yes
GATCCCCAAAGCCTGGAGCC	326	24	yes
GATCCCATTTTTGACAGCAA	116	9	yes
GATCCCATTGGAGCTCTGTT	24	13	yes
GATCCCATTACAGATAGCTA	4	5	yes
GATCCCATGTTGACCCGTCA	17	3	yes
GATCCCATGTTCAAGCTGGT	58	13	yes
GATCCCATGTGTCTTTTTGC	38	10	yes
GATCCCATGTGCCACCATCA	28	8	yes
GATCCCATGTCCTGCTAAAA	11	13	yes
GATCCCATGTCCTCTTCTGG	6	5	yes
GATCCCATGCTTTGAAAAAT	88	11	yes
GATCCCATGCTAGCCTCTTG	182	11	yes
GATCCCATGCCTGGAATTTG	13	9	yes
GATCCCATGCAGAGCGGCCT	120	10	yes
GATCCCATGATGGAAATATT	2	3	yes
GATCCCATGAATCATTTGCC	440	21	yes
GATCCCATGAAATCCCCAAA	34	6	yes
GATCCCATCTTCAGAGCTTA	12	8	yes
GATCCCATCTCCTGGAAGGA	162	11	yes
GATCCCATCCTGGGCGTTAC	4	5	yes
GATCCCATCAGCGCATACTC	60	5	yes
GATCCCATATCCCTGTGAAA	201	18	yes
GATCCCATACCTGACATGAC	21	5	yes
GATCCCATACCCCACCAAAA	40	66	yes
GATCCCATACAATGCCGCCC	43	18	yes
GATCCCAGTTTGCTTCATGA	31	7	yes
GATCCAAACTTCTACAGCAA	41	7	yes
GATCCAGGTGTGAGATGATG	1	1	yes
GATCCCAGTTCATAATGAAC	6	5	yes
GATCCCAGTGTTGCTACGTG	263	39	yes
GATCCCAGTGTGAATCATGG	44	7	yes
GATCCCAGTGGTATTCCGCC	39	4	yes
GATCCCAGTGGATGAAGTGT	49	12	yes
GATCCCAGTGCTGTGGAAGT	18	6	yes
GATCCCAGTGCTGGTCAGTT	175	10	yes
GATCCCAGTCCTCCTGGGCA	41	29	yes
GATCCCAGTACTTGGGAGGC	42	53	yes
GATCCCAGGTGGAGCAACCC	307	41	yes
GATCCCAGGTCCCTCTGGGA	601	17	yes
GATCCCAGGGGTCCTAGGGG	36	6	yes
GATCCCAGGGGCTCTTCTGC	361	141	yes
GATCCCAGGGAAAGTGCTAT	538	56	yes
GATCCCAGGCTAGCAAGCAA	91	9	yes
GATCCCAGGCTACCCTCCAG	201	10	yes
GATCCCAGGCGTCAAGCTCG	6	7	yes
GATCCCAGGCAAGGGATGGT	7	7	yes
GATCCCAGGAGTCAAGCTCT	378	41	yes
GATCCCAGGAGAGAGGCTTC	69	15	yes
GATCCCAGGAAGGACCATCA	15	25	yes
GATCCCAGGAAAGTTCTAAT	14	2	yes
GATCCCAGCTATGATGTAGC	17	15	yes
GATCCCAGCGCTTAGCCACC	11	8	yes
GATCCCAGCATTTGGGAGGC	57	41	yes
GATCCTACTATGAGCAAAAA	5	8	yes
GATCGGCGTTCATACTTCTG	4	5	yes
GATCTCTGTCTTTCCCTGGT	172	21	yes
GATCTCTGTCATTGTTTACA	2	3	yes
GATCTCTGTCATCCCCCACG	29	2	yes
GATCTCTGGGCAGTCATGGT	5	7	yes
GATCTCTGGCTCTTCATCCT	3	4	yes
GATCTCTGGCCTGTGGAGTA	38	27	yes
GATCTCTGGCCAGGCAAGTT	2	3	yes
GATCTCTGCTGTGGGAAAGG	4282	467	yes
GATCTCTGCTGTCGGTTTCT	13	7	yes
GATCCAGCAGACCTCACTCA	1	1	yes
GATCTCTGCCCCAAATCCAA	1	1	yes
GATCTCTGCCCAAACCAGGC	266	20	yes
GATCTCTGCCACCCACCCAC	27	27	yes
GATCCGAGTGTCCCCTCTGC	23	0	yes
GATCTCTGCAAGCAGTTGTC	17	17	yes
GATCTCTCTTCCCAGAGGAA	275	62	yes
GATCTCTCTGGTAACACAGC	90	91	yes
GATCTCTCTCCTTGGCCTTC	157	50	yes
GATCTCTCTCAGTGTGTCTG	5	5	yes
GATCTCTCGTGTGCCTTTGG	85	83	yes
GATCTCTCCCCAGAGCAACG	176	76	yes
GATCTCTCCATATCAAGCGA	1735	19	yes
GATCTCTCAGTTGAATACAT	29	28	yes
GATCTCTCAGGCCAGGATTT	14	14	yes
GATCAAGATAACGGTGGCTT	1	1	yes
GATCTCTACTTTGGAGTCCT	26	21	yes
GATCTCTACTGCTGTTAGGT	20	15	yes
GATCTCGTTTTTCAAAAGCA	3	5	yes
GATCTCGTTCATTGGCAAAA	22	22	yes
GATCTCGTGCAACTGTTGTC	149	13	yes
GATCTCGCCGTGTCCCTGGG	1041	128	yes
GATCTCCTTTCTGTAATTCA	18	13	yes
GATCTCCTTTCCGGAAGCAA	435	70	yes
GATCTCCTGTCTGAGGTGTC	1	2	yes
GATCTCCTGTCTATGTGGGC	73	14	yes
GATCCCTTCAGACACACCAG	5	6	yes
GATCTCCTCCTTGCTTTCCT	10	7	yes
GATCTCCTCCTTATTCCCCA	196	36	yes
GATCTCCTCAGAGAAGTCTG	131	94	yes
GATCTCCTCAGAAGAAATCA	7	9	yes
GATCTCCTCACATACAGCAT	6	9	yes
GATCTCCTCAACCAGTGTGT	3	2	yes
GATCTCCGTCCCTCAGCTCC	236	58	yes
GATCTCCGCGGCCCGAGTGC	2	2	yes
GATCGCAGAGAGGCGAGAGC	53	53	yes
GATCGCAACACCTGCAAGCT	431	68	yes
GATCTCCGCACTGTGTGTAC	2642	365	yes
GATCTCCCTTTCCTGTAGAG	12	11	yes
GATCTCCCTGTTCTGGACTC	222	121	yes
GATCTCCCTGAGTTCGAGGC	16	15	yes
GATCTCCCTAACCTGCACCC	287	26	yes
GATCTCCCCTTTGTAGGACT	4	5	yes
GATCTCCATTCTGGAGCTGA	2	2	yes
GATCTTATTGCCAAGTTCCT	4	4	yes
GATCGCAGCACTGAAAACAA	10	8	yes
GATCTCCATCTTCCAAATAC	13	5	yes
GATCTCCATCGTGCAGGGAT	82	14	yes
GATCTCCAGTCCAAGGCTTC	28	2	yes
GATCTCCAGCTTCTCTGCCT	315	8	yes
GATCTCCAGCACAGCAGAGG	45	21	yes
GATCTCCAGAGTCGCTTGGA	71	14	yes
GATCTCCACTTTCTACAACA	126	22	yes
GATCTCCACTTCAAGCCTTT	2	2	yes
GATCTCCACTCTCCCTCTGG	18	14	yes
GATCTCCACATCTCCAAGGA	3	4	yes
GATCTCCACAGCGTGTTCAT	64	25	yes
GATCTCCACACAACAGGTGA	442	60	yes
GATCTCATTTTAACATCCAC	34	33	yes
GATCACAGCCCAGTCAATTA	14	11	yes
GATCACAGCCAGTTCAAAGC	423	142	yes
GATCACAGCCACCTCTTTAC	3	5	yes
GATCACAGCAGTAAATGTGA	195	22	yes
GATCACAGCAGCTGAGCTGT	76	8	yes
GATCACAGATTTAAGGGGAG	6	4	yes
GATCACAGAGTGGTTACTGG	69	31	yes
GATCACAGAGAACACAGAGG	99	24	yes
GATCACAGACTTCGGCCTTG	2	2	yes
GATCACAGACACCTGCACTG	21	21	yes
GATCACAGAAGTGAGCGGAT	42	4	yes
GATCACAGAACATTCCAGAT	1388	194	yes
GATCCTTCTGACTTGGCTTT	20	7	yes
GATCCTTCTCAGAAGAGTCT	20	20	yes
GATCACACTTCCCACAACCC	15	11	yes
GATCACAGCAGAGATGGCCA	113	17	yes
GATCTCATTGTTCTTGGAGA	104	11	yes
GATCTCATTCTTTCATGGAT	7	6	yes
GATCTCATTCCGGATGAAGC	25	24	yes
GATCTCATGTTCCTTTACAC	12	12	yes
GATCTCATGTGTGGGAACCA	22	4	yes
GATCTCATGTGTACCAGCCA	10	13	yes
GATCTCATGTCTCTGGAGGA	134	17	yes
GATCTCATCCTCTCACCTCC	343	32	yes
GATCTCATCCATTGAATTTG	17	11	yes
GATCTCATCCAGTCTGCTGT	18	18	yes
GATCTCAGTTTTCATCAAGT	20	4	yes
GATCTCAGTTTGAGTGGATG	35	2	yes
GATCTCAGTTCTGTGTTTAC	20	25	yes
GATCACACTGATGGAGCTGT	22	22	yes
GATCACACCTGTCCCTACAC	84	30	yes
GATCACACCGTTTCTTCCTA	9	9	yes
GATCACACCGAGATTCTTTT	1	1	yes
GATCACACCGAGACCAGTGG	14	11	yes
GATCACACCCCTGGTCACCA	35	33	yes
GATCACACCAGTCCTGTGAG	62	13	yes
GATCACACATTTGCAAGGGA	49	19	yes
GATCACACACTCAGTCCTTG	73	6	yes
GATCACACACGGCAACCGAC	55	4	yes
GATCACACACACAGTTGTAG	6	8	yes
GATCACACAAGTGTGGGTTT	50	7	yes
GATCACACAAAACTGTCAGC	12	12	yes
GATCACAAGTTTGAGACCAG	3	4	yes
GATCACAAGTTGTTTCCTGT	1	1	yes
GATCACAAGTTAAGGTCAGC	1	1	yes
GATCACAAGGTTTACATCTG	18	14	yes
GATCACAAGGGGGTAATCAA	202	89	yes
GATCACAAGGCTGAAAACAA	4	6	yes
GATCACAAGCTTGGGGCAAC	34	10	yes
GATCTGTTGTTTGCGTTGAA	10	8	yes
GATCCTTCTGTCGGCTTCCT	2	2	yes
GATCTGTTACTTTGGCGAGG	425	84	yes
GATCTGTGTTGCAGACTCCT	1	1	yes
GATCCTTCCTTCTTCTCTTC	6	7	yes
GATCTCAGCTTGCATAGCAT	108	5	yes
GATCTCAGCTCCACTGTGAA	12	16	yes
GATCTCAGCACTGTGGCTGT	564	110	yes
GATCTCACTGTTTGCTAACA	2	2	yes
GATCTCACTGTTTCATGCTG	16	15	yes
GATCTCACTGCCTCCCTCTC	143	21	yes
GATCTCACTCAGCAACAAGT	60	2	yes
GATCACAAGAAAGACGTGGT	1476	231	yes
GATCACAACTTTTGATTTTT	1	1	yes
GATCACAACTGTAGGGAATA	211	41	yes
GATCACAACGGCTTGCGTGT	86	22	yes
GATCACAACCCTGATGGCAG	816	106	yes
GATCACAACCCCCAAGTCAG	34	9	yes
GATCACAAATACAGATTCTG	46	45	yes
GATCACAAAGTTTGAGAATG	808	104	yes
GATCACAAAGGTGGAATGTT	2	3	yes
GATCACAAAATGAGTCACTC	18	18	yes
GATCTGTGTATACCCCACTC	17	17	yes
GATCCCCATTGGCTTCTGTA	6	5	yes
GATCCTTACATCAACCTGGC	16	16	yes
GATCCTGTGGCTAATCCTGT	13	9	yes
GATCTGTGCCATCCCATACA	62	42	yes
GATCTCACCTTCAAGGTTCT	168	38	yes
GATCTCAACTGACTCCTCTT	101	28	yes
GATCTCAACCTGGTGTTCAC	3	3	yes
GATCTCAAACTCAGAGGTTT	38	37	yes
GATCTATTTTCCTAACCGTT	7	6	yes
GATCAATGATGAGGACAAAC	470	271	yes
GATCAATCTTCTGGTTCATC	26	26	yes
GATCCTGGGTACTGCACAGT	472	277	yes
GATCAATCGCCTTGCCTTGT	1986	667	yes
GATCAATCATCTGCCTGGAA	307	108	yes
GATCTGTCTCAACAGTCTGG	17	17	yes
GATCAAGTTTTGGCTCTTGG	3	3	yes
GATCAAGTTTGTGGTGTGTT	82	5	yes
GATCAAGTTTCACATCCTTC	53	8	yes
GATCCTGCATACCAACGGCC	815	232	yes
GATCCTGCACAAATATTTCT	381	85	yes
GATCTGTCCTGATGAAGGCT	87	86	yes
GATCCTGCAAACTTCCCTGG	12	12	yes
GATCTGTCCATCTTGGAGTT	17	1	yes
GATCCAGGTTGTGAAACATC	15	10	yes
GATCTGTCAGCTGTGCTCTC	8	8	yes
GATCCTGCAGACACTCAGAG	1	2	yes
GATCAAGTTGGGAATGAGGG	203	23	yes
GATCAAGTTATGTGTGGTTT	14	14	yes
GATCAAGTGTCGGATGGAAT	2213	305	yes
GATCAAGTGTAAATGTGCTG	5	5	yes
GATCAAGTGGATTCGGCGGT	103	23	yes
GATCAAGTCGTGCTTCTGGC	1713	212	yes
GATCAAGTCCTTTGTGAAAG	380	90	yes
GATCAAGTCCGAGGTCCCCC	27	27	yes
GATCCTGAGGAAGGCCAGGC	1106	507	yes
GATCAAGTACTACTGTTGGC	27	27	yes
GATCAAGGTGTTGCCTGGTG	10	10	yes
GATCAAGGTCCTAAAATTTC	87	6	yes
GATCTGTACCTGCGGCTCCA	3	3	yes
GATCTGGTCACTGGTCAGAG	10	8	yes
GATCAAGGCTTTCCTCGGGC	10	2	yes
GATCAAGGCTCTGGAGATAA	354	259	yes
GATCAAGGCTCCCGGTTTTG	631	20	yes
GATCAAGGCCTTTCTGTCCT	7091	1439	yes
GATCAAGGCCTTTCTGCCCT	369	356	yes
GATCAAGGCAAAAGGAGGAT	17	1	yes
GATCAAGGAGGCTGTTGCTG	43	42	yes
GATCAAGCTTTCTCCCCGCA	126	47	yes
GATCCTCTGGCAGATGTTTG	79	15	yes
GATCAAGCGGGCTTTCCTTA	108	41	yes
GATCCTGAACTCCCCAGAGA	1	1	yes
GATCTGGGCTGAGCTTGGTT	2	3	yes
GATCTGGGCACCGAGGCTGG	147	106	yes
GATCTGGGCACCCACTGCCT	7	5	yes
GATCCTCTGCCTCAGTGAAC	1	1	yes
GATCAAGCCCTTCTTCCATT	788	28	yes
GATCAAGCCATCCATCAACT	238	13	yes
GATCAAGCATCATGATGCTC	20	19	yes
GATCAAGCAGCGAGAGGCTG	767	159	yes
GATCAAGCAGAACCTGGAGA	99	35	yes
GATCCTCCTCACTTAGCACC	93	11	yes
GATCAAGACTGTGACTTTTG	572	379	yes
GATCAAGACTCTCCTGGAGA	49	6	yes
GATCAAGACGCCTGTCATTT	10	10	yes
GATCAAGAACTTCCATTACT	29	19	yes
GATCCTCAGGACGAGTCACA	2	2	yes
GATCCTCACTGGCAGCAGCT	97	70	yes
GATCCTCACCCACCTGCTGG	247	44	yes
GATCTGGCCCTTTTGTCCTT	48	11	yes
GATCAACTGTGCAGACAACA	691	150	yes
GATCAACTGCTACGATGTGT	74	8	yes
GATCAACTCTTGGCTTTGAC	20	19	yes
GATCTGGCCAACACAAGAAC	1	1	yes
GATCAACCTCAGCAAGATGA	130	50	yes
GATCAACCGACAGCTGGAGG	58	51	yes
GATCAACCACTGCAAATTCG	36812	5535	yes
GATCAACCACTGACCTGCCT	30	29	yes
GATCAACATGGAGGAGACTT	59	58	yes
GATCAACACGAATCGTTTTT	25	24	yes
GATCCACGCGGTAAGAGAGA	5	7	yes
GATCAGCTCCAACTATGGTG	10	10	yes
GATCGGCTCTTCCCACCTAC	12	6	yes
GATCAGTCCTTCCCTCGAGA	80	3	yes
GATCAGTTTCAAGAAGCGTG	5	5	yes
GATCACCGACCGCATCGAAA	10	16	yes
GATCCCAGCATCGGCAAGCG	130	8	yes
GATCCCAGCAGCTGTTACCT	55	18	yes
GATCCCAGCACTGCAAAAGA	75	25	yes
GATCCGCCTGCTTCTGCCTT	3	2	yes
GATCCCAGCACACACCGTGA	47	11	yes
GATCCCAGAGGAAAGGGTTT	76	5	yes
GATCCCAGAGACAATCTCAT	110	9	yes
GATCCCAGACGCCTCAAATG	67	11	yes
GATCCCAGACCAGAAAATCC	10	7	yes
GATCCCAGAATGAACAGAAC	292	37	yes
GATCCCAGAAGCCGCACAGG	21	6	yes
GATCCCAGAACCATTGCCTG	33	23	yes
GATCCCACTGTTGATAAGGA	5	3	yes
GATCCCACTGCTCATTTGAC	5	5	yes
GATCCCACGGTAGAACCTGA	138	18	yes
GATCCCACGAGCCAGAGAAC	49	14	yes
GATCCAGGAAATGCTGGAGA	8	10	yes
GATCCCACCTTCACCTCCCT	4	3	yes
GATCCCACCTCACGTGTGAT	1	1	yes
GATCCCACCGGTCCAGTGGA	10	7	yes
GATCCCACCGCAGCTACCAG	102	12	yes
GATCCCACCCCAGTAGGAAG	939	133	yes
GATCCCACCATTCTCCTTGG	80	52	yes
GATCCCACCAACCTACACTA	1372	407	yes
GATCCCACATTTCCCTTGCC	4	4	yes
GATCCCACATGCACATAAGA	6790	4358	yes
GATCCCACAGTGTGACTGAT	34	16	yes
GATCCCACAGGCCGGTGGAG	25	2	yes
GATCCCACAGCCAGGCTCAC	198	58	yes
GATCCCACAGATGTAGTTTG	32	21	yes
GATCCCACACTTAAGACTTC	140	15	yes
GATCCCACACATACATGACC	1071	879	yes
GATCCCACACATAAATGCCC	232	301	yes
GATCCCACACATAAATGACC	26721	18447	yes
GATCCCACACATAAATGAAC	13229	13392	yes
GATCAGGTGGATGTGCAGGA	9	11	yes
GATCAGGTCCTAAACATGGC	73	12	yes
GATCCCAATTACAACCCACT	119	85	yes
GATCCCAATGGTCACACACC	9	12	yes
GATCCCAATGCTGCCCCATC	18	15	yes
GATCCCAATGCTCAGAAGGA	38	10	yes
GATCCCAATGAGCCCACCTA	31	21	yes
GATCCCAAGTTCAAAGCCAG	25	5	yes
GATCCCAAGTTAAATATACT	3	4	yes
GATCCCAAGTGTACTTCTCG	2	1	yes
GATCCCAAGTGCTGGGAAAG	173	17	yes
GATCCCAAGTCCAACACCCA	13	4	yes
GATCCCAAGCCTCACCGGCT	138	26	yes
GATCCCAAGCCAAGAAACAC	137	18	yes
GATCCCAAGAGGAAGGGTAT	8	5	yes
GATCCCAAGAAAGGATGGAA	6	4	yes
GATCCCAAGAAACTACTTGA	18	19	yes
GATCCCAACTGTGTCACTAT	30	7	yes
GATCCCAACTGTCAGTGCCA	496	56	yes
GATCCCAACTGTAACAGCAA	28	12	yes
GATCCCAACTCTGCAAGAGC	2	2	yes
GATCCCAACGTGACCATCAT	115	9	yes
GATCCCAACATTTGAGAGGC	5	6	yes
GATCCCAACATTGTTGGCAA	10	3	yes
GATCCCAACACCCATATCCA	2	2	yes
GATCCCAACACAGCGATATG	249	17	yes
GATCCCAAATCTGTGGTGTG	172	31	yes
GATCCCAAATACTCAGTGCT	9	9	yes
GATCCCAAAGGCTCCAGGGT	13	13	yes
GATCCCAAAGCACAATGGTG	10	15	yes
GATCAGGGCTCCAGTGGTCC	39	35	yes
GATCCCAAACTGTATCCTTG	45	14	yes
GATCCCAAACTGCTTTCTCA	3	5	yes
GATCCCAAACTGAGGCAGCA	17	13	yes
GATCCCAAACAACTAAGAAT	223	46	yes
GATCCCAAAATGCTGCGGAG	101	7	yes
GATCCCAAAAACCGTGCAGC	18	8	yes
GATCCATTTTTCTGTGACAT	29	8	yes
GATCCATTTGCTTACACTGT	45	20	yes
GATCCATTTGATGCTTCCAG	10	13	yes
GATCCATTTCTTCTGCATGA	23	18	yes
GATCCATTTCTTCATCCCCT	93	24	yes
GATCCATTGTTCCTCTGTTT	1	1	yes
GATCCATTGGTTTCTCAGTC	3249	756	yes
GATCCATTAGTGTTTGCTGG	16	16	yes
GATCCATCTTTTTCTTTGGA	12	6	yes
GATCCATCTTCAGCTGACTG	8	12	yes
GATCCATCTGCTGTGGAACA	61	6	yes
GATCCATCTCTTTCCTTCTG	112	6	yes
GATCCATCTCCTCTGGCTCT	26	19	yes
GATCCATCTCCAGCACATGC	8	7	yes
GATCTGGTCCCCTGTTCTCC	4	3	yes
GATCCAGAATGTCAGCTGGA	10	7	yes
GATCATTCAGTTTCCCAGCC	16	5	yes
GATCAGGCCCTAAAGCATTG	17	17	yes
GATCCATCGACTGTGATAGG	39	4	yes
GATCCATCCTATCCATCCGT	71	9	yes
GATCCATCCCCGGCAAAGAG	38	10	yes
GATCCATCCCAGAGGGACTG	1041	156	yes
GATCCATCCAGCAAAGAGGA	11	9	yes
GATCCATCCACCAGCAGGAG	442	77	yes
GATCCATCCAATGGCTTACC	92	45	yes
GATCCATCACAGGACTATGT	7	6	yes
GATCCATCACAAGGCAAAAC	378	51	yes
GATCCATAGCACAAAGCCAC	3	4	yes
GATCCACTCACAGCACCTCC	18	13	yes
GATCCATACTCCCCAGTATG	313	65	yes
GATCCATACCCACCACTGTG	30	2	yes
GATCCATACAGCATTTTGCG	32	21	yes
GATCCATACAATTTGTGCCA	250	54	yes
GATCCATAAGTTTGCCCAGT	16	11	yes
GATCCAGTTTTGGGAAAGGA	32	21	yes
GATCCAGTTTCTGACTCGGG	28	21	yes
GATCCAGTTGCTCTAAGTTT	94	8	yes
GATCCAGTTCTTGGCTCAAT	139	25	yes
GATCCAGTTCTGCTCAACTA	95	8	yes
GATCCAGTTCTACGAGCGGC	18	16	yes
GATCCAGTTCTAAAACTTGT	167	26	yes
GATCCAGTTCCAAGACAACT	450	111	yes
GATCCAGTTCATCAATCAAA	33	26	yes
GATCCAGTTACCAGAAGATG	276	183	yes
GATCCAGTGTGTTGCTGGCA	97	65	yes
GATCCAGTGTGGACCAGCTC	1091	617	yes
GATCCAGTGTGCTGGTCTTT	284	104	yes
GATCCAGTGGCAGCCTCAGC	21	26	yes
GATCCAGTGAGAGCCAGACA	26	4	yes
GATCCAGTCTTTAAAGAAGC	22	17	yes
GATCCAGTCTGTCCTAGATG	9	7	yes
GATCCAGTCCTGGAGGACAG	129	6	yes
GATCCAGTCCTCTCCGTTGG	45	14	yes
GATCCAGTCCATTCAGCAGT	83	12	yes
GATCCAGTCAGGACATATGA	12	16	yes
GATCCAGTATCTGAAAGACC	28	35	yes
GATCCAGTACTTGGTTTGTG	15	8	yes
GATCCAGGTTCAATTTCCAG	24	1	yes
GATCCAGGTGTGCTGAGTGG	49	34	yes
GATCCAGGTCCGTGAACCCC	37	25	yes
GATCCAGGGTGTGCAGTGGG	62	12	yes
GATCCAGGGTGCCCCTCCAA	8026	2321	yes
GATCCAGGGTCCTCTGCCTG	31	32	yes
GATCCAGGGGGGACACCTGC	67	36	yes
GATCCAGGGCTCAGGAGCAC	25	18	yes
GATCCAGGGCGATGTTGGGG	4	4	yes
GATCCAGGGCCTGTGAATCA	25	18	yes
GATCCAGGGCCTGGTGGAGG	235	46	yes
GATCCAGGGCCACTTTGTCT	64	19	yes
GATCAGCGCAGGCCCCAGCC	7	6	yes
GATCAGCCTGTCCTATTCCC	4	4	yes
GATCAGCCTCTTCCTTTTGT	16	2	yes
GATCCAGGCTGCGTATGAAG	53	35	yes
GATCCAGGCTGAGGACATCA	4	4	yes
GATCCAGGCGGCCAAGAACT	35	44	yes
GATCCAGGCCTCTGAACTGG	5	5	yes
GATCCAGGCCTCCCTTCTTG	31	14	yes
GATCCAGGCAGAGCTCTTCA	44	18	yes
GATCCAGGAGTTCAAAGAGG	73	53	yes
GATCCAGGAGCACGTGAAGA	92	73	yes
GATCCAGGAAGTTTTGTTGT	18	8	yes
GATCCAGGAACAGTTTAAGA	1785	943	yes
GATCCAGGAAAGCAGCCTGT	321	126	yes
GATCCAGCTGGGTGAGGGAT	5	5	yes
GATCCAGCTGGGCGAGGATG	22	23	yes
GATCCAGCTCAGGCGGTGTC	23	23	yes
GATCCAGCGAGAAAGAAGAA	49	35	yes
GATCCAGCCTTCCTTAGGCC	367	8	yes
GATCCCGAAATGGAAAATGA	36	6	yes
GATCCCACCTGCTCCTGGAC	1	1	yes
GATCCCCGCAAAGTGAGCAA	12	20	yes
GATCCACAAGTACAATGCGT	16	11	yes
GATCCAGCCTGAGCTCAGTG	37	2	yes
GATCCAGCCTGACCTGCACA	74	18	yes
GATCCAGCCCCTTTGTCACC	46	32	yes
GATCCAGCCATTTGTGGGTG	5	5	yes
GATCCAGCATTTAAATTTCT	87	24	yes
GATCCAGCAGTTAAAGCAGT	93	25	yes
GATCCAGCAGGTGCTGACCT	790	196	yes
GATCCAGCACCGTGTGTACC	59	43	yes
GATCCAGCAAACTTGGTTGG	8	8	yes
GATCCAGATGCCGGCTTTCA	10	17	yes
GATCCAGATGATGGTTCTTT	26	22	yes
GATCCAGAGTGGCACAGGGT	15	10	yes
GATCCAGAGTGGAACTGTCC	2	3	yes
GATCCAGAGCTTCTGCAAGG	20	6	yes
GATCAGCAACTCCTGCTTCA	70	51	yes
GATCCAGAGAGACTTGGTTG	69	23	yes
GATCCAGAGAACTCAGCTGT	8	8	yes
GATCCAGAGAAAGCAAAGGC	15	19	yes
GATCCAGACGAATCTTGTCA	4	3	yes
GATCCAGACCTGCCACAGAC	27	2	yes
GATCCAGACCCGGGAAGGGA	57	11	yes
GATCCAGACACTGGCATCTC	82	5	yes
GATCCAGAATTGCTTTCCCA	49	37	yes
GATCCAGAAGCATATTGCTT	89	72	yes
GATCCAGAAGCAGTGGAATC	1543	268	yes
GATCCAGAACCTCTCAGCCA	5	6	yes
GATCCAGAACAGTACAGCGT	39	26	yes
GATCCACTTGGAACTGGCCA	6	4	yes
GATCCACTTGCTGCCTGAGA	171	7	yes
GATCCTCAGAGTCAAGGACC	16	4	yes
GATCAAGTTTGCCGTCCATG	23	23	yes
GATCTTGCTGTTGTGGATGT	19	5	yes
GATCCTCAACGAGGATGGCA	21	15	yes
GATCCTATGTTGCTGGAGCT	17	12	yes
GATCCTATGGGTGACTGTAC	2	3	yes
GATCCTAGTGGGTCTACCAG	38	38	yes
GATCCTAGTGCTGCTCTGGC	42	16	yes
GATCCTGCACAGCCAAGAGT	5	6	yes
GATCCTAACTAGCAAGGGTT	976	246	yes
GATCTGGACTTGTTTTCTGG	26	17	yes
GATCTGGACTTCTGAATCTG	18	13	yes
GATCAACAAATCTCCTAGGC	13108	5170	yes
GATCAAATGTGCCATAGCAC	33	32	yes
GATCAAATGAGAACACTGCT	59	58	yes
GATCTGCTTGCTTTTCAGTT	18	4	yes
GATCTGCTTCCAGGTCCTCA	51	37	yes
GATCTGCTGTCCAGAGCAAG	118	14	yes
GATCTGCTGCTGGTGCTTGC	51	45	yes
GATCAAATCACTGGCAGACA	64	5	yes
GATCAAATATGTGGAGATTT	340	56	yes
GATCCGGGCAGCCCAGGAAA	6	9	yes
GATCAAAGGCTTCAATCACA	12	17	yes
GATCCGGCCCTACTGTGTGT	6	9	yes
GATCAAAGCTGGCAAGGTAC	291	286	yes
GATCAAAGCCCGGAAAGGCA	501	252	yes
GATCAAAGCCAAGTATCCTG	21	21	yes
GATCAAAGCCAAACCCTTTC	7	6	yes
GATCAAAGCAGCTGCCTTAC	18	18	yes
GATCAAAGCACAAGCCCTGC	14	23	yes
GATCCGCTGTACTCTCCTCC	31	10	yes
GATCCGCGAATGCTCGGAGG	1070	138	yes
GATCCGCAGTGGCATGTTCT	357	6	yes
GATCCGCAGCGCCTCTTCTT	44	45	yes
GATCTGCGGGTTGTCACTAG	9	11	yes
GATCCCTGGGGCTCACTGCT	5	6	yes
GATCAAACTTGGCAGTGGTG	7	6	yes
GATCAAACGAGTTGTGTGTC	44	9	yes
GATCAAACCAGCCTGTTTTT	13	13	yes
GATCAAACACAATTTCAGTT	253	4	yes
GATCCCTTTCACACACCTGC	13	13	yes
GATCAACTCAGATTTGGCTC	9	9	yes
GATCTGCCTGAAACCAGGGG	10	13	yes
GATCTGCCTCAGTCCACAAG	12	12	yes
GATCAAAATCGCAGTTACTG	39	38	yes
GATCACAGTCTTTCAGCTAT	29	28	yes
GATCAAAATACACGCTAAGG	97	15	yes
GATCCCTGGTGGGAAGGCGG	794	808	yes
GATCCCTGGTCCTTAGGTGG	13	13	yes
GATCAAAAACAAAAGCGAAA	107	17	yes
GATCTGCCAGGAACATGAGA	18	12	yes
GATCTGCCAGCCGTACATCC	160	25	yes
GATCCCTGATTGCCTCCATG	321	193	yes
GATCCCTGACTTCATTGGCC	368	41	yes
GATCCCTCTCCCAGCTCTTC	119	23	yes
GATCTGCAGGAGGATGTTGA	18	18	yes
GATCTGCAGGAGGATGCCTG	157	18	yes
GATCCGCTTCCTGCACGACC	3	4	yes
GATCTGCACTCGGTACCCTC	10	0	yes
GATCCCTCAGTGTAGCATAG	18	19	yes
GATCCCTCAGTCTTTATGAG	29	29	yes
GATCCCTCAGTCTGCCGTAG	40	7	yes
GATCCCTCAGCCCACACAGT	68	69	yes
GATCCCGTCAACTTCAAGCT	1830	515	yes
GATCCCGGGGCAGTCCAGCC	52	53	yes
GATCTGATTCTCCGGGGAAC	15	11	yes
GATCTGATTCCCGCAGGTTC	60	12	yes
GATCCCCAGGGTTACTAAGA	5	4	yes
GATCCCGGATTGGTGGCTGT	304	69	yes
GATCCCTTTCCTTTAGCAGT	56	10	yes
GATCCCCTGAGAAGCTGTAT	22	23	yes
GATCCCCGGCGTCTGTTTGA	1899	109	yes
GATCTGAGCCCCCTGAGGTT	12	9	yes
GATCCCTGCTTTCATGGAAG	26	27	yes
GATCCCTATGGACACTGACA	105	12	yes
GATCCAAGATGGAGGAGGAG	3	3	yes
GATCTGCTGCGTTGTTTGCC	2	2	yes
GATCCACTTGAAACCGGGAG	301	53	yes
GATCCACTTCCCCAGACTGT	128	20	yes
GATCCACTTCAGAAGCAGCC	82	60	yes
GATCCACTGTTGTCCAGAGG	72	9	yes
GATCCACTGTGTGTCTGGTA	10	2	yes
GATCCACTGTCTTCCTAGAG	61	17	yes
GATCCACTGGGCCAAGGAGC	62	12	yes
GATCCACTGGCTGGATATAG	61	13	yes
GATCCACTGGAGATACAGGT	27	18	yes
GATCCACTGGAAGCAGCACG	3625	352	yes
GATCCACTGCTGGAAGTACC	204	20	yes
GATCCACTGCCTGTTTCCTA	200	21	yes
GATCCACTGAGAAGGTGACC	1	1	yes
GATCCACTCTTTTCATACCC	15	15	yes
GATCCACTCGGGGGCTGTGA	136	9	yes
GATCCACTCCTGCAGAGCAC	82	8	yes
GATCCACTCCAGGCTGCGAG	72	12	yes
GATCCACTCAGACGAACAGT	12	3	yes
GATCCACTAATGCAGCTGGT	29	9	yes
GATCCACGTCTCGTCGTCAG	3973	113	yes
GATCCACGGACACCAAGTTA	56	14	yes
GATCCACGCAGCCATCTTGG	4	6	yes
GATCAAACAGAAGCGCCAGG	22	22	yes
GATCCACCTGTTTCTATCTC	9	6	yes
GATCCACCTGTGGTGCTAGT	2	3	yes
GATCCAACTGCCTTTGCCTC	59	21	yes
GATCAGAGCTACACAATGGC	13	13	yes
GATCAGAGCCGCCTGACTTC	37	36	yes
GATCTGCCTGCCACTCCTGC	1	1	yes
GATCCACCTCTGCTGAGTCT	465	46	yes
GATCCACCTACTTTTTCAGC	29	2	yes
GATCCACCCTGAAAGTGTCT	15	2	yes
GATCCACCCCTATCTGAGAA	3	3	yes
GATCCACCCCTAAAATCCTG	46	6	yes
GATCCACCCACCCTGGGCAT	20	25	yes
GATCCACCCACCCCTGCCTC	44	17	yes
GATCCACCATCTGTAATGTC	3	4	yes
GATCCACCAGTGCTTCTGCT	63	24	yes
GATCCACCAGTCCTTGAAGC	61	12	yes
GATCCACCAGGATGTTTGAT	28	7	yes
GATCCACCACATGTGCCAAA	738	52	yes
GATCCACCAAGTCCTGGCCC	338	16	yes
GATCCACATTTGCTGGTTTG	22	17	yes
GATCCACATTGCTGTCCTAT	7	8	yes
GATCCACATTCTCCATTCTA	62	11	yes
GATCCACATTACCATCAAGC	42	13	yes
GATCCACATGTACCATCAAC	779	131	yes
GATCCACATGCGTGTAGCAG	463	30	yes
GATCCACATGAGGAGATACT	31	7	yes
GATCTGATGTTCACTACTGT	2	2	yes
GATCCACAGTCCCTATGTGT	15	3	yes
GATCCACAGTCAGCAAATCC	8	7	yes
GATCCACAGGGTACCTCCCT	134	14	yes
GATCCACAGGCAGTTGTGCC	32	24	yes
GATCCACAGGAGGGTTCCAA	13	12	yes
GATCCACAGATTCTGCCTGT	159	25	yes
GATCCACAGAAGCACTGCAG	1	2	yes
GATCCACACTTCTGAAGACT	24	7	yes
GATCCACACTGCCACTAAAA	186	34	yes
GATCCACACGGAAGGGGAAA	8	2	yes
GATCCACACCTGATGGCTCC	3	5	yes
GATCCACACCTGAAATGCTA	30	4	yes
GATCCACACCCTAACTCCCA	38	5	yes
GATCCACACCCGCTCCGCAT	17	12	yes
GATCCACACACGACTCTCCA	71	12	yes
GATCCACATCTTCAAATGCC	5	6	yes
GATCCACAAGTCTTAGCTGT	44	7	yes
GATCCACAAGGCCCTCATCA	1037	205	yes
GATCCACAAGCGACTCATTG	789	115	yes
GATCCACAACCTGATTCCCG	1423	131	yes
GATCCCACCTGGCCTCGCCC	16	16	yes
GATCCACAAAGTTAATGAGG	8	11	yes
GATCCACAAAGGCAGAGCCC	50	14	yes
GATCTGCCATCCCCTTCAGA	1	2	yes
GATCCAATCCCTGTGCAGCA	10	13	yes
GATCCAATACTGCAGCAATG	26	19	yes
GATCCAAGTGTTTAACCATA	9	11	yes
GATCCAAGTCCAGGAACCCT	3	4	yes
GATCCAAGTCATGATTTGAA	337	47	yes
GATCCAAGTCACCCCCCGAA	18	13	yes
GATCCAAGTACTACCATAGG	21	16	yes
GATCCAAGTACACCTAAGGG	10	17	yes
GATCCAAGGTCAAGGCAGAG	73	10	yes
GATCCAAGGCCTCAGGTCAC	166	18	yes
GATCCAAGGAGTGGTACCCA	2	1	yes
GATCCAAGGACTTCTCTTCC	283	201	yes
GATCCAAGCTCATCATTTGC	74	13	yes
GATCATGTGCCTACCCTGAC	8	6	yes
GATCCAAGCGTGAGCCAGTC	51	23	yes
GATCCAAGCGGACAGAGTGA	11	8	yes
GATCCAAGAGGAGGAGCACA	40	12	yes
GATCCAAGACCAGGGTGGCT	83	4	yes
GATCCAAGAAGTCAGTCGGC	39	31	yes
GATCCAAGAAGAAAAGCAAG	13	9	yes
GATCCAACGTGTTAGCCTTG	20	19	yes
GATCCAACGAAAGGCTGGTT	4	4	yes
GATCCAACCCCACCTCAAGT	51	10	yes
GATCCAACCATCCCACTCCT	97	23	yes
GATCCAACCAGAACATGGGC	49	13	yes
GATCCAACATTGACTTTCTT	3	3	yes
GATCCAACAAAGGTTGTGAG	681	186	yes
GATCCAACAAAACACGCAGG	47	14	yes
GATCACTGGAGCAGGCCTCC	10	10	yes
GATCCAAATGCTTCTGTCTT	4	5	yes
GATCCAAATCTTCAGTGTAG	51	10	yes
GATCCAAATATTGTCATAGC	178	21	yes
GATCCAAAGTTGGCCAGCAT	36	16	yes
GATCCAAAGTCACACCTCCA	57	21	yes
GATCCAAAGGCAGCAAGAAG	161	153	yes
GATCCAAAGCTTTCCCATTT	3	3	yes
GATCCAAAGCTGCTTAAATC	116	24	yes
GATCCAAAGCAGTGCTCCCA	95	10	yes
GATCCAAAGAGAGAAAGAGC	10	7	yes
GATCCAAAGACTCAGGTGTT	80	9	yes
GATCCAAAGACACAGTCTGT	196	32	yes
GATCCAAAGAAGACAAAATG	16	14	yes
GATCCAAACTTAACGAGCCC	29	0	yes
GATCCAAACCCCAGTGTACC	60	20	yes
GATCCAAAATGCTACTGTTA	4	5	yes
GATCCAAAAGGAGACTTCTA	327	16	yes
GATCTTCTTGCTGGTCTTGC	1	1	yes
GATCCAAAACAGCAAATAGG	10	11	yes
GATCCAAAAATGGGGATGTT	127	33	yes
GATCCAAAAATACAGCCTGC	23	24	yes
GATCATTTTTCTGTAGCCAT	26	26	yes
GATCATTTTGTCGAGTGAGT	14	14	yes
GATCATTTTCCCAACGTTAC	12	12	yes
GATCATTTGTGTGGCCGTTT	488	156	yes
GATCACTCCTTGCTTTGCCA	12	12	yes
GATCACTCAGGGTGGGCAGT	61	5	yes
GATCACTAAAGGGTTTCCTG	43	42	yes
GATCATTTGCGTTTGGAGGT	51	50	yes
GATCATTTGAAAACTGAGAA	10	10	yes
GATCATTTCTTTCTGGCCTG	78	10	yes
GATCATTTCTCCATCTTTCC	98	78	yes
GATCACGGCATCGAAAGGAA	345	74	yes
GATCACGATGCCACACCCTG	12	12	yes
GATCATTGCTGACCCCCTCT	332	100	yes
GATCATTGCAGTCTGAGGCT	1	1	yes
GATCACCTAGATGACACTTG	6	4	yes
GATCACCGCCTGCACCGCAG	12	20	yes
GATCACCCTGTCTCTTTACC	73	33	yes
GATCCCCAGAAAATGCGTTG	45	6	yes
GATCATTCATCAGTTTCGGC	820	290	yes
GATCATTCAGGACAAAGGAG	43	21	yes
GATCATTCAGACAGTACATT	7	6	yes
GATCATTAGGGGTTTGGTCT	90	88	yes
GATCATTAGGAAGGGAGGTG	10	15	yes
GATCATTACTGTGTGAGTGT	2	3	yes
GATCATTACCTTTGTTGTCC	9	7	yes
GATCATTACCATTGTTGGTG	14	14	yes
GATCATTACACGGAGAACAC	5	8	yes
GATCCCGGCAGCACTCGCTC	31	21	yes
GATCAGTCGCAAAGATTTCA	7	6	yes
GATCCTTCTGAATGCCTGCT	118	20	yes
GATCCCAGTGGATGAGCATG	123	125	yes
GATCCCCTCGCTGAGTCCTA	2	1	yes
GATCCCAGCACCGAGGGGAA	54	12	yes
GATCTGAAGTTCAAATTCCG	44	34	yes
GATCCCACTGCACATAGGAC	16451	6177	yes
GATCCCACGGGGTGCAGTGA	145	34	yes
GATCCCACCTAGCAGCCACC	185	50	yes
GATCTGAACTTTGTACAGGA	83	82	yes
GATCAAACAACCCAACAGGA	2636	1658	yes
GATCCCCGTGTCTGTGGAAA	5	3	yes
GATCCCACAAGGTGGCTTGT	8	8	yes
GATCCCAACAGCAATTGTCT	290	295	yes
GATCCCAAAGCCTCGTATGC	18	18	yes
GATCCCCAGTCCAGGATGTG	15	7	yes
GATCCACAACACCCGAGTAT	1	2	yes
GATCCATTCTGACGTGTGGA	1	1	yes
GATCCATTCCAGAGGGACAT	14	4	yes
GATCCATGTTTTCCAGGTAT	7	7	yes
GATCCATGTGTTGGTTGAGA	13	13	yes
GATCACGTACTGTGCCTTGT	8	8	yes
GATCCATGGTGCAAACTCCA	133	15	yes
GATCCATGGTAGTCAGATAG	23	24	yes
GATCATGCCTACTGTGGTTC	4	5	yes
GATCCATGGGCCTTAGGGCT	8	8	yes
GATCCATGCTCTGATGAGCG	33	33	yes
GATCCATGAAGTTTTCAGTC	9	9	yes
GATCCATCTGCATTTGCGGC	1405	122	yes
GATCCATCCTCTGTCCTCTT	5	5	yes
GATCTCTGCTATGAGGCTAC	48	12	yes
GATCCCAGCAGCATGGCGTC	7	8	yes
GATCTCTCCAAAGCACACGC	34	33	yes
GATCTCTCAGGCCATGGGTC	119	15	yes
GATCTCGTAGCTGCCTTTTT	4	4	yes
GATCCAGTGTGGAAGAGGTG	33	33	yes
GATCTCGCTTACAAGAAACC	17	17	yes
GATCCCACCTCCCCCCAGTC	38	38	yes
GATCTCGCCCTGTCAAGCAT	15	11	yes
GATCTCGCAGCCTTCCCCTC	60	1	yes
GATCCAGGGTGGGAAGGAAG	97	28	yes
GATCCAGGAGACTCGAAGAT	30	31	yes
GATCCAGCTTCCCTCCGAGA	202	21	yes
GATCCAGCGAGGGAGCTGCC	27	4	yes
GATCTCCGCCCGAGCCTACG	43	34	yes
GATCCAGCATCACCCAGACA	36	11	yes
GATCCATTTTGTTCGTGGAC	11	4	yes
GATCTCCCCTCTTCCTGGAT	19	15	yes
GATCTCCCCTCTGGGTAATA	5	8	yes
GATCCATTGTACTACAAGTT	25	25	yes
GATCTCCCCACCACCCCAGG	161	144	yes
GATCCATGCTTTGCCCGAGA	7	7	yes
GATCTCCAGGGTGGATTTCT	31	1	yes
GATCTCCAAGTCTCTCAGTC	8	8	yes
GATCACCCAGGAAGAGAAAT	33	32	yes
GATCACCAGAAGCCATGCTC	33	32	yes
GATCATGTTCTTTCCGCAGG	167	10	yes
GATCATGTTCGCCTGGACAC	195	45	yes
GATCATGTTCCTGGAGGTCA	38	9	yes
GATCATGTTACACTTGCCAG	120	93	yes
GATCATGTGTCAAAAGCAAA	14	23	yes
GATCATGTGTAAGTGTCAAA	10	9	yes
GATCATGTGGATTCCAGGAA	19	10	yes
GATCATGTGGATGCCTTCCC	746	115	yes
GATCATGTGCTCACCTGCAT	36	17	yes
GATCCTCCTGTCTCTACCTC	31	32	yes
GATCATGTGAGCATCGTGGA	48	32	yes
GATCATGTCTTCTCCATGTT	80	19	yes
GATCATGTCTATCTCAGGGG	147	37	yes
GATCATGTCATTGCCTGTTA	216	38	yes
GATCATGTACAAGCTGATGG	658	44	yes
GATCATGGTTCAAGTGACAA	11	19	yes
GATCATGGTCTTCGGAAAAC	13	10	yes
GATCATGGGTGTGCCAGGGG	38	8	yes
GATCATGGGGATGGACGGGG	446	151	yes
GATCAGGTGAGACTGACTGT	2	1	yes
GATCACAGTTCATGTAATGC	8	6	yes
GATCTGTCTACTTTTCCTAT	8	8	yes
GATCATGGCGATGAAATCTT	15	10	yes
GATCATGGCCCAGACCTGAG	876	164	yes
GATCATGGCAAAGGATGACC	139	47	yes
GATCATGGATGTGTGGGGAA	4	5	yes
GATCATGCTTTCTTCTCTAT	3	5	yes
GATCATGCTCCTGCAGCTGA	274	57	yes
GATCATGCTCCTGAGTGGCA	86	20	yes
GATCATGCTACGTTTTGTCT	4	3	yes
GATCATGCTACCACTGCATC	158	35	yes
GATCATGCGCCTTTCTAAGC	37	2	yes
GATCATGCCTGGGTGAGCCC	647	489	yes
GATCATGCCTGGGGGAGCCC	496	103	yes
GATCACAGCAGCCCAAGCTC	46	23	yes
GATCATGCCTGGGATTCATT	80	10	yes
GATCATGCCCAAAACAACCA	3	5	yes
GATCATGATTTCCGAGCTAC	41	30	yes
GATCATGATTCTCCCTCAGC	10	7	yes
GATCATGAGTGACCACAGTT	14	12	yes
GATCATGAGGGAGTTCCGGT	198	48	yes
GATCATGAGGCTGTCTGCAG	2	3	yes
GATCATGACATTCCTCAGAT	10	4	yes
GATCATGAATTTCCCTCAGA	209	29	yes
GATCACAGACCATGGTCTCA	10	8	yes
GATCATGAACATCATCCAGG	63	48	yes
GATCATCTTGCTGCTTGACA	10	6	yes
GATCATCTTCACTCAGCCAG	7	7	yes
GATCCTTTCGGCTGAGCCTC	1	1	yes
GATCATCTGCCCTTTCTATC	50	49	yes
GATCATCTCCCCCTTCAGTG	8	8	yes
GATCACACCACTCTCAACCA	108	12	yes
GATCACACATCTGGGCAGTG	10	8	yes
GATCACACAACCCACCTCAG	4	4	yes
GATCATCGTGTCGGGATGAT	1	1	yes
GATCATCGGCATGGCATACG	402	26	yes
GATCATCCTTGTGTTGTGAA	56	8	yes
GATCATCCTACACCAGGTTT	260	130	yes
GATCATCCACCTGCTCACTG	247	242	yes
GATCATCCAAGTGTTTGAGC	9	9	yes
GATCACAAGATGGCGTTATC	7	6	yes
GATCAGGTCATCGCCTCCTT	175	51	yes
GATCAGGGTTAAGGAGGAGC	21	21	yes
GATCAGGGATATGAGGTTGC	4	4	yes
GATCAGGCGAGACATGTTCT	274	134	yes
GATCAGGCAGTGTTGCAGGC	2159	218	yes
GATCATCATCTTGACAGCTT	2	3	yes
GATCATCAACACAATGACGC	1	1	yes
GATCATCAACAAGACTATCT	36	12	yes
GATCGTGAGTGGGAAGCTGC	4	4	yes
GATCATAGCTTCCTGTCCCC	12	12	yes
GATCAGCGTGCGCCTAGCGG	214	26	yes
GATCAGCGCTGAGCTCCAGA	2	3	yes
GATCAGCCCCATTGCGGTGC	10	10	yes
GATCAGCCAAGCCAGACTTG	72	21	yes
GATCATAGCTGATGGCCTTC	5	8	yes
GATCATAGCTCTTTTCCTGA	2	3	yes
GATCATAGCAAAGATGGACG	45	20	yes
GATCATACGTAGTTGTGAAA	113	112	yes
GATCATACCAAGAGGTGAGG	201	98	yes
GATCAGCACTCTCGGTATGC	20	9	yes
GATCAGCACCACACTGGACT	16	15	yes
GATCAGAGCCCTGTCGATGG	5	8	yes
GATCAGACCATGGTACTGGC	146	42	yes
GATCAGTTTTTGGTGTCATT	650	88	yes
GATCAGTTTTGGTCTTGATG	48	5	yes
GATCAGTTTTGACCTCTTAT	198	64	yes
GATCAGTTTGTTTTCACTGT	82	5	yes
GATCAGTTTGCCAATCATCT	25	24	yes
GATCAGTTTGATTTGTTCTG	21	7	yes
GATCAGTTTCATGTTTTTTC	3	3	yes
GATCAGTTTCAGCCAGGAGT	492	155	yes
GATCAGTTTATCAGTCCGTT	17	17	yes
GATCAGTTGAAACTTGGAAA	2867	275	yes
GATCAGTTCCTGGTATACAG	18	18	yes
GATCCTGCTGGAGGTGAACA	2	3	yes
GATCAGAATGAGGGACCTCC	31	31	yes
GATCACTTTGACTTCATCCT	3	3	yes
GATCTGTGCAAAAGCAGTGA	480	44	yes
GATCAGTTCAGTGTGCATCG	12	12	yes
GATCAGTGTTTCTGCGAAGG	189	32	yes
GATCAGTGCTCTGCTAACGC	46	45	yes
GATCAGTGCCTTTGTTGGCA	80	53	yes
GATCAGTGCATTTCAGAGTT	17	17	yes
GATCAGTGAGTGTGAGTGTG	12	12	yes
GATCACTCAGTAACTGCTGG	20	4	yes
GATCACTACTCCTTAGACGT	46	45	yes
GATCACGTGTTTACCAATCC	6	9	yes
GATCACGTGTCCAAAGGTGA	42	41	yes
GATCACGTGACCACCCTTTC	17	17	yes
GATCACGGTGCCTGGTTACA	259	36	yes
GATCACGGGAGCTGAGCAAC	5	5	yes
GATCACGCAGTCTTAGAAAT	9	9	yes
GATCACGACGACGCCCACGC	12	12	yes
GATCACCTGCTCTAATGTCC	55	54	yes
GATCACCTCCCAGATTCTGA	19	3	yes
GATCACCGTTCCCATCCCCG	12	10	yes
GATCACCGACATCCTGCTGT	19	5	yes
GATCACAGTGAGATTCTCAT	9	9	yes
GATCACAGGTCTGAGCAAAG	5	8	yes
GATCACACCTGTAGACAAGA	20	19	yes
GATCACACAGGGAGGCCTTG	77	26	yes
GATCACACACTACTGAGGGC	22	6	yes
GATCACAACTGATGGCGGGT	562	39	yes
GATCACAAACACCGGTGAGA	5	7	yes
GATCAATGTCGTCATCATCC	13	13	yes
GATCCCTGTCAGCTAGCTGG	265	217	yes
GATCAACACTTTTCTCTCAG	48	47	yes
GATCCGAATCTGTGCCCAGC	30	29	yes
GATCACCAAGGCTCGGGAGT	1	1	yes
GATCCCTTTTCTGGAGCTGT	10	4	yes
GATCAAACTTAAGACCAACC	9	9	yes
GATCGACCACCGCAACTACC	1199	589	yes
GATCCCTTTATGAACCTTGT	10	17	yes
GATCCAAGCTACACCGACCA	1	1	yes
GATCAAGACTACCATGGTCA	13	13	yes
GATCAGGCAGCTGTTGAGTT	10	10	yes
GATCCAGAATGTGTGGCAAC	42	30	yes
GATCCCTCTCCAAAGTGGTT	12	12	yes
GATCCACTGCGTTTCCATGC	65	46	yes
GATCCACTCTCTCATGGGCT	21	34	yes
GATCCACCTTGTGGCCTGGC	68	22	yes
GATCCACCTGTCTCTCCTTC	4	6	yes
GATCTCATCCAACTGTTTAC	9	9	yes
GATCCACCGTACCAGGAAGC	59	13	yes
GATCCAGTCGTTCTGCTGCG	5	4	yes
GATCCAGGTGTTTGGCCTGA	13	13	yes
GATCAGGCGAAGCAACTGCT	4	4	yes
GATCCTGCCCCCACGCTGGG	10	17	yes
GATCCACCAAGGTAGAAAAC	42	42	yes
GATCCACATAGTGCTGCTGC	4	5	yes
GATCCACACAGGAGAGAAGC	22	17	yes
GATCTCACTGTGTCGCTCTG	9	9	yes
GATCTCACTAACCTGCCACC	3	3	yes
GATCCAGCTCTCTTAGACAG	4	4	yes
GATCTCACGGCCAGACAGAC	14	14	yes
GATCTCACGCCTCTGTGCAT	1	1	yes
GATCGCATTGCCAAGGGGGA	32	45	yes
GATCCAAGGAGCTGGGGAGG	9	9	yes
GATCTCACAGTTAGTAGTCA	5	8	yes
GATCTCAAAGGGAAACTGAC	7	6	yes
GATCCAACTGACTGGCTAGC	47	48	yes
GATCCAACTCAGTTAGGCTT	47	3	yes
GATCCAACGCAGCACCGTCT	78	4	yes
GATCGAGCCCCTCCGAGCCG	1	2	yes
GATCGAGCCAAGAGCTGTAA	35	35	yes
GATCGAGCAGGCCCGGCTGC	18	18	yes
GATCCAAAGGACATCGATAT	23	17	yes
GATCAAACCCGGCTTCCGAA	13	13	yes
GATCAAAACAAGGTACTGTG	25	24	yes
GATCTATCAGCTCCAGGAAC	1	1	yes
GATCCACTTGCGTTGTGAGC	33	5	yes
GATCTACTCCTTCAGAGCCT	15	11	yes
GATCTACTACCAGACAGACA	49	10	yes
GATCCACGGGGTGACTTCCA	4	4	yes
GATCTACCTGACCTTGTTGA	5	5	yes
GATCTACCAGGTGGACACCC	18	18	yes
GATCTACAGCACTGCCTTTC	9	9	yes
GATCCACCAGCGTGTGCATG	13	13	yes
GATCATTCTGAAGTACATTG	31	31	yes
GATCATTCCAAGTTTCACGT	76	12	yes
GATCTAATAGGACTTCTGTT	47	46	yes
GATCCACACTGGCGAGAAGC	2	3	yes
GATCTAACCACCAATCCCCC	934	88	yes
GATCCACACAATGGAGACCT	52	10	yes
GATCCCTTACAATTTCATCT	17	12	yes
GATCCAATTGTGTGCTGTGC	3	3	yes
GATCGTGTCCGGCATGAAGT	65	64	yes
GATCATGGCTGCCCGGCAGA	7	9	yes
GATCGTGGCACCTCCGGGCT	9	2	yes
GATCGTGAAGCCGCTGAATC	3	3	yes
GATCCAACCATGACCAGGTG	3	3	yes
GATCAGTCTTTTCAGTATTT	81	9	yes
GATCAGTCTTGGTTGCTTAG	162	0	yes
GATCAGTCCTCTGCACACTT	42	41	yes
GATCAGTCCTCTAGCATTTC	368	95	yes
GATCAGTCCTACAAAGTTCC	12	12	yes
GATCAGTCATCAAAGAACAC	38	37	yes
GATCAGTCAGGTCCTAGATG	9	9	yes
GATCAGTCACAGGCAAACTC	40	40	yes
GATCGCTTTAGCTTGCCTAC	3	3	yes
GATCACTTCATTTTCAACTT	5	5	yes
GATCAGTAGGAAGCACAGGT	472	175	yes
GATCAGTACTGCAGTTCCTG	202	97	yes
GATCAGTACTACTGTGGTGT	63	20	yes
GATCAGGTTTGGACTCCTTC	5	5	yes
GATCAGGTGGAGACTGGAGT	35	35	yes
GATCTGCGATGAACTGGGAG	178	27	yes
GATCAGGTGACCAATCAGAC	1860	389	yes
GATCAGGTCTACCTTTTCAT	4	4	yes
GATCAGGTCAGAGATGCGGT	90	11	yes
GATCAGGGCGTGGTAGAGAA	14	14	yes
GATCAGGGCCGTGTGGATGC	40	28	yes
GATCAGGGCCGAGTGATGAG	27	21	yes
GATCAGGGCCAGGGGAGGTC	65	64	yes
GATCAGGGCAAGAGGATTGT	52	25	yes
GATCAGGGCAAAGTGGCTTT	9	6	yes
GATCCTCTTCCACGAAACAC	5	8	yes
GATCAGGCTACTACAAAGTT	372	128	yes
GATCAGGCCTGGAGCCCCAG	65	64	yes
GATCAGGCCTGAACCCGTCC	48	47	yes
GATCAGGCCCTTCTTCCCAC	3707	346	yes
GATCAGGCCCACAGCCGAGT	1	1	yes
GATCAGGCCATCAAGTCACA	6	7	yes
GATCAGGCCATACGTAGCCT	17	12	yes
GATCAGGCACTTGAGTTTCA	3	3	yes
GATCAGGATGGGACAGTTCC	23	23	yes
GATCAGGAGGGTCAGCTGTG	180	136	yes
GATCAGGAGAAGGAAGAGGA	10	10	yes
GATCAGGACTCCTGTGACTC	4	4	yes
GATCAGGAACTCCAGTTCAT	8	8	yes
GATCAGCGGTGGGAATGACA	500	85	yes
GATCAGCGCTATTTCCTGAG	195	20	yes
GATCAGCGCCTCCAGTTCCT	5	3	yes
GATCAGCGAGTAAACTGGTA	161	15	yes
GATCAGCCTTCAGTTCATTT	1	2	yes
GATCAGCCTGCTCCTGGGGC	43	54	yes
GATCAGCCTCCATCCGCTCA	11	8	yes
GATCAGCCGTTCCTCTGGTG	21	10	yes
GATCAGCCGCTCAAGATTCT	620	77	yes
GATCAGCCCTTGAGGCAGCC	21	3	yes
GATCAGCCCTCCCCTGTGTC	12	12	yes
GATCAGCCCTAATCCTCTGG	284	147	yes
GATCAGCCCGACTGTCTGCT	23	23	yes
GATCAGCCCATCCACTCTTT	2	1	yes
GATCAGCCCAGCCCATGTGA	66	2	yes
GATCAGCCCACTCAGCCTAA	49	35	yes
GATCAGCCATTTCTTGGGGT	9	7	yes
GATCAGCCAGTGATACCACA	3	3	yes
GATCAGCCAGTGAAGCCCCT	125	32	yes
GATCAGCCAGGACCCTCAGA	26	32	yes
GATCAGCCACAAGATTTCAT	43	14	yes
GATCAGCCAAGGGTTCAGAG	252	54	yes
GATCAGCATGGATGAGAAAC	55	69	yes
GATCAGCAGTGTCGGCCATT	43	7	yes
GATCAGCAGTGCCTTGTGTT	156	22	yes
GATCAGCAGGGATTATTCCA	4	5	yes
GATCAGCAGCTTCACATCTT	10	8	yes
GATCAGCAGCCTACGACCTT	27	7	yes
GATCAGCAGAGTGGTTATGG	8	10	yes
GATCAGCACTCTGCCTCCAA	71	16	yes
GATCAGCACTAAGACTGCTA	23	5	yes
GATCAGCACCTCTCCAAGAA	28	20	yes
GATCAGCAAGTCAGGAGTCA	127	51	yes
GATCAGATTTGTCCACAAGG	43	42	yes
GATCAGATTGTCTCTGTTCT	20	19	yes
GATCAGATTCTTTTCTTTCC	110	108	yes
GATCAGATGTTTTGGGAAGT	23	23	yes
GATCAGATGGACAATGCCAA	4	4	yes
GATCAGAGGTGTGTGCAATC	2	3	yes
GATCCCCAGAGACAGAACTT	13	1	yes
GATCAGAGGCTCCCAACTGG	59	46	yes
GATCAGAGCTCTCCTGTTCT	1929	149	yes
GATCAGAGCTCCAGGCTTGG	5	5	yes
GATCTGCTTCTCGTCGGGGC	10	7	yes
GATCAGAGAGTAGAAGGAAA	10	10	yes
GATCAGAGACTGCCTTGTGT	713	164	yes
GATCTTGCCCAAGCAGTAGC	21	34	yes
GATCAGACTTTCTGGCCCCT	3340	2243	yes
GATCAGACTACAGCTGAGGT	47	46	yes
GATCAGACCTGTGGCTGAGT	50	28	yes
GATCAGACCATTGAAACCAC	10	10	yes
GATCAGACCAAAGATGGGTT	5	5	yes
GATCGCCCCCAGCTGGTGAT	3	3	yes
GATCAGACACTTCAAAATCT	3189	1447	yes
GATCAGACACTGACTGGTGA	21	21	yes
GATCAGAATGAACTTGCCAA	14	14	yes
GATCAGCTCCTCTCGTCTGA	13	13	yes
GATCTCTCCCTCATATAACT	25	24	yes
GATCCGTCGCCACTGGGGAG	2389	53	yes
GATCTCTGCCCTGGCACTAT	1	1	yes
GATCACTGCTCTGGTGGTGA	32	8	yes
GATCGTAAACTACTTGAGCT	14	14	yes
GATCGGCGCCTCCGGAGTAC	52	37	yes
GATCATTCTGGTTTCAGAAC	12	12	yes
GATCTACGTCCACCCCAGAT	53	40	yes
GATCTGCGAACCCTGACCTG	491	75	yes
GATCCTTCAGAGTCACATTT	10	11	yes
GATCACTCATTGTTCAGGTG	4	1	yes
GATCTGACGCCCTCTTCTGT	77	126	yes
GATCGGGCTGCCTGGCGTGG	73	72	yes
GATCGGCGTGTGGGCCAGGC	16	15	yes
GATCCTGAGAAACCTTTGAC	30	31	yes
GATCGCTGTTTAGGATGGCG	300	81	yes
GATCTTTCCAGAGCTGTGCA	10	15	yes
GATCGCTGTGGCCGAAACTT	60	40	yes
GATCCAAACTAAAGGCAGAG	19	15	yes
GATCACAGTCTGCATCCTAG	7	6	yes
GATCGCTCTCATTGCCCTTT	34	10	yes
GATCGCTACCAAGCAGTTCT	12	12	yes
GATCGCGCTCTACCATAGGC	3	3	yes
GATCGCCTTCTCCACCAATT	18	13	yes
GATCCTCAGGGCCTGAGCCT	7	5	yes
GATCGCCTGCGCACATTACC	12	12	yes
GATCGCCTCCTCCCTCTCTT	21	26	yes
GATCATGTGCCTTCCACTTC	12	1	yes
GATCGCCCTGTCCAACAAGC	25	3	yes
GATCATGTCTTCCCCTCTTT	11	3	yes
GATCATTTGGTTCCTCTATA	10	10	yes
GATCGCAGTAGCCAGCGCAG	23	23	yes
GATCGCAGAGTCCGCCAACT	7	6	yes
GATCCTTTGTGCAATATTGT	2	1	yes
GATCCTTTCCTTGGACTCAC	9	9	yes
GATCCTTTCCATGCAAACTG	15	5	yes
GATCCTTGTTGTGCCTCTTC	13	4	yes
GATCCTTGGGGTAAGCAGAA	21	10	yes
GATCCTTGAGGTCACGTTGC	19	2	yes
GATCCCAGGCCTGCTGCTGT	4	3	yes
GATCCATCTGCACTTGCGGC	14	14	yes
GATCCTTACCCTGTCCCTGT	33	24	yes
GATCCTGTTCCGAGCAAGCT	22	36	yes
GATCAGTGCCTGGCGCCAGA	48	47	yes
GATCCTGTGTGGGAGGCTTC	4	4	yes
GATCCTGTCCCAGGGGCTAG	164	35	yes
GATCAGGTCTCTCCAACTCA	4	3	yes
GATCCTGTCACTGGGGAGGC	132	2	yes
GATCCTGGTTGGGGGCAAGG	12	12	yes
GATCCTGGTCCCCAGCACCT	38	38	yes
GATCGCTGCAGAGCAGAGCA	2	3	yes
GATCAAGCTCAGTGTGTTCA	7	6	yes
GATCAAGCCCACCAGGCCTC	12	12	yes
GATCCTGGCGCTGGCTGTCC	196	24	yes
GATCCTGGCAGTGGACCGCC	29	21	yes
GATCCTGGCAACAGCTGTTT	7	7	yes
GATCCTGGAGAAGCATGTTC	10	12	yes
GATCCTGGAGAACACTGGTT	10	7	yes
GATCCTGGACCGCCACAATT	2	3	yes
GATCCTGCTGACACGGTGCG	4	4	yes
GATCCTGCTCCAGGAGATTG	12	12	yes
GATCCTGCTAAGCACTGAGG	20	33	yes
GATCCATTCGCAACTTGGCT	1	2	yes
GATCCCAACAATGCAGCCAT	328	197	yes
GATCTCTCCCCAGGGAAGGA	36	32	yes
GATCAGAAGTTCAGGGTTAT	22	9	yes
GATCAGAAGTTCAAGGTAAT	464	112	yes
GATCAGAAGTTCAAGGCCAG	155	105	yes
GATCAGAAGATGCAACGGAG	170	47	yes
GATCAGAACAACAGACAGTG	171	14	yes
GATCAGAAATGAGGTGTAAC	9	9	yes
GATCACTTTTGGTCAATATG	42	42	yes
GATCACTTTCCAGTTGAGTT	64	18	yes
GATCACTTGTTTGTGGTGAG	382	37	yes
GATCACTTGTCAGTGTTCAG	59	58	yes
GATCACTTGGCGGTGACTTT	69	8	yes
GATCACTTGATTTCTTGTGC	16	15	yes
GATCACTTGAGTTCTGGTAG	22	23	yes
GATCACTTCTCTGGTCTCCA	61	5	yes
GATCACTTCGGCCTGTACAC	29	28	yes
GATCACTTCGCCCTTTTTTG	50	14	yes
GATCACTTCAGTCTGTGCCA	42	14	yes
GATCACTTAGTGGGGGGTTT	23	23	yes
GATCACTTACTGCCTAATGC	39	5	yes
GATCACTGTTTTTCTGTTTG	10	8	yes
GATCACTGTGTTGGACACTC	6274	428	yes
GATCACTGTGTACACATTGG	13	11	yes
GATCACTGTCTGGAACCACA	104	8	yes
GATCACTGTCCCCCTGGGAA	1	1	yes
GATCACTGTCATATTTCACA	31	5	yes
GATCGACCACATCCTGGATG	99	22	yes
GATCACTGGTGTTTCCCATT	15	13	yes
GATCACTGGGTGTGTTTCAG	347	258	yes
GATCACTGGGAACAAACGGC	2509	208	yes
GATCACTGGAAACGATTGCT	18	18	yes
GATCACTGCTCAAGCCTGGG	33	5	yes
GATCACTGCTAAGTTTCAGC	1	1	yes
GATCACTGCGTTAATCTTGG	21	15	yes
GATCACTGCGAAGTTTCGTT	10	11	yes
GATCACTGCCATTTCGTACA	1335	139	yes
GATCACTGCAGGCGCAGCGG	326	19	yes
GATCACTGCAACCTTGTGCT	74	5	yes
GATCACTGACCTTGGAGCTT	30	9	yes
GATCACTCTGGCCGCTCTTC	27	27	yes
GATCACTCTGGCCAAGTAAG	112	5	yes
GATCACTCTGGAGTTCAGCG	429	198	yes
GATCACTCTGCTGGAGTTTT	63	15	yes
GATCACTCTCTGCATCGCTG	4	5	yes
GATCACTCCTTTTGAGGAAA	190	56	yes
GATCACTCCTGTTATGTGAC	1	1	yes
GATCACTCCGTGCACCTGCT	17	17	yes
GATCACTCCCTGCCTGAGCC	194	21	yes
GATCACTCCAAGTTGACATT	150	9	yes
GATCACTCAGCAGCCAGGAC	100	20	yes
GATCACTATGTCCAGGCTTC	12	12	yes
GATCACTAGTGACTGTTGGG	15	12	yes
GATCACTAGCTTCGAGGAGG	49	6	yes
GATCACTACTTCAGAATATT	10	9	yes
GATCACTACCCATCCTTAGC	4	5	yes
GATCACTACAAACCAAAGCA	67	2	yes
GATCACTAACATTCCCCGTA	31	4	yes
GATCACGGTTTTCTCTGTAA	288	72	yes
GATCACGGTTCAGATTCGTT	20	16	yes
GATCACGGTGAACCCCCAGT	65	26	yes
GATCACGGTCCCGTGACCGC	15	11	yes
GATCACGGCAGTGGATTGGG	191	26	yes
GATCACGGATGAGGAGTGGC	287	88	yes
GATCACGCGTCCAGATGTGC	193	24	yes
GATCACGACCGATACAGTGA	6	4	yes
GATCACCTTTGTCTGATAGC	5	3	yes
GATCACCTTTCTGCAGATGG	2	3	yes
GATCACCTTGCTGGCATCAG	125	1	yes
GATCACCTTGCCTGTCTATT	15	5	yes
GATCACCTTCTGATTCATCT	1134	81	yes
GATCACCTTCCTGTCTCATC	17	2	yes
GATCACCTGTTTCGCTGTGG	705	11	yes
GATCACCTGTAAATGGCCAC	720	708	yes
GATCACCTGGGACTCTAAGC	15	5	yes
GATCACCTGAAAGACCTGGG	1552	186	yes
GATCACCTCTTAGGGATGGT	2	1	yes
GATCACCTCGGATGATGGCT	14353	1182	yes
GATCACCTCAACGTGGGTGT	291	18	yes
GATCACCTCAACATGGTCTT	464	70	yes
GATCACCTCAAACTAATTTG	1	1	yes
GATCACCGTTTCAAGGCCCA	19	2	yes
GATCACCGGGGATGAATTCT	10	8	yes
GATCACCGCTCACCTTTCCA	1	1	yes
GATCACCGCCATTTCGTACA	266	70	yes
GATCACCGAGGAGGGAGACA	3	4	yes
GATCACCGACTCCCTTACTA	74	17	yes
GATCACCGACCGCATCGAGA	2270	57	yes
GATCACCCTGAATACTCCTA	2	3	yes
GATCACCCTCAGGTGCAGGT	329	28	yes
GATCACCCCCTTCCCTCTGT	49	6	yes
GATCACCCCCAATTGTATGG	373	371	yes
GATCACCCCCAATTGTATGC	49	34	yes
GATCACCATTTCCGACTGTG	3084	238	yes
GATCACCATTTCCCAGCAAC	12	20	yes
GATCACCATTCCGGTTACTT	33	2	yes
GATCACCATGAGTTTGAGTC	26	26	yes
GATCTACCCTGACTCTTATT	12	12	yes
GATCGTGGTACTCAATGAGG	14	20	yes
GATCACCATAGTGTATCTGA	11	8	yes
GATCACCAGGAAGAAAGAGT	28	21	yes
GATCACCAGCCTGAAGCTGA	40	11	yes
GATCACCAGCAAACAGCTTT	147	3	yes
GATCACCACCCCTGTTAAGC	86	21	yes
GATCACCACCAGGACGCTGA	131	29	yes
GATCACCAAGGTTGATGCAC	214	41	yes
GATCACCAACTCCTTCCCCA	2	3	yes
GATCACCAACCTGCTATCAT	1	1	yes
GATCACATTTTCGCAGTGGG	13	5	yes
GATCACATTTGCTTTGTGTT	4	5	yes
GATCACATTCTAATTGCTGC	100	3	yes
GATCACATGGCTGGATGTGA	26	17	yes
GATCACATGAAGTTTGATTT	60	28	yes
GATCACATCTTGCAGACAGG	278	21	yes
GATCACATCTATGAGAAGTT	76	5	yes
GATCACATCCAAAAAGTCAT	63	6	yes
GATCACATCATACCAGACAT	5	8	yes
GATCGCTGCTCCAACTCTAA	8	7	yes
GATCACATCAAAGGATGATG	45	8	yes
GATCACATACGCAGGAGTGG	33	11	yes
GATCACAGTTTCAAGATGTG	5	5	yes
GATCACAGTTGCTACTGCCT	54	43	yes
GATCACAGTTCCAGGAACAG	65	12	yes
GATCACAGTGCGTGCCTGGC	322	160	yes
GATCACAGTCTTCGCTAACT	16	5	yes
GATCACAGTCTTCCATTTCA	2	1	yes
GATCACAGTCCTTCCTCTGG	306	33	yes
GATCACAGTATTGTCTCAGA	50	5	yes
GATCACAGTACAATAGCTCA	71	5	yes
GATCACAGCTGAGGTGTGGG	53	4	yes
GATCACAGCTCAGTTCCTAT	6	2	yes
GATCACAGCGTTCGTGCCCA	51	11	yes
GATCACAGCGGAGTTAGCTT	35	9	yes
GATCGACAGGTATCTGGAGG	8	6	yes
GATCGACAAGGACAGCGAGA	284	63	yes
GATCGACAAAGTCAAGGTGT	5	6	yes
GATCGAAGCTGGTACCTGTG	15	21	yes
GATCCTTGCACAGCCTTTTC	10	8	yes
GATCTCCACACAACAGGTAA	46	75	yes
GATCCTTCCATTTTCACCGT	32	14	yes
GATCCCGTTGAAACTGCTGC	44	9	yes
GATCCTGCCAAGTTCAAGAT	150	20	yes
GATCCCCTTCTACCTACTCC	214	21	yes
GATCTCTCTGACTCTGCCTC	1	1	yes
GATCCGGCTGGTGGATGAAC	14	12	yes
GATCCCTGGTGCAAAGGCGG	173	176	yes
GATCCATCTGTGTAGTTTCT	134	31	yes
GATCCCTGCTCCTCTGGAGG	81	21	yes
GATCTGCCTGTCTTTTCCTG	3	3	yes
GATCCAGTCTCATCTCAGCT	18	14	yes
GATCCAGGGCACTCAAGTGT	9	9	yes
GATCCACTTCACAATCTTGG	29	24	yes
GATCCAGTGTTGGAATTCTT	23	0	yes
GATCAAAAGGTCAAGGTCGT	47	10	yes
GATCCTGCAACCCATTTCCA	10	6	yes
GATCCTGAGTGAGTGTGAGG	44	3	yes
GATCAGCAACTACAACTTTT	17	17	yes
GATCCTGAGGCTACGGGGAC	21	16	yes
GATCCTGAGGACAGGAGAGG	239	64	yes
GATCCTGAGAGTGTCACTGT	26	3	yes
GATCCTGAGAAAATCAGGGC	2	2	yes
GATCCTGACCGAGCGTGGCT	32	13	yes
GATCCTGACCATCACTATAC	4	5	yes
GATCCTGACCAGGGGGAGTC	17	17	yes
GATCCTGAAGTCTGCAGACC	53	54	yes
GATCCTGAAGATGTGGACAC	56	40	yes
GATCCTGAACCCACCCCCGT	36	46	yes
GATCCTGAAACGACAGTGGT	34	24	yes
GATCACACCAACCATTAAAG	5	5	yes
GATCCTCTTGTCTGCTTCGC	147	14	yes
GATCCAGGACCTGGTAGCAA	47	3	yes
GATCCAGGAAGTTGGTGAAC	187	38	yes
GATCCTCTTCTCCGCGTGCC	43	1	yes
GATCCTCTTCCACGAGACAC	236	168	yes
GATCATCCAGAACACACCCT	16	16	yes
GATCACTTTCCTCCCACGTG	6	7	yes
GATCCTCTGAAAAACCAAGA	14	18	yes
GATCCTCTCCAAGGAGGAGC	36	46	yes
GATCCTCTACTACTGCAGAC	3	4	yes
GATCACTGAGGATGGCTGAC	20	6	yes
GATCCTTCCTAGAGTCACTC	4	1	yes
GATCCTCCTGCCGATGTGGC	10	13	yes
GATCACGTGACCACAGCCCC	47	46	yes
GATCCTCCCGTATGCCAACC	50	39	yes
GATCCTCCCCTGGCCTCAGT	13	17	yes
GATCCTCCCCGCTCGCTCAC	25	25	yes
GATCCTCCCCCTCTGTCTTT	69	19	yes
GATCCTCCCAGACCCTCTGA	195	44	yes
GATCCTATCATTGTTGGTGG	7	7	yes
GATCCCACTGGGGAAACCAA	4	4	yes
GATCCTCATCATCGCGGGTA	46	57	yes
GATCACCAGACAGACAAGCT	13	19	yes
GATCCTCAGCCTCCCAGAGC	153	43	yes
GATCCTCACTGAGAAGGAAC	18	13	yes
GATCACAGTTCCTTATTGTG	4	5	yes
GATCCTCACACCCTGTTCCC	5	6	yes
GATCCTCAAGTCGGTGGTGG	2	2	yes
GATCCTAGTCCACCTCCTTC	10	11	yes
GATCACACTGTCTTGGAATT	26	7	yes
GATCCTAGCCAGATTACTAG	13	13	yes
GATCCTAGAGACAGGCCATC	13	13	yes
GATCCTAGACTCTCCTTGTT	77	47	yes
GATCAGCGCAGAGGACGCTG	2	3	yes
GATCCTACCTGCTCATCTGG	15	21	yes
GATCCTACAGTCTGGAATCC	20	20	yes
GATCAATTGGAACCGGCTTT	27	27	yes
GATCCTAAGCAAATGCCTTC	19	15	yes
GATCCTAACTTGGAAACTGT	10	11	yes
GATCGAACGTGAGCTTGATG	2	3	yes
GATCCTAAAGACTTCCAACT	27	17	yes
GATCCGTTTCTCTCTGCCTT	90	5	yes
GATCAAGTTTCCATCCACAG	7	6	yes
GATCCGTGTGAGGTGTGCTG	14	1	yes
GATCAAGTCTTGTCATAGCT	70	38	yes
GATCCGGTCCCAGCCCCCGA	34	25	yes
GATCCGGCTTCCCAAGAGTA	14	11	yes
GATCTTTCTTTGGTCAGGAA	20	19	yes
GATCCGCTGGGAGCTCACAC	20	16	yes
GATCCGCGGGGCTCAGTGTG	64	65	yes
GATCCGCCGTTCTCTGGAAC	30	1	yes
GATCCGCAGTGTCTTGGATG	22	4	yes
GATCCGCAGGCGCAAGGCCC	323	290	yes
GATCCGCAGCCGCCTAACTG	61	14	yes
GATCTGCTCTGTGGTGAACG	66	16	yes
GATCTGGTGTCTGGAATCCT	1	1	yes
GATCCCTCGTCAGATTCCTG	3	4	yes
GATCTGGGCTGTCACTACGA	77	7	yes
GATCTGGCTTCCTGCTGCTG	10	10	yes
GATCTCCTGCGTCCTTTTGC	6	7	yes
GATCGAAAAGCAAATGTTGA	3	3	yes
GATCAGACAGAGGTCAGAGG	16	5	yes
GATCTCTCCATTCCTGGTTC	4	4	yes
GATCTCCTTTGACCCTGAGA	7	9	yes
GATCTCCAGGGAGACTCCAT	3	5	yes
GATCGCTGCATTTTGGCAAT	1	1	yes
GATCGCCCCGACTTCCTGAC	10	10	yes
GATCGACATGTTCCTCCACA	5	6	yes
GATCCTTTGTGCGTCCACGC	2	2	yes
GATCCTGACACCTACACTCA	32	6	yes
GATCCAGAAGCTGATGGATT	23	23	yes
GATCCTGATGCTGCCAAAGC	556	37	yes
GATCCCGAAGTCTGTGACGC	6	4	yes
GATCCCATCCACCATTCTGC	2	1	yes
GATCCCAGCCATCTCAGCCC	190	12	yes
GATCCCAACGAACCCACATA	82	5	yes
GATCCCAAATTCAGGGAGTG	40	19	yes
GATCTATGAGGCCTGCTCCC	3	3	yes
GATCCATATCCCCAGACTGT	80	9	yes
GATCTCACTCTTCTTGATGC	3	3	yes
GATCCAGGTGTCAGAGCGAG	187	101	yes
GATCCAGAGTGGAGAGTGTT	25	10	yes
GATCCAGAGTGCTGTGGCAA	3	4	yes
GATCGGCCGGAGCCCTTCCC	4	4	yes
GATCCACTTCTTCTTTGCCA	55	10	yes
GATCTGCAGAAGCGTCCGGG	189	16	yes
GATCCACCTGTGTCTCAAGA	1159	15	yes
GATCCAAGCACTGACACTGG	79	25	yes
GATCCACCAGAAGGCACCAG	61	7	yes
GATCCAAACAGGCTGGAGAC	102	12	yes
GATCATATCCACCCTCCCAC	33	6	yes
GATCATAGGCAAACGTGGCA	282	237	yes
GATCATGGTGGAGGGCGGTG	35	58	yes
GATCAGCTGCTCACGCTGAT	570	104	yes
GATCCAAAGCTCTATTGTAC	2	2	yes
GATCACTACAACCATGTTAG	63	2	yes
GATCCACTCCCTGTACCGCC	215	24	yes
GATCAGCACTCTACCCTGGA	40	29	yes
GATCAGAGCAAGGGCTAGAC	138	136	yes
GATCCGGTCCCAAGACCGAT	33	42	yes
GATCAACAACAGGGCATCGG	34	33	yes
GATCACCCTTTCCTTTTCAT	39	4	yes
GATCACCAGTGTCGCCAAGG	1737	168	yes
GATCCCCTCGAACTAGAGTT	7	9	yes
GATCCGCAATCCACGTGGGC	4	4	yes
GATCCGCAAATACGGGCTGA	11	9	yes
GATCCGAGCCCCAGCGGGAA	145	17	yes
GATCCCAGGAGTCAAGCTAT	1	1	yes
GATCAACCACCCAGACCACA	18	18	yes
GATCCCTTCTGGTGCACACT	62	41	yes
GATCCCTTCTAAGTGCCAGT	20	7	yes
GATCCCTTCCCTGATGTTGG	22	23	yes
GATCCCTTATCGAAGTGTCT	9	1	yes
GATCCCTGTGGACAACAAGG	80	7	yes
GATCCCTGGTTGCTCCCTCT	45	5	yes
GATCCCTGGACACTTACATT	24	6	yes
GATCCCTGCTTCCAGCTTCG	85	4	yes
GATCCCTGCTGGGTACTTGA	339	175	yes
GATCCCTCTCCACAGGGTCT	17	12	yes
GATCCCTCTCACAGGCTTCG	4	4	yes
GATCCCTCACTGTGGTAGGA	83	41	yes
GATCCCTACACTAAGCTGAC	4	5	yes
GATCCCTAACCCTGGGCTGG	9	14	yes
GATCCCGTGTATGTTATGAC	15	8	yes
GATCCCGTCCAGGCAACTGC	3	3	yes
GATCCCGGTGTATCATGGCA	56	57	yes
GATCCCGGCAAGAAGAGCAC	14	15	yes
GATCCCGCAGTGGCAAGGTC	188	63	yes
GATCCCGAATTTTCCTAAGG	65	12	yes
GATCCCGAAACCCACCAAAG	52	37	yes
GATCCCCTTACAGCTGGCAT	4	3	yes
GATCCCCTGACCCTTTGTGT	10	8	yes
GATCCCCTCCCCTGGTGAAC	62	10	yes
GATCCCCTCCCATAGGTAGC	1	1	yes
GATCCCCTACAGTTTCTTCA	60	55	yes
GATCCCCGTTTTCTCTGCAG	1	1	yes
GATCCCCCTTTTCAGCCCTG	59	4	yes
GATCCCCCCTCTGGAAGGCG	43	13	yes
GATCCCCCAGTTGTCACCCT	101	6	yes
GATCCCCATTGCTCCCCAGT	30	23	yes
GATCCCCATCTCCATCAACA	316	43	yes
GATCCCCAGGGCCTCAATGA	2	2	yes
GATCCCCAGCTTCTAGGAAA	40	10	yes
GATCCCCAGCCGTGGCACTG	14	23	yes
GATCCCCAGCCACAGAATGG	149	18	yes
GATCCCCAGAAAGGTGGTCG	137	14	yes
GATCCCCACTTATGTGAATT	6	7	yes
GATCCCCACCACACCCTGAG	2	2	yes
GATCCCCAACACCAAGTGAA	3	2	yes
GATCCCATCCAGCCCTCCAG	130	19	yes
GATCCCATAGCAAGAGAGGG	22	28	yes
GATCTCAAAGTAACACTGTG	411	161	yes
GATCCCAGTAAAGATGCTGC	107	31	yes
GATCCCAGGGCCTGTCTCCC	13	13	yes
GATCCCAGGAGAGTCTGCCC	19	7	yes
GATCCCAGCATGGTCAGCGC	39	16	yes
GATCCCTCCTCCTTCACTCC	8	0	yes
GATCCCAGAGCTGGGTGATG	5	5	yes
GATCTATGAAACCAAGGCTG	673	46	yes
GATCAGTCACTCACAGAGGC	8	8	yes
GATCCCACGGTTGCTGGTAG	26	25	yes
GATCCCACCTCAAACTCGGT	38	31	yes
GATCCCACCGTATCCACCAG	2	3	yes
GATCCCACCCTCACCCCACC	33	2	yes
GATCCCACCATCCCACTGGA	9	12	yes
GATCCCAACCCTGAGAACTT	97	2	yes
GATCCCAAAGCACAATCTCC	75	3	yes
GATCCCAAACAGGCGCACGA	59	23	yes
GATCAGCCCCTGACATTGTT	7	1	yes
GATCCATTGCCTGGACTGAG	45	35	yes
GATCCATGTCCCACAGTAAC	40	15	yes
GATCCATGCTGTGCGCTACC	65	9	yes
GATCCATCTCTTCCGGACAT	1	2	yes
GATCCATCTCCCAGACTTAT	10	2	yes
GATCCATCCTAGGGTCTGTG	129	7	yes
GATCCATCCCCAGTGCCCCT	171	18	yes
GATCCATCCCACTTTGTCTT	4	4	yes
GATCCAGTTCCTCACCTTCA	23	18	yes
GATCCAGTGTATTTGGTGAA	48	32	yes
GATCCAGGTGCTGTGGACTT	78	22	yes
GATCCTTTCAGCCTTTTCAG	18	12	yes
GATCCACGAGCCCAAGGGCT	30	21	yes
GATCATCCACAGCGGCAAAT	27	27	yes
GATCCCCTGCCAGATGGTAC	440	75	yes
GATCACCGTGCTCCATGTCT	10	7	yes
GATCACAGAGGACCTAGGAG	11	9	yes
GATCCTCTCTCTAGGGCAGC	11	14	yes
GATCTTCCCCGAGGGTCGGC	30	29	yes
GATCCATCTTGTGTCCCTCT	38	4	yes
GATCTGTGACAAGAACCTGG	595	191	yes
GATCACATCTGTGTCACTGC	5	4	yes
GATCCCCACGGCTGGTCTGA	5	4	yes
GATCTGGTGCCCTGCTGCTT	39	28	yes
GATCTGGGCCTCTTTCCACG	2	3	yes
GATCTGGCTCTGCCTGCTGC	65	64	yes
GATCCAGTTCTAAGCAGATT	173	41	yes
GATCTGCTGACTACAGCACG	67	13	yes
GATCACAAAGTTTGAGAATT	57	56	yes
GATCCTGATTCCTGGGCAGA	1	1	yes
GATCGTGAAAGGGAACGGGA	7	6	yes
GATCTGCTCCTGAAAAAAAA	5	8	yes
GATCACGTCTCTGCCCTCTT	8	8	yes
GATCCCCCAGGGTGAAGCAC	17	17	yes
GATCAAGCTACAGATATGGG	23	23	yes
GATCATATACAGGAGCAGTA	12	12	yes
GATCCTGGCCCAGCAGAAGA	7	8	yes
GATCTGACTTTCCAGAGCTG	23	21	yes
GATCTGCAGATGCTGTCCTC	102	43	yes
GATCGACCGTGAGAACTTCG	12	12	yes
GATCTGGAAAATGAGTGTTT	7	8	yes
GATCTGCTGAGGTGGAGAAT	15	12	yes
GATCTGCTCCAAAGAACCAT	42	11	yes
GATCACTTCTGAGGCTCCGT	13	13	yes
GATCACTTCATCTCCCTTCA	18	18	yes
GATCCAGGCGCTGCCCAAGC	27	34	yes
GATCCAGCTGCAGATGGAGC	9	9	yes
GATCCAGCCACTGTATTTGC	3	3	yes
GATCCAGCAGGAGTTGGAGC	3	3	yes
GATCCAGCAGAGGAAGAGGC	7	6	yes
GATCCAGAGGCCACAGCAAG	10	11	yes
GATCCAGAGGCAACGTGGGG	6	8	yes
GATCCAGACCTATGCTGAGT	22	3	yes
GATCCAGACAGCAATCCTTA	43	35	yes
GATCCAGACACCCAGACTAT	13	7	yes
GATCCAGAAGCTCCAATTTT	217	220	yes
GATCCAGAAGAGCATGAGGC	7	6	yes
GATCCACTTGTCTTCGGAGA	36	11	yes
GATCTTTGCCGGCAAGCAGC	743	387	yes
GATCACATCTTCCCGTCTCC	4	3	yes
GATCCACTGGGAGAGAGTGG	10	2	yes
GATCCACTGCCAGTGGTGTG	21	10	yes
GATCCACTCCTTACCGTTTT	44	11	yes
GATCCACGCTATCTCGTTCA	35	9	yes
GATCCACCTGATTTCTCCCT	4	4	yes
GATCCACCTCAGCCGTGTCC	10	13	yes
GATCCACCTCAAACCAAGCC	18	30	yes
GATCCACCCTCAGGCACCAG	54	7	yes
GATCCACCCGGCACACAGGA	9	11	yes
GATCCGCCAGGCCTGTGCTG	9	9	yes
GATCCACCAGTGCTCAGCAC	4	6	yes
GATCCACAGGCAGGAGGAGA	86	13	yes
GATCCACAGCGATATCCAGA	32	1	yes
GATCCACACTGGACAGTTCG	13	10	yes
GATCCACACAGGAGAGCGGC	88	9	yes
GATCCACAACAGTGCGTGGG	69	13	yes
GATCCAATGCCTTCTTCTGT	9	14	yes
GATCCATGGTGCAAACTCCC	1163	537	yes
GATCCAAGACCAGAGGGACA	21	5	yes
GATCCAAGAAGGTTTCTCTG	7	7	yes
GATCCAAGAAAGCGCCAAGG	9	6	yes
GATCCAACTGGCAGGAACCA	75	30	yes
GATCCAAAGAACAGGCATGC	18	19	yes
GATCCAAACCATCTTCCCGG	68	33	yes
GATCCACATCTCTAAGAAGT	44	35	yes
GATCCAAAAACAAAAGGCTG	3	5	yes
GATCATTGATGAGGACACCC	18	18	yes
GATCATTCCCTGGGTTGGTA	42	2	yes
GATCTCAGCAACCGTGGTAG	109	77	yes
GATCTCACTGCGTAGCCCAG	27	27	yes
GATCTTTCAAGTACCTCCGG	6	8	yes
GATCATGTCTATGCTATCCG	15	21	yes
GATCATGCACTGGGTTGGCT	37	28	yes
GATCACTTTCTCTTATCACT	7	6	yes
GATCATCCCCTCTGAGAAAC	40	6	yes
GATCCAAAGAGCCCAGTAGA	31	32	yes
GATCATCCAGTCCAACGGGC	145	1	yes
GATCATCCAGCAGCTCGTGA	3	5	yes
GATCATACATGTGCCCTCCA	2	3	yes
GATCAGTTCCAACATCAGCT	33	32	yes
GATCAGTGCCAGTCACCATT	4	4	yes
GATCAGTCTGACTGTTCTTG	44	10	yes
GATCCCTGACATGCCGAGGC	23	22	yes
GATCTGTGTTACCCATCCAT	4	4	yes
GATCAACCCCAAGAACTATA	12	12	yes
GATCACCAAACCAGTCAACA	24	39	yes
GATCACATTTTGAAATGCCT	27	20	yes
GATCTCTGACCTTGTATCAC	8	11	yes
GATCTCCTCTTGTTCCCCTT	46	14	yes
GATCTCCAGAGACCATGATT	2	3	yes
GATCTCATTTCGGGTGGTTG	8	11	yes
GATCTAGGCTGACCTGAGAG	78	23	yes
GATCACAGGTGATTCACACG	5	7	yes
GATCTAAACCTGAATGACTG	141	18	yes
GATCGCTCCATCTTCTCAGC	10	10	yes
GATCGCCTGGATGGTGCTTT	8	8	yes
GATCCTGCAGAGCCACGGTC	10	5	yes
GATCGAATGGGCAATGCTTT	21	21	yes
GATCCTGAAGCTGTGTTGTG	27	28	yes
GATCCTTGGCCCTTCCCATT	34	26	yes
GATCCTGTGTTACCCGGCAA	176	36	yes
GATCCTGTGGATACCTGAGA	8	5	yes
GATCCTGTGCAAGAGCAAGC	38	31	yes
GATCCTGTACCATCTGCAAC	19	14	yes
GATCTGCTCCCCAGGGTGCC	4	4	yes
GATCCACTTCCATAACCTGC	14	11	yes
GATCTGCCTTACGTGCACGG	26	26	yes
GATCCTGCGACAAGTATCAT	4	6	yes
GATCCTGCCTCCCAAGTGCT	39	11	yes
GATCCTGCACTCACACTTGG	53	31	yes
GATCCCGGGGACACACAATT	1354	508	yes
GATCCTCTTCCTGACTCGCA	10	3	yes
GATCCTCCTGGGAGGACAGG	28	35	yes
GATCCTCCCCGCCCCCCGAT	32	23	yes
GATCCTCATCCTGGACGAGG	325	15	yes
GATCCACTGTGAAGGATGGC	535	98	yes
GATCCCAAGCGCACCATTGC	22	23	yes
GATCCTCAGCAGAGGTATTC	72	53	yes
GATCCTCAAACAGCAGGTGA	3	2	yes
GATCCAGTCCTGTTCAGCGC	1	1	yes
GATCCTAACCCTCCTTTTAC	59	14	yes
GATCTCTAGAAGTTGAAGTC	34	33	yes
GATCCCTGGTGGAAAGGCCG	275	384	yes
GATCCCTGACCGGGAGTACC	4	5	yes
GATCCCTCGCTGAGAGCCCG	13	13	yes
GATCCCTACCCCCACTTTTT	4	4	yes
GATCCCGCCAGCGTTCTGTG	37	7	yes
GATCCCGAGTTCAAGGCCAG	233	22	yes
GATCCCCTCAAAGCTCAGGC	199	24	yes
GATCACAAGCACAAATCTTT	23	6	yes
GATCCCCACTTATGTGATTT	167	202	yes
GATCCCCACCTACGGGTTGG	155	10	yes
GATCCCATTCCTCAAGACTA	9	11	yes
GATCCCAGGAGAACAGTTTC	2	2	yes
GATCCCAGCAGTCCTGGCAT	13	13	yes
GATCCCACTGATGCCAAGTA	255	15	yes
GATCCCACTGAGACTTAAGC	153	67	yes
GATCCCACATCCCATTTCTT	5	5	yes
GATCAAGAACGCAGACATGT	37	36	yes
GATCCCAATGCTCAGGGCGA	3	5	yes
GATCCCAACTCGACGGTCCA	136	23	yes
GATCCAGGAGTTCAAAGAAG	112	39	yes
GATCCAGGAGGTCTCAGGAC	17	17	yes
GATCCAGCTGGACAAGCTCA	9	11	yes
GATCCTGTCCGGATTATGAT	91	25	yes
GATCCACAAGTTTGAAGAGC	213	45	yes
GATCCTAGCAAGATGTGATG	3	3	yes
GATCCTGGAGCTGCTCACAG	16	16	yes
GATCCAGGTGTCTGAGGGTT	91	15	yes
GATCCTGACTACTGGGAGAA	1	2	yes
GATCGAATCCGGTTCCTTAA	21	21	yes
GATCCTTACCACCGAAAAAG	7	5	yes
GATCCAACTCCAATTCAACA	87	22	yes
GATCCCGACACCAAGAAGAT	65	66	yes
GATCCTGGTTTCCTAGGAAA	2	3	yes
GATCCCCTCCCACAGAATAA	224	367	yes
GATCTAGGCATTTGGGCTTG	17	2	yes
GATCTACTTGATTCTCAGGG	7	6	yes
GATCAGCTACAAGAGGAGAT	16	15	yes
GATCTACCCGGGACACGGGC	880	330	yes
GATCGTTCTGAAACTCGAGG	8	0	yes
GATCGTGTTGTTTACCGTTG	10	2	yes
GATCGTGGCTCCCATCAGTG	104	6	yes
GATCGTCGTGACAGATACTC	18	18	yes
GATCCCAGGTCACACCTATG	6	7	yes
GATCACTGTCCTGCGGCAGC	34	8	yes
GATCGCTTTGATGACCACAA	66	51	yes
GATCCATGCTGGGGCTGGGC	7	6	yes
GATCCCACTTAGGATACCAT	5	5	yes
GATCGACTCCTGGTCTACGG	36	5	yes
GATCGACGCCACATACGTCA	3	3	yes
GATCCATGAGTACTACAGCA	145	46	yes
GATCCTTGCCTTCTGGCAGA	49	7	yes
GATCCTTCTGTTCACACCTG	8	3	yes
GATCCTTCCCATCAGCCTTG	1	2	yes
GATCCTTAGCTACAAGATTG	13	10	yes
GATCCAGTTTGTCCTGGTCT	157	23	yes
GATCCACTCGTTGCCTTCGA	1	1	yes
GATCCTGGACTCGAAGGGAT	10	5	yes
GATCCTGCGGAAACGCGAAT	2	3	yes
GATCTTCCCGTTGGCCGCTC	2472	187	yes
GATCTCGGGGAAACTCAGCG	20	19	yes
GATCTTCCATCCCTTCTGCT	65	64	yes
GATCCTATCCAGCTAGCTCT	67	5	yes
GATCCTAAGTGTCCCCCTGT	5	2	yes
GATCCGTGCTTCCTTTGGAT	35	7	yes
GATCCAGCAAGTCACCATGC	16	15	yes
GATCCCTTACCTGGATGGAA	24	11	yes
GATCCCTTACAGAAACAGTC	22	10	yes
GATCCCTGCTCACCGCGTGG	3	3	yes
GATCCCTGCGTAGCCCCTAG	129	34	yes
GATCGCTTCTGCCTGGGTGG	7	7	yes
GATCAGCTGGTCCAGGCAGA	16	15	yes
GATCATCTTCACCTACTACA	3	3	yes
GATCGAAGCGAGCAAAGTGC	3	3	yes
GATCATGTTGATAATGCTCG	138	37	yes
GATCCTGGGCTAGAGTTGTG	31	4	yes
GATCTGGTCATGACAGTCAT	57	23	yes
GATCAGTGTCGACTGCACAG	3	3	yes
GATCATCACCCAGCCTGAGA	2	1	yes
GATCACCTTTGACAGCATGA	21	34	yes
GATCATATCAAGTTTCCTAC	4	4	yes
GATCTGCCAGTGTGACTTCC	21	7	yes
GATCCTAGCCTTCTACTATG	9	9	yes
GATCTCAAAACCCAAACCAC	7	6	yes
GATCTGCTGGGTCACCAAGG	8	12	yes
GATCTTGCCAAAGCAGTAGC	21132	1445	yes
GATCAATCAGAGATTCAGTT	12	12	yes
GATCTGCGCGGCGAGGCCGC	14	18	yes
GATCCTAGCCTAGGACACTG	38	37	yes
GATCCTGAAATAGGGTTGTG	3	4	yes
GATCGACAGTGTTATCCCAC	1	2	yes
GATCAATGGAAGAGCAACTT	44	44	yes
GATCTCGCGCCAGGAGCTGG	50	10	yes
GATCCCGGCTTCAGGCTCGT	18	2	yes
GATCCCGGCCTCCTACACAC	22	12	yes
GATCCCAGCCCTAATTGCTT	1	1	yes
GATCCAAGACAAGGAAGGCA	8	4	yes
GATCTCCTCCATTCCTAGCT	449	50	yes
GATCTCATCATGGCTCTGGC	284	73	yes
GATCAGCTGACTCTCCGCTC	56	55	yes
GATCCCGAGGAAGACCTGAA	2	3	yes
GATCATTCTCTTGCGCTTTA	12	12	yes
GATCCGCATTCAGTGACTAG	3	5	yes
GATCCATGTCTCCCACACTC	16	5	yes
GATCGTTCTCGAGAACCTGT	18	0	yes
GATCCCGAGTCATACTGGTT	21	9	yes
GATCCCCTGGAGACGCCTGG	23	19	yes
GATCGCAAGTACACCCTAAC	21	21	yes
GATCGCAACCTGAGCTCCCC	65	64	yes
GATCCCATCAGAGCCACTCA	4	3	yes
GATCCCAGTACGACTACGTC	55	11	yes
GATCAGCCCCGCTCAGAGCT	35	35	yes
GATCAGCAGCAGTGGCCTCC	3	3	yes
GATCCCACGCCAGCGTCCAC	20	20	yes
GATCCCACCCACCACAAGGA	21	14	yes
GATCCCACAGTTTACACTTG	69	10	yes
GATCCCAAAAATCCCAGGGA	4	5	yes
GATCCAGTCCTTTCTCCTTT	3	3	yes
GATCTTCTCGCTTGGTCTGA	6	8	yes
GATCACACAGGAGACGAGGT	25	24	yes
GATCACCGTGTTAGCCTTAC	4	6	yes
GATCCAGGCCCTAGCACTCT	39	2	yes
GATCCAGCTCAGCCTGGGGG	20	14	yes
GATCCGGTCCCTGCCCACCA	35	25	yes
GATCTGTTCTTTCTCCCAGG	94	79	yes
GATCCCTGTGCTGAAGGCAG	3	4	yes
GATCCACCACTCTTGTCACA	5	5	yes
GATCCAATGCTTTCTTCCAT	4	4	yes
GATCCCGTGACGGCACCTAC	14	14	yes
GATCCCGCCTTGTCCATGCT	1	1	yes
GATCCCCTGGTTCCAGTACC	1	1	yes
GATCTGTACTGACCCCAAGC	16	15	yes
GATCCCCGATTTCTAGCGTA	22	15	yes
GATCCCCCAAAACGCTCTTA	5	3	yes
GATCCCAGCAAGCCCTGTGT	13	13	yes
GATCATTGTTGCCCATGTGC	6	8	yes
GATCTGTGCTAATGGACTCT	51	19	yes
GATCATGGCATTGTGCCTTC	3	5	yes
GATCCCACGTATCCTGGGCC	240	106	yes
GATCCCAAAGACTTTCAAAT	2	2	yes
GATCCATCAGGTGCAAAGTT	39	11	yes
GATCCATACACCAATGTTTT	30	30	yes
GATCGCCACATCACAAAACC	19	14	yes
GATCTGGTTCCTGAGCCCAC	61	60	yes
GATCCACAGGCAGCACAAAC	23	17	yes
GATCACAGACTCCAGCTTCC	240	74	yes
GATCATAGCTGCTGTGTGCT	5	6	yes
GATCTGGCCTAGCAGCTCAA	10	10	yes
GATCATACGAGGAGGCGTTC	97	51	yes
GATCAGTTTTGAGTTTTCTC	3	3	yes
GATCCAAGGCTTCCAACCCA	2	3	yes
GATCATTTGAAGAAACTTGC	4	4	yes
GATCTGGCTAGGATGCTCAC	2	3	yes
GATCCTCTGGTGCCACTTTT	7	7	yes
GATCCCTTTTTAACAGCTTG	3	3	yes
GATCATCCCCACGCTGGAGC	12	12	yes
GATCTGCCCTCCTGTCCCTT	3	3	yes
GATCACCAGTGTCGGCAAGG	27	44	yes
GATCTCAGCATACGGAGTGT	5	4	yes
GATCCTCCCAACCACTGTGC	10	5	yes
GATCCTCCACTGCCTGCTTA	1	1	yes
GATCGGGGAGGTGTTGGGAG	4	5	yes
GATCCCTGCTCCCCTCTGGT	6	9	yes
GATCGCTACGCCAGTGAAAA	39	38	yes
GATCCAATGGCCACTTCTGA	7	7	yes
GATCCCTGGACCCAAGAGGT	1	1	yes
GATCGAGAAGTGGCACTGCT	4	4	yes
GATCGACCTCTTGAGGAGTC	20	16	yes
GATCCTTCCTGAGTTGGTAT	4	3	yes
GATCGCCAAAATCCCAAATT	52	12	yes
GATCATATCCAGCCCAACTC	27	27	yes
GATCAGTGCATGATAATTTG	159	26	yes
GATCAGTGTTTGGCTGGGAC	85	39	yes
GATCGAGCTTTGAAGGCAGC	4	4	yes
GATCCTGACACCCGCCCTCC	1	1	yes
GATCCTGAGACTGGTTCATA	3	4	yes
GATCCACACCAAACGTGCAT	49	9	yes
GATCCAGGCCCTTTTCAGGA	6	4	yes
GATCATCAGCGTAAATGGGG	19	16	yes
GATCCAGACCTTCCAAAAGG	18	2	yes
GATCACTGTGTTGGACACTT	65	66	yes
GATCACTCAGTCTTGAGGTT	52	1	yes
GATCACCTAATTTTTCCCAT	31	15	yes
GATCACCACCAAGGACTTGA	210	86	yes
GATCACATCCATAGCTCTGT	18	18	yes
GATCTCATCCTGAGCGAGTC	3	3	yes
GATCACTGTCTGGAAGCTCA	19	31	yes
GATCTCTTTCCTTGCAAGAG	2	3	yes
GATCACTCAGGGGAGGAGAA	3	3	yes
GATCACCGACCGCATCAAGA	88	79	yes
GATCGCAGACTTTGGCCTCT	5	5	yes
GATCACCTCACTCAACAGAG	2	3	yes
GATCACCATCCCCAAAGATG	3	3	yes
GATCAGCCACACAACTGTTT	5	5	yes
GATCTGCCTATATCAGCCTC	10	10	yes
GATCACACCATTCCTGAAGT	97	11	yes
GATCCTGCATCCGGATGTGC	18	14	yes
GATCAAACGCTCTTGCAGAC	81	1	yes
GATCCTCGCGGTGCAAATAG	8	7	yes
GATCCCTGGAGGCTCAGAGT	48	12	yes
GATCTTTTCTTTCTTTCCTT	5	0	yes
GATCCTGCGGGAGATGCAGG	3	3	yes
GATCGTGGAGATGCTGGTGC	10	10	yes
GATCTGTTCTGGGGAATATT	89	4	yes
GATCGCCATCTTCCCCTACG	6	1	yes
GATCCTTACCAACAAGGAGG	2	2	yes
GATCCCTTTCTGCCCAGATA	3	4	yes
GATCCTGGGGAGTTACTTAC	17	9	yes
GATCAGTTGGGATTTTCACC	7	6	yes
GATCCTTAGTAAGGCAATCC	15	25	yes
GATCCTTACGTCCTCGAACA	3	5	yes
GATCCTGTGACTCGGAATGG	15	19	yes
GATCACGTTCAAGGTCACCC	5	5	yes
GATCCTTTTCCACGAGACAC	13	22	yes
GATCATATGCCAAACCCTCT	600	501	yes
GATCCATGTCAAGTCTCCTC	25	25	yes
GATCACCAGAGGAGATGGGA	45	62	yes
GATCACTACTGGGATTTCTC	13	13	yes
GATCACAGGAACCAAGGACC	3	3	yes
GATCCAGGCTGAGCGAGCAG	8	11	yes
GATCACAAAAGAGGCTGTTG	17	17	yes
GATCCATCCTTCCCTCTGTC	17	8	yes
GATCAACCGGTCCATGGACA	100	20	yes
GATCACCACCCCTCTTAAGC	3	5	yes
GATCAGAGCCGACACCAGAC	22	16	yes
GATCTGCTGCTGCTGACCAG	4	4	yes
GATCATCTTCAAAGTCGGCC	8	8	yes
GATCACCACCTTCATCGATG	3	5	yes
GATCCAAGCCTGAGGAGAAA	12	12	yes
GATCTGACAGTGCACAATAT	67	31	yes
GATCCTGCCACAAGCCAATT	37	28	yes
GATCCTAACGGGAGTGCTTT	3	4	yes
GATCCGGGAGGTGCCGGAGG	9	7	yes
GATCTCAACCTGTGCGGGCT	34	6	yes
GATCCTGTTGCTGAATGAAC	15	10	yes
GATCCCGAGCGTGAGGTCAC	2	2	yes
GATCCCCACACACAGCAGAC	6	5	yes
GATCCTACAATCTGCAGGAC	1093	342	yes
GATCGCCGACCTCAAGAAAT	4	5	yes
GATCCAGATGACCGTGGTGG	91	15	yes
GATCCACTATCAGAAGAACT	2	2	yes
GATCCACCAAGAAGATTGCT	59	11	yes
GATCTCCATGACCTGATACC	1	1	yes
GATCCCCAACAACGTCAAGA	8	8	yes
GATCGGGATTTTCTTAACTT	46	45	yes
GATCTGACTCTGTCTTCTGG	8945	1040	yes
GATCGAGCTCTTGTCCTTGT	5	5	yes
GATCCCCTCCCACAGAATAT	28	26	yes
GATCTTGAGGTTACGGAAAC	63	62	yes
GATCCTGAACCTAGTACAGG	7	8	yes
GATCTGTGTAAATGGGGACG	721	266	yes
GATCCTCAGCTCGGTGGTCT	2	2	yes
GATCCTAAAGATGGTTCTAG	6	7	yes
GATCCGCTTCTACCTGCAGG	10	2	yes
GATCCTTTCAGCTGATGACA	4	3	yes
GATCATTTGAAGCCAGGTGT	3	3	yes
GATCTTTCCCTGTGGGTGGT	16	3	yes
GATCCCCGGCACCACAGGAA	4	5	yes
GATCCCCAGGGCCAAGGACA	21	14	yes
GATCCCCAAGGAGAATTTCA	30	6	yes
GATCCATTTTCGGGGAGGGG	51	12	yes
GATCCCATCCGAGCTGGGGT	2	1	yes
GATCCCCGTGGAATACCAGA	2	2	yes
GATCCAGACATCCTTGTTGG	4	4	yes
GATCCGTGCTCCCACTACCA	18	5	yes
GATCCGGGGTGTTACACACA	3	4	yes
GATCCATGAGGATGACCATC	29	29	yes
GATCCCATGCTCATGTGCGC	28	10	yes
GATCCGCCTGCCTCTGTCTC	40	40	yes
GATCCACGGACACTTGAAGG	2	3	yes
GATCTGGCCATTTGGTACAT	20	11	yes
GATCTTTTGTTCCCCTCTGT	38	2	yes
GATCTGCTGCAAGACAGGCA	21	14	yes
GATCCTTGGAGAAGTCATCA	22	17	yes
GATCTGATGATGAGGAGGAA	113	87	yes
GATCCTGGACACTGACTGCA	116	74	yes
GATCAGCCGCTCCGTCAGGG	1	1	yes
GATCTGTTTCCGAGTGGCAT	7	6	yes
GATCTGTGCCGTTGGCTGCC	3	3	yes
GATCTGTGCAGCCTTTGCGT	9	12	yes
GATCCTGGCCTGACTGCACT	13	9	yes
GATCCCCTGCCTCTGTGGCT	18	3	yes
GATCCCCTCATCAAGGTGAA	21	3	yes
GATCCGAAAATGTCAGCAGA	26	26	yes
GATCCCCCTGCCCAGGTGAG	60	44	yes
GATCTTTTGGAACTGCCGCT	125	13	yes
GATCCCCAACCTGTTTCCAG	8	4	yes
GATCCCGCTGTGAGTGCATC	12	4	yes
GATCCCGAGTGAACTCCAAC	37	13	yes
GATCCCCTCCGTTGGAGTCT	1	1	yes
GATCCCCCTGCTCTACAAGT	12	9	yes
GATCTTGCCTCTGCACTGTT	1	1	yes
GATCCCAGACTGGTTCCTGC	9	9	yes
GATCACTCAGATGCTGATGG	22	4	yes
GATCCAGAGGGTCACTTCCA	1	1	yes
GATCCATCCCTGGTTAGCAA	3	5	yes
GATCCAGTTTTCTGGTGGTC	2	3	yes
GATCCAGAGCCACCAAGACA	2	2	yes
GATCCAGCTCTACTGCGGCC	5	5	yes
GATCCAGCTAAAGGTGTCAC	17	1	yes
GATCTGAGTTCTGGGACACT	9	12	yes
GATCACACTGTCACGTGAGC	40	1	yes
GATCCACAGAGGGCAATGTG	44	9	yes
GATCCACCCTCAAACATGCA	6	4	yes
GATCCAAATCAGGAAAGACG	454	18	yes
GATCCAAAGACAGACCACAG	52	43	yes
GATCCATGACTAGAGTCCTG	17	17	yes
GATCAGCTGTTCCAGGACTG	1	1	yes
GATCATTTCAAGAAACCTCT	50	20	yes
GATCGTTTCCCTGCTGGCGG	85	39	yes
GATCCTGTCACTGCAAAGCC	1	1	yes
GATCCCTCCTAGAGATGTCT	3	3	yes
GATCAGTCCTTGTAGCTGCC	3	3	yes
GATCCCCCTCCTCCCACTTG	1	2	yes
GATCAGTTGTGGTAATGATG	74	5	yes
GATCTGCATTCCATCCTGTC	139473	28632	yes
GATCTACCTCCGCTAGCTGT	34	23	yes
GATCCAGCTTACACTGCACA	5	6	yes
GATCACACCATGACTGTAGT	9	9	yes
GATCATAACTCTTTGTTGAA	1	1	yes
GATCTGTTGTGCAGCTGTTG	16	15	yes
GATCAGCAAGCAGGAGTACG	570	380	yes
GATCAGGCCAAACATCAAGC	4	5	yes
GATCCTGCAGTTCTGTGATG	1	1	yes
GATCAGCCTCCCGAGGGAGC	3	3	yes
GATCAGCCAGTGGTTAAGGG	4	4	yes
GATCTGTCCCAGTGTCAACC	78	14	yes
GATCTGCAGAAGCGTCTGGT	30	31	yes
GATCTCTGCTTCCTGTACCT	74	21	yes
GATCTCTAGCTACTGGCCTC	30	50	yes
GATCTCCTTCATCCCTCTCC	437	43	yes
GATCCAGGAAAGCAGCCTAT	20	33	yes
GATCTGCCCCTTCCGCCAGG	4	6	yes
GATCTCAGCATTACCTCTTT	3	5	yes
GATCCATTTCATGTGCCCAC	196	50	yes
GATCTGACCTTGGTAGGACT	18	18	yes
GATCTGAACAGTGGGACGAC	17	6	yes
GATCACTGTCTACTGATGGG	8	7	yes
GATCTATTTCTGAGTATGTG	16	15	yes
GATCGTGCCTTAGGAGTTAA	10	10	yes
GATCCTCTGCATCAGGTCAC	15	9	yes
GATCAGGTTGTCTCCTGCGA	30	29	yes
GATCCACGCAGAGCTCTCAA	309	250	yes
GATCAGCGTCCTGAGTTTCT	78	7	yes
GATCCTAGAGTGGACCCTGC	3	3	yes
GATCACTGGTGGAAAGGCGG	71	52	yes
GATCACCTTGAACTTCTCAT	2	3	yes
GATCTGTCTCTTCTGGAGTA	1	1	yes
GATCCTGCTATATTTCCTGC	5	5	yes
GATCCTGCCGATGCCACTCG	62	8	yes
GATCCTCTTCTGGTGTGGCT	7	9	yes
GATCTTGACCTTGTGGTCCT	15	12	yes
GATCAACCACGACATTGCCC	220	13	yes
GATCCTTTACCGCCAGTTCA	7	5	yes
GATCCCGATGGAGGCTGCAC	2	3	yes
GATCCCCAGTGCAGTTGGGC	8	7	yes
GATCCCATCAATTCGATGTT	112	12	yes
GATCCCAGTTAGGACTGAGT	120	67	yes
GATCAGGCTGGCTTTGGGTG	38	37	yes
GATCCCAGAAGCCTCTCTGT	6	4	yes
GATCCCCACTTATGTGACTT	7997	576	yes
GATCTCTGCAGTCAGAAGCT	135	12	yes
GATCCAGTTTGCCTGTTTGC	1441	15	yes
GATCGCCAACATGGGCCTGT	2	2	yes
GATCCACTACCGCTGTTGTG	8	1	yes
GATCCACGTGGTGGGAGGTG	27	4	yes
GATCCACCTTTCTTGTCATT	7	3	yes
GATCCACCTCCCAAAGTGCT	1	2	yes
GATCCACCAGTGCTGTGCTG	51	5	yes
GATCCACCAACTGCAAAGGC	7	5	yes
GATCCACAAATCATGCAAAG	3	5	yes
GATCCAAGTAGGGAGCCATC	14	9	yes
GATCCAAACTACTGCTGGCA	3	4	yes
GATCACTCCCACGCTGCTTC	8	3	yes
GATCAGCCCCGCCTGTCACA	29	7	yes
GATCCTGGAACGAGCTAGCT	9	9	yes
GATCTGCTTTCCATCCTGTC	445	20	yes
GATCCAGAGCAGAAACCACA	1	1	yes
GATCCTTTCCCGAAGTATTT	3	5	yes
GATCCAGACGGCCGTGCGCC	7	11	yes
GATCCTGCAGTTTGAAGCAA	36	6	yes
GATCCTCTGCCCGCCTTGCA	24	30	yes
GATCCTGCTCCTGCGCTGGC	381	35	yes
GATCACTTCCTCGGATATTT	5260	355	yes
GATCACTCTCTTAGACCATG	17	6	yes
GATCACTCCAGCTGTCGGGG	9	9	yes
GATCGCGAGTTTCCAATCCA	1	1	yes
GATCACCTTTCAGAAGTGCC	12	4	yes
GATCACCAGGGAGTGAGCTG	1	1	yes
GATCTCACAGGCTGAGAAAT	95	47	yes
GATCACATGACTGGCAGGGA	3	3	yes
GATCCCCGCCTCCGAGCCAG	4	6	yes
GATCCCCAGGAGGACATAGT	23	8	yes
GATCCCCACAGACTGTGGGA	28	8	yes
GATCACAAGTTCAAGACTAG	32	25	yes
GATCTAAGAGACTCGGAGCT	8	8	yes
GATCCAACCCTGTCCGCGTC	4	4	yes
GATCAACAACACGGATGCTG	50	49	yes
GATCCCCTTTACCTTCTGGC	4	5	yes
GATCATGGCTTTTGGAGGGA	4	5	yes
GATCCAGAGCTGCCTGTCGG	23	5	yes
GATCCTGCCTAAAGAGGTTA	2	1	yes
GATCTACAACCCCTGGGGGA	3	4	yes
GATCAGCTCTAAGACTGTTC	1	1	yes
GATCTCTTTGGGATACTGCC	14	14	yes
GATCAGCCAGACCCTGGAGC	4	4	yes
GATCCCTGGGAACTACAGTT	1	1	yes
GATCCCTCACTCCAGCCTTC	4	4	yes
GATCGGTGGTTACGCTGGTC	8	8	yes
GATCGAGCCAGTAGTTCTGC	9	9	yes
GATCTCGCCGTGTCCCTGGT	152	111	yes
GATCCCAGGAATGTGTGGGT	9	7	yes
GATCTCAATTCCTTTTGGTG	27	27	yes
GATCTTTTTCTGCCTGAGAT	37	3	yes
GATCTGCTACCTCAGACAGC	30	20	yes
GATCTGCGCCGCAGCCTGGC	312	72	yes
GATCTGCATGCCCTGGGTTC	3848	2606	yes
GATCCATTTGGAGTTAATTT	6	4	yes
GATCTTTGGTGAAGTGGCCA	13	19	yes
GATCTGCAGGAGGATGAAGC	51	50	yes
GATCTTTGCCAGTGGTTGGC	442	156	yes
GATCAGCTTCTGAAGTGCTG	17	17	yes
GATCTCCAGCTGCCTTGAGT	2	2	yes
GATCCAGACCTAGAACCTTC	30	24	yes
GATCCACCTGTCTCAGCACC	5	6	yes
GATCACGCAGACCCTCTTAC	8	8	yes
GATCACAAGTTCCAGGCTAG	8	12	yes
GATCGCTGCCTTGCTGGACC	5	6	yes
GATCCAGCCTTGCCTGGGAC	3	3	yes
GATCATAGCGCTGGGAGGTG	2	3	yes
GATCAGTTACAAAAATCTAC	12	12	yes
GATCACTGTCTACAGTGGTT	14	14	yes
GATCACTGCAGCTTCTAGGA	32	27	yes
GATCTTGTCTGTGGACTGTT	2952	215	yes
GATCCACATCATCCGTACGT	13	19	yes
GATCTAACTTACACGTTTTC	47	46	yes
GATCCCGCTCCCCCTCCCCC	10	2	yes
GATCCACCAGCTGAGAATTA	47	48	yes
GATCCCTGTGCCCCTGGTGC	10	13	yes
GATCCGTTCCTGGCTCAGCC	1	1	yes
GATCACCAAACCAGTCCACA	551	27	yes
GATCCAGCACGTCTGTCTGT	12	1	yes
GATCCCGTGCCATTGAGCAT	40	15	yes
GATCCACCTGGTTTTGTTTT	1	1	yes
GATCACCCTTAGCGGCTGTG	22	22	yes
GATCTTGGCTTGTAGGCGAG	88	17	yes
GATCTATCTCAGGCTCCCTT	13	5	yes
GATCTCGTGGCCGTGCTGTG	33	32	yes
GATCACCAACGAGAAGCTGG	258	11	yes
GATCCAGAAGTCAGGGTTGG	3	3	yes
GATCGGCCTCGAAAATGGAC	5	5	yes
GATCACCTTGGAATTTATCT	2	2	yes
GATCGAACAGAGGCAGTGCA	16	15	yes
GATCAGCACCTGCCACCAGC	17	17	yes
GATCCTTGGCCTTCCTCGAG	6	4	yes
GATCCTTCCGAATCAATCCA	14	11	yes
GATCAAGCGCCCACAGGACC	16	15	yes
GATCCTGGGGCAACCCATCT	167	65	yes
GATCCTGGGAGCCCTTTGCC	138	47	yes
GATCTTGTTGTGAGTGTGTG	258	24	yes
GATCTTGTGGATTCGTTAGT	34	33	yes
GATCCCCGAGTGTGCTCCTG	18	14	yes
GATCCTGCTGCTGGTGTACC	2	3	yes
GATCTTGGGCAAAATGGCAA	59	53	yes
GATCTTGCTGTATTGTTACT	11	9	yes
GATCTTGCTGCCCTCTGGTG	5	6	yes
GATCCTGACTGGCTCTGTAG	1	2	yes
GATCCTGAAATCCCGCAAAC	12	16	yes
GATCTTGCATCCAGATGTGC	16	15	yes
GATCTTGACTCTGAGGAGAG	30	5	yes
GATCTGTCTCCTGGGTCCTT	22	22	yes
GATCTGCTTGCTTCTGCCTC	11	16	yes
GATCTACGAGTGGATGGTGC	5	7	yes
GATCTTCTGCTTGTCAGTGG	128	8	yes
GATCTTCTCTTTGGGATATT	9	7	yes
GATCCACAACTTTATCAGCA	2	3	yes
GATCCCCTTCTGCCTGCAGT	3	2	yes
GATCTCATCGCAGTTTCCAA	11	8	yes
GATCACTAACGGTCAAATGG	50	49	yes
GATCAGCACTAAGAGTGTGG	1	1	yes
GATCAGAGTGAACCATGAGC	8	8	yes
GATCTTCAGGTGTCTGCCAT	214	19	yes
GATCTTCACCTCCACCATGC	83	61	yes
GATCTACTTCTTGAGTTCTG	29	19	yes
GATCTTAGCTTCCTGTCAGC	21	14	yes
GATCTTACTGAAATGCGTAT	14	14	yes
GATCTTACTCCAGCCTGGCA	9	14	yes
GATCTTACCCATGGTCTGTG	29	0	yes
GATCACCGCGTCAGGGTCCT	2	1	yes
GATCTGTTCTCCATAATTTC	1	1	yes
GATCGTCGTTTTGGTAAGAA	35	49	yes
GATCTGTGCTTCCCAATTCA	11	9	yes
GATCTGTGCTTCAGCCGGGT	13	8	yes
GATCGTACAGAAAGGAGGGC	35	36	yes
GATCGGGAAGAATTGGGTCG	16	15	yes
GATCTGTCTTGTGAACCAAG	4	4	yes
GATCTGTCCTCAGCAGGCTC	9	9	yes
GATCTGTCCACTAAGCCCTC	22	16	yes
GATCGGCCGGGGCTCTTGGA	1752	1550	yes
GATCCAGAAGCTGATGGATG	95	97	yes
GATCCCTAAGGAAGAGGAGT	7	5	yes
GATCGCCTCCACTTGCAACA	8	8	yes
GATCGCCCGCAGAGACCGCC	18	18	yes
GATCCCATTGATTCAACCTA	15	10	yes
GATCCCATGGCTGACACGCT	20	8	yes
GATCCCACTTTATCTCCGAC	1	1	yes
GATCGTTCCAAAGCCAGAAG	672	112	yes
GATCGAACAGCCAGAGGGCC	33	32	yes
GATCGGACTAAAGAAGAGCG	3	3	yes
GATCCATGCACTGATGCTGT	248	116	yes
GATCCATAAGGGATTTTTGC	5	6	yes
GATCCTTGGAAAAAGGCATG	5	7	yes
GATCCAGCGCAGGGGGGCCT	5	6	yes
GATCCACAGCCCCTGCTGTA	4	5	yes
GATCAACCTGAGCGTGGAGA	155	106	yes
GATCCCCTGTCACTGTGGAG	5	4	yes
GATCTTAGCCATCTCAGTGT	10	6	yes
GATCCATTTCATCAGTCTCT	10	8	yes
GATCAAGCAGGGCCTTCTGG	16	15	yes
GATCTCCTTCATCGATTACT	30	7	yes
GATCTGCATTCCATCCTGTG	335	200	yes
GATCCTCACCTGTCTGCACG	9	6	yes
GATCGGCCACTACCTGGGCG	10	10	yes
GATCCGGGCTACAGAGACCT	2	3	yes
GATCCCTTCTGATTTGTGAG	19	4	yes
GATCGCCTCAGAAGCAGCAG	93	25	yes
GATCAAGACTGACCCGTCAA	95	94	yes
GATCCTGCAACAGCCCCTGG	79	57	yes
GATCCTTCTCTCTCAGCTCT	5	6	yes
GATCCCAAAACGACGCATGC	31	24	yes
GATCCAGCCAGCTGCTGAAT	9	6	yes
GATCCAGTTCTACGAGCGGT	3	4	yes
GATCCAGCAGTTCGCAGCTC	31	5	yes
GATCCCTGTTCGGTTGCAAG	12	11	yes
GATCCACCTGAGACCTGAGG	16	4	yes
GATCACTTCCCGGAGAAAAT	4	4	yes
GATCAAGCTCAGAAGCGCAC	1	1	yes
GATCCCTACCGCCAGCTGCG	3429	64	yes
GATCCTGAGCTCCGAGACTT	95	18	yes
GATCCCTCTGCCCGGCCGGG	72	12	yes
GATCTTGTTGCCAAGGGGTT	37	36	yes
GATCCCCTTTCTCTATGTCG	655	126	yes
GATCCCCTTGAGCAGAGAAA	8	6	yes
GATCTGTAGAAAACGGGAAT	113	36	yes
GATCGGCAAAGCAGTGGAGC	5	5	yes
GATCCCCTCGCCACAGGGAA	14	10	yes
GATCGCTGCGGAAGATGTCG	35	1	yes
GATCCCCATGCTAAGAAAAT	46	14	yes
GATCCCCATCATCATTCGCC	114	8	yes
GATCTGGGCCTCCAGGGACT	96	21	yes
GATCTGGGACTGAGGCCTTC	33	32	yes
GATCGCTAGGACCCACACGC	5	5	yes
GATCGCCTCCGTCGCTTACC	1	1	yes
GATCCTTGCTCCCGCCTGTT	23	7	yes
GATCCCCACAGCCTTGCTGA	5	3	yes
GATCTGCTTTTCTGCAGAAC	61	5	yes
GATCTGCTTTCCATCGTTTC	1102	844	yes
GATCTGCTTGTCCTCTGGTC	202	24	yes
GATCTGCTTGATAAAGACAT	6	9	yes
GATCCCATAAAGGAGTCTTC	13	1	yes
GATCGATGACATCTGCCACC	4	4	yes
GATCCTGTCTGAAGGTAGAC	4	5	yes
GATCCTGGCTTTGATGTCTG	1	1	yes
GATCCCAGTACTGCCTTCTG	14	14	yes
GATCTGCTGTGCATTGAGGC	10	10	yes
GATCCCAGGACAGGGTTTTC	20	4	yes
GATCTGCTCTTCTCCCAGAC	32	2	yes
GATCTGCTCGCAGCCCACAC	40	40	yes
GATCTGCTCCTGTCCTTTGC	7	6	yes
GATCTGCTCACCAGTGAATC	1	1	yes
GATCTGCTATGAACACAGGC	166	163	yes
GATCTGCTACAAGTTTTACT	5	5	yes
GATCCCAGACTGGTTCCTGA	959	19	yes
GATCTGCGCAAATTCAGAAC	28	6	yes
GATCTGCGAGCGAAACCTAC	10	10	yes
GATCGAATCATTGATGCTGG	4	4	yes
GATCCTGCACAGCAGGATAT	3	3	yes
GATCCAAGATGCTGGGCTTG	216	79	yes
GATCTCAGCTCAGCATGGAC	5	4	yes
GATCTGCCACAAGGTGGATT	30	11	yes
GATCTGATGTTTGCCCTGCT	15	1	yes
GATCTGATGCCCTCTTCTTT	143	234	yes
GATCTGATGATGAGGAGGAG	40	41	yes
GATCCTACACACCTACCAAA	20	15	yes
GATCCGTTCTGGAAACACAC	4	4	yes
GATCCGTGCGTCCTTAACAA	9	4	yes
GATCCCAAGCACTGTCAGGA	29	13	yes
GATCGCTACGGTTCTTAATC	7	6	yes
GATCCGCCATAGGAGGCTAT	235	35	yes
GATCTGTGTGTTATCAGCAA	83	77	yes
GATCCCTGAGGAGGTCTATG	31	21	yes
GATCCCTCTTCCTTCTTATC	2	2	yes
GATCCTGGCCACTGGTGAGA	18	16	yes
GATCATGCCTGGGGGAGGCC	2151	832	yes
GATCCCGTGTGCGCTCCATG	13	0	yes
GATCCTCGGCTACATCAAAT	8	5	yes
GATCCCGAGCAACTATGTGG	9	3	yes
GATCAAGTTCTTCATTGACC	5	5	yes
GATCCCCTTTGTTTTCCGGG	21	5	yes
GATCATTCTGACTTACACAT	14	14	yes
GATCTTACCTGGGAGCCCTG	39	7	yes
GATCAGCTCTGACTTGGACG	8	8	yes
GATCCTCAAGGTCATTCTGC	32	5	yes
GATCTGTCCATCTTAGCCAG	656	27	yes
GATCAGCACCACCGGAACCA	7	8	yes
GATCCCTGACTATAATGATG	9	9	yes
GATCACTATGGTCGGTGACC	8	5	yes
GATCTGTCACCAGGAGAGGA	53	53	yes
GATCCCGTGTATGGTGTCCA	6	5	yes
GATCCTGCCAGATGAGTCGG	1	1	yes
GATCATAAACTGTCCCGTTG	150	59	yes
GATCACAGCCTGCATGGATT	4	4	yes
GATCAGTGAAACTTGACAGG	25	24	yes
GATCTGGTTGTACTGTCAAA	366	196	yes
GATCACCTGGTGCCATACAC	4	4	yes
GATCACCAGGAAACTTAAAA	3	5	yes
GATCCCCATCACCCCTACAT	1	1	yes
GATCGAGAAGAGTCAGGAGG	10	10	yes
GATCAGCTTTTCTTCTGGAG	46	45	yes
GATCACATGGGTGGGGACCC	23	23	yes
GATCAGCTTTTCTGTTTATT	8	2	yes
GATCAGCTTCCCATCAGTAC	342	28	yes
GATCAGCTTCATCAAGCAAC	55	54	yes
GATCAGCTGGGTTTGTCTTT	25	6	yes
GATCAGCTCTTACAACTTCT	188	6	yes
GATCAGCTCCGTGGTGCTGG	44	18	yes
GATCAGCTCCAACCCGGAGC	12	12	yes
GATCAGCCTTGAGACCATAG	6139	5392	yes
GATCAGCCTCTGAGCTCGGC	4	4	yes
GATCAGCCTCAGGAGCAACT	7	6	yes
GATCACACCCGCCGTGGACC	4	4	yes
GATCAAATGGCTCTTTTTCC	16	15	yes
GATCACAACATCTTTGTGTT	8	2	yes
GATCCCTGCCTGTGGGGGTT	6	9	yes
GATCCCGACCTCAGACTTTA	67	0	yes
GATCAGAAGTTCAAGATGAT	8	10	yes
GATCACTTTTCAGAAGCAAA	8	8	yes
GATCACATTCAGATATGGTT	3	3	yes
GATCCCAAATACTTCCGCTA	4	4	yes
GATCAAACTTTACCATTATT	262	21	yes
GATCGCAACAGCCTATATGC	10	11	yes
GATCCCAAATTTGAAGTCAT	1229	69	yes
GATCCTGGTAAACCCTGTGC	27	28	yes
GATCCATTGGAGGGCAAGTC	8	7	yes
GATCCTTTTGGCCACCATGT	2	3	yes
GATCAAAAGTTCAGAGCCAG	95	37	yes
GATCCCACCGCAGTCATGCC	2	3	yes
GATCCTACAGGCTGAGCTGT	30	31	yes
GATCCTAAGTCCTGCTGTCT	1	1	yes
GATCCGGCCCAACACAGAAC	1	2	yes
GATCCATCCAAAAACAAGGA	82	27	yes
GATCCATCACTTCGCAAAAG	5	6	yes
GATCCCAACCCCCACCCTCG	14	18	yes
GATCCCCCTCACAGTGTTGA	23	0	yes
GATCCATAGTCAGAAAAGTT	55	5	yes
GATCCCATGCTGACCTCTTC	14	12	yes
GATCCATCCTGAGTGTCTTT	2	3	yes
GATCCTTCAGCAGGCACAGT	40	15	yes
GATCCAGAGAGAGAGAGAGA	593	18	yes
GATCCAGACGACAGGGAAGA	12	12	yes
GATCGCTGCACAGGGTTTCA	346	54	yes
GATCCCTTCACAATCTCCTT	72	5	yes
GATCCAGCTCTGAGATGGGT	4	1	yes
GATCTCCTCGCTCATGCATT	20	19	yes
GATCTGACGTGCCGCCTGGA	236	156	yes
GATCTGACGCCCTCTTCTGC	566	118	yes
GATCGCCTGGAGAAATGACC	1176	1157	yes
GATCTGAAGTTTCACATCTG	3	4	yes
GATCCACTTCTGGAAGAGGC	18	16	yes
GATCTCTTTCGCGGACTACC	17	11	yes
GATCCCAGTCCCCATTGCAA	8	6	yes
GATCTCTTCCAAGATGCACC	3	3	yes
GATCTCTTCATCACAGCGTA	13	13	yes
GATCCACATCTCAAAGAAGT	1341	96	yes
GATCTCTGTTGCTCTGCGTT	85	60	yes
GATCCCCTGCAAGCTCATAT	16	12	yes
GATCTCTGCTTTGCAGGTGT	6	4	yes
GATCCACTCAGTTCTTAGCC	3	4	yes
GATCCCATGTCAACCGTGCT	2	3	yes
GATCCCCATTAGCTGTGGCC	92	17	yes
GATCTCTCCTCCATACACAC	4	4	yes
GATCCTCGCTATAGTTACTA	1	1	yes
GATCCCAGTGTGAAAAAGAC	44	24	yes
GATCCCACTGTCTTCTGATT	20	20	yes
GATCTCTCCCTCCCAGACAC	8	8	yes
GATCTCTCCAGCTACCTGCC	8	8	yes
GATCCTCAGTCCCCTGAAGT	20	15	yes
GATCCCAGACTCTGAAATCC	9	12	yes
GATCCTATATCAGACAGAGC	1	1	yes
GATCGGATTCACTATGTAGG	113	15	yes
GATCCTTCTGCTGCCCTCTG	9	6	yes
GATCTCGTGGAGACATGGCT	157	154	yes
GATCCATGCAAACTGCCGTA	12	12	yes
GATCCAGTTCACAGTTAATT	34	1	yes
GATCTCCTCCTCTACAAGGT	17	12	yes
GATCTCCTCATTGCTTCTCA	4	4	yes
GATCTCCGTCTCCCAGGGGC	19	7	yes
GATCTCCGTCACCAACATCT	6	7	yes
GATCTCCGGCTTTATTTTGA	100	79	yes
GATCTCCGCAAGGGTGCACG	171	41	yes
GATCCCTCAAAATACTGTGG	10	8	yes
GATCCCGCGCTCGGGTTTCT	5	4	yes
GATCCAGCTCTCCCACCCTG	43	5	yes
GATCTCCCTTGTCCAGTGGA	5	7	yes
GATCTCCCCGCACGGTTGTG	29	24	yes
GATCTCCCCCTCCTTTGAAT	5	5	yes
GATCAATAAAGGGAAGAAGT	21	21	yes
GATCTCCATTGCTCTGAAAG	108	82	yes
GATCCTAACCAGCTAAGATG	10	11	yes
GATCAAGAAGGTGTTGAAAT	10	10	yes
GATCTTTGCTGGTAAGCAGC	309	304	yes
GATCCTTGCCTCAAACAAAG	4	5	yes
GATCACCAAACACAAGTGGG	8	11	yes
GATCACACTTGGCGATGGCT	2	3	yes
GATCACACCATTTGGAGATA	2	1	yes
GATCAAGTAGTCCCAGTAAC	4	4	yes
GATCTGATTTGCTAGTTCTT	5	7	yes
GATCCGACAGGAGGGTGTAT	14	15	yes
GATCAAAAGGTCGGAGGAGC	5	5	yes
GATCCATACGTCTTGCCTGC	2	3	yes
GATCCCAGTGTCTTTCCTGA	6	7	yes
GATCTGGGACAGGGTCACCC	29	28	yes
GATCACTTTGTGGTACTACC	81	19	yes
GATCTATGCATCCTGTCAAG	850	233	yes
GATCTGCACCTGGGGACATC	13	13	yes
GATCACTGTCACTTCAGAGG	33	33	yes
GATCCAACCTTCCTCTAGAC	5	3	yes
GATCACCTGAACATTCTAGA	61	60	yes
GATCACCTCTAGACAGCCCC	27	27	yes
GATCCCATACCCCACCAAGA	398	51	yes
GATCACCCAGCCTTAGCAGT	34	33	yes
GATCCCGGGAACAGGGATAG	7	7	yes
GATCCATTCTCATGGTCAGC	5	7	yes
GATCCATTAAGTGGAGGTTT	4	4	yes
GATCCATCTCATTTTCCTAA	13	10	yes
GATCCCAGACTGGTTCCTTA	38	62	yes
GATCACGTCTTCCCATTGCT	4	4	yes
GATCCATACAGCAGTGCACA	1	1	yes
GATCCAGTGTCTTCCAGGCT	48	14	yes
GATCACACTGGGCGACGCGG	150	74	yes
GATCACACTGGACCTGTTGT	8	8	yes
GATCCAGTCGTGTCTAGGAG	12	12	yes
GATCCAGTCCATTCCAGTAT	4	1	yes
GATCCAGTCACTCTCCCAGA	50	40	yes
GATCCAGTCACAAACAAGTC	1	1	yes
GATCCAGGTTGTACTTCCGA	4	3	yes
GATCCAGGGCACAGTAGTTA	26	19	yes
GATCTTTTTTGTCGTAGGTG	2	2	yes
GATCACAAAGTTTGAGAAAG	28	45	yes
GATCAATTTGGATAGGTGTG	990	715	yes
GATCAATTTCAACCCCCTGC	203	64	yes
GATCCAGGCTCAGCACTTTC	13	12	yes
GATCAGGTTCCAGCTGCACA	62	10	yes
GATCCAGGACCCTATGTAAC	103	24	yes
GATCCAGCTGTGAGCAGATG	17	9	yes
GATCCAGCTCCAAGCCCTCC	40	40	yes
GATCCAGCGCAGGGGGCCCT	836	167	yes
GATCCAGCAGTTTACAAACC	1	1	yes
GATCCAGCAGGGCTTGCAGA	8	6	yes
GATCCAGCACAAAGAAAAAT	29	11	yes
GATCCAGAGAGCTGCCTTGT	53	18	yes
GATCTGGACAGTGCCTTGGT	22	16	yes
GATCCAGACCAGAGTTCTTC	23	17	yes
GATCCAGAAGTCCTGAGGAC	57	17	yes
GATCCAGAAGGCCTGATGGG	13	17	yes
GATCCAGAAACTGAGAAGCT	4	3	yes
GATCCACTGAGTTAGTATGT	2	2	yes
GATCCACGTGGAAATCTTAG	7	5	yes
GATCCACGCTGCACGGCCTG	6	9	yes
GATCCACGAAGTGCAACGCT	42	6	yes
GATCCACGAAGGTGGTGCCC	1645	219	yes
GATCCACCCCTGTGAGAGCA	126	9	yes
GATCTGAGCTACACCAGTTG	4	4	yes
GATCTGACCAACTGTTATGT	5	5	yes
GATCCACCACGCTAGCCATC	327	130	yes
GATCCACCACCTTGGCCAGC	19	14	yes
GATCCACCAAAGGCTGGGGC	118	14	yes
GATCCACATCCCCTTCTGGC	42	10	yes
GATCCACAGGTTGAGAACCA	2	1	yes
GATCCACAGCCAGTGTCCAC	2	3	yes
GATCCACAGCATGTTCGACG	61	15	yes
GATCCACAGAGAGGTGGTGC	26	7	yes
GATCCACACGCAGCTTGTGG	49	12	yes
GATCCACACCACTCAAAAAT	8	5	yes
GATCAGCCAACACCGGAACC	7	6	yes
GATCCACACAGCCCAGGCAC	10	16	yes
GATCCACAATCCAGGGACCC	29	21	yes
GATCCACAACTCCACAGGTA	199	35	yes
GATCCACAAACTGAAAGCCA	78	7	yes
GATCTCCTGGCTGTAAGGGA	91	51	yes
GATCCAAGGACTGTTAGTCC	2	2	yes
GATCCAAGCCCCTCCCAGCC	28	20	yes
GATCCAAGCCAGATTGACTG	8	8	yes
GATCCAAGAAATCACTGAAA	10	8	yes
GATCCAACTTGTTGCTGTTA	3	4	yes
GATCCAACTGGGATTTGGAG	3	4	yes
GATCCAACTCAACCTATTGA	29	8	yes
GATCCAACTAAGTCTCCTCC	14	2	yes
GATCCAACCCAGTGCCTTAC	39	3	yes
GATCCAACAGTCATCCTGCT	68	22	yes
GATCCTCTCCCATCCCCAGC	5	6	yes
GATCTCCACTGTCCATCCTG	2	3	yes
GATCAAATCAGTGGACATAT	4	4	yes
GATCACATGCGTTGGCGGCG	3	3	yes
GATCTCCACGTACATAAAGG	41	21	yes
GATCTCATTGCTGTGGTGGC	27	14	yes
GATCTTGTTATCCCAGCTGC	1	1	yes
GATCTCAGCCCCCGTCCGTC	90	10	yes
GATCCCGAGACCATTCCAAC	1	1	yes
GATCTCACTTCAGGGCTTCC	222	64	yes
GATCTCACTGCGCATTGTCT	8	8	yes
GATCTCACCGAGAAATTATC	30	29	yes
GATCTCACAGCCAGTTCTGT	102	7	yes
GATCCCTGTCACCATCCCAC	18	13	yes
GATCCCTGCCCAAAGCTCCG	29	2	yes
GATCTCAACTGCAAGATTGC	1085	378	yes
GATCTCAACTCCCTGGTCTC	10	10	yes
GATCTATTTTGTTTGTGGTT	20	13	yes
GATCTATTGGTGAGAGCTTT	4	4	yes
GATCCCTCCTGACCCTGACT	14	8	yes
GATCCACCTCTAAAGAGAGT	30	24	yes
GATCTATCCCAGCCTCTTAC	8	8	yes
GATCCCGTGCTTTTGCTGGT	1	1	yes
GATCCCTGGTGGAAAGCCGG	375	266	yes
GATCTGCTCTGGGTCTATGA	43	9	yes
GATCTACTTTGGGGTGCTTT	22	22	yes
GATCTACTCTATGCTTGTTC	4	3	yes
GATCTACGTTGCCCGAAATG	1	1	yes
GATCTCTTCCTTTCTGCAGC	3	3	yes
GATCTACCTCAGCGGCTCTC	5	5	yes
GATCTACCGGGAAGAAGGGA	47	39	yes
GATCCTGCCCCCAGGAAGTT	6	4	yes
GATCCTGCCATTCTGGAGGA	5	3	yes
GATCTACACGCAATGTGGCA	12	8	yes
GATCCCATGGCGTCTTTGCC	17	15	yes
GATCCTGCAAACCTGAACTA	56	17	yes
GATCAGTCTGTCTGTCTTTG	4	4	yes
GATCTAACCTGGGTTGAGCC	21	21	yes
GATCTAACCACCAATCCCCA	70	70	yes
GATCTAACACCCTCTTCTGC	194	14	yes
GATCGTCTCCTCCATCTTCC	97	2	yes
GATCACAGCTGCACCCAGCA	2	3	yes
GATCCTGCTGGACGCCCTTT	1	1	yes
GATCCTTAGAGCAGTGTGCC	13	11	yes
GATCCTATCCCAGCCTACTC	36	46	yes
GATCCACACTGGGGAGAAGC	3	3	yes
GATCCCAACACAGCGATATA	10	17	yes
GATCAATCCTCTTGGCTTGT	91	9	yes
GATCTGAACCAGCCAGGAGG	33	4	yes
GATCCCCGTGAGTTCAAGGC	14	11	yes
GATCCCGACAAGAAGAGGAT	17	9	yes
GATCCACGTGACACAGACAG	4	4	yes
GATCCAAAGTACAAGGCTTG	13	13	yes
GATCACCGTCACACCACCTA	2	2	yes
GATCCAGTCCCTGTCAAGCA	61	8	yes
GATCAAGAAATTGCCAGAAA	145	67	yes
GATCAGGATACTACAAAGTT	9	9	yes
GATCCAAAGGACATCGACAT	73	1	yes
GATCAACCTTAAAGGAAACG	250	71	yes
GATCAACATTCCTCGGCACT	10	10	yes
GATCCTCAGCACAATCACAC	8	10	yes
GATCAAACTTTCTACAGCCT	14	14	yes
GATCAAACTTCTCCGGAAAT	5	0	yes
GATCTCTTCCTGTCCTGGTT	59	6	yes
GATCAGACTATGGCGGTGGC	14	14	yes
GATCTTCTTCTGGTTCGGCC	48	47	yes
GATCCGTGCAGACATTGTGG	9	6	yes
GATCTCTGGCTCTGGGTGTC	96	10	yes
GATCCGGCCGGAGCATGTGT	6	4	yes
GATCCAAAGTGCACTTGCTG	36	5	yes
GATCCAAAGCTGGCACCTTT	14	18	yes
GATCCAAAGACCACAAGAAA	2	3	yes
GATCCAAAAGTTCTTCAGGA	45	11	yes
GATCCAAAAAGTCGGCTCCC	46	36	yes
GATCCAAAAACATGGAAAGC	37	2	yes
GATCCTTTCCTCACATCCAG	22	8	yes
GATCCTTTCAGTGGTGAGTG	33	6	yes
GATCATTTATGGAGGTTCTG	286	281	yes
GATCCATCTCGGCAACTTGA	1	1	yes
GATCATTCCTTCTCTCTCTT	27	11	yes
GATCCCCTGGGAGAGGACAT	2	2	yes
GATCCCCTGCTACTTCAGTT	35	4	yes
GATCATTCCCCAGAGGGTTG	93	49	yes
GATCGTCCTCCGCAGCTATG	33	3	yes
GATCATGTCTCTCCAGTTCA	47	5	yes
GATCCGTGCCATTAGTCTCT	35	20	yes
GATCCGCCTGGTTGCTGGGG	5	7	yes
GATCGCATCTCGGAATGTCC	10	10	yes
GATCGCACAGAGAGGCGGTT	3	3	yes
GATCATGCACAAAAGTTTCC	20	14	yes
GATCATGAGTTCCAAACCAA	1	1	yes
GATCATGAGCGTGTTGAGCG	13	12	yes
GATCATGACGCTGAATAAAT	2	3	yes
GATCATGACCTCACCAGTGT	1	1	yes
GATCATGACCATGCACAATG	28	6	yes
GATCTGCCTGTGCCCCTATC	4	4	yes
GATCATCTCCACGAGGAAGT	43	42	yes
GATCTGTTCCAGCTGCAGGT	136	2	yes
GATCCTTCTGCGAAGGTGTG	19	24	yes
GATCATCGACACGGACTACG	2677	1431	yes
GATCATCCTCTCAGTCTTTG	1	1	yes
GATCCTTACTCTCTAACGTT	5	4	yes
GATCCTGTGGTGCAGATTCA	6	3	yes
GATCCTGGTATCCTACAGGG	18	19	yes
GATCCAAACCAGAGGCCGAG	4	5	yes
GATCCTGGACGACTGGGGGG	26	17	yes
GATCCTGCCTTTGCCTACCA	7	5	yes
GATCCTGCAGAGGGCGGGAT	8	8	yes
GATCCTGAGCAAGGGTGTGG	1	1	yes
GATCACACCTTTTCAGTTAT	9	1	yes
GATCGTTCCTCTGCTTCAGT	8	8	yes
GATCCTCTGGGTCCAAGCTT	305	25	yes
GATCGTGTTTTCCAGAGCCG	4	5	yes
GATCGTGTTCTTGACTATGA	1	2	yes
GATCGTGTGTGTCTGCGTGC	216	32	yes
GATCGTGCGGAAGGCAGTGG	43	5	yes
GATCTGGACTCCCTAGGCTC	26	26	yes
GATCGTCTCAAGTATGTCAT	1	1	yes
GATCGTATTCTGCTTCTCTG	4	4	yes
GATCCTCACCGTGGAGGACC	196	16	yes
GATCCTCACACCAGCAGGTG	5	6	yes
GATCGGTGTGGCACCGTTTT	16	15	yes
GATCGGGCGTAGGTTTGATG	1	1	yes
GATCCAGGCTTCAAGGAATG	1	1	yes
GATCGGGATTTTCTAAACTT	20	7	yes
GATCCTCAGAACAGAATTGC	3	4	yes
GATCGGGAGGTGGAGCCCAC	30	29	yes
GATCGGGAAAGGAGTTTTTC	21	21	yes
GATCGGCTCAGCAAGCAGGA	4	3	yes
GATCGGCGAGGTTCTGCAGG	60	2	yes
GATCGGCGACACGAGGACGA	17	17	yes
GATCCTCAAGTACAGTGAGT	220	30	yes
GATCGGCAGCTCCGAGTCTT	35	25	yes
GATCGGCAGAGTGGGACGAG	12	20	yes
GATCGGCACTAAAGAGCGGA	3	4	yes
GATCGGCCGCTCTCTTCTCC	5	5	yes
GATCGGAGAGTTCAGAGATG	17	17	yes
GATCGGACTTTCCACAGGGC	59	8	yes
GATCGCTTCCCTGCCTCAGG	8	7	yes
GATCGCTGTATTGTGTACTG	10	8	yes
GATCATACTGTCGTGGCATC	143	31	yes
GATCGCTCATCCCAAGAACC	14	14	yes
GATCGCTACTTTGGGACAGA	6	5	yes
GATCGCTACTATTCTTGCTG	37	4	yes
GATCCAGATTGACTGACTCA	8	6	yes
GATCCCAGAATTCTACTGAA	5	5	yes
GATCGCCTTCAGGTTGCAGG	60	5	yes
GATCGCCTCTCACCATTGCA	34	3	yes
GATCGCCCAGGACCTCAGCA	42	15	yes
GATCGCCATGCTCCTCTTCC	50	13	yes
GATCGCCAGTGGATGACATT	5	5	yes
GATCGCATGTTTTGCTCTGT	47	31	yes
GATCGCATCTCCTGCTCGGC	24	17	yes
GATCGCAGCACAGCTGAAGT	4	3	yes
GATCCACTTCCGCGTCGAGT	38	12	yes
GATCCTAGTCTGTGTGGAGA	13	13	yes
GATCCTAAGGAGTAAATTGA	4	4	yes
GATCTTACAGAGAGTTATCC	17	17	yes
GATCGCACCCGTGAGCAGCC	16	0	yes
GATCGCAAGATAAAGGTTTC	37	36	yes
GATCGAGTCTGCGAGGTGAC	10	10	yes
GATCGAGGCCTTGAAACTCA	3	4	yes
GATCCACTCAGCTATGATGT	3	4	yes
GATCCGCCATCCCTAGCCTT	157	21	yes
GATCACCAAACCTAGTTGCT	55	6	yes
GATCGAGCTTGGCTGCCCAC	33	9	yes
GATCGAGCTGTGGTTTCAGA	3	3	yes
GATCGAGCGGGCTCGGAATG	1	1	yes
GATCGACACTGCTTGTCTTT	10	7	yes
GATCAACTGTGCAGACAACC	43	42	yes
GATCCACGGAACCAGACCCT	9	6	yes
GATCCCGTTCTCTCCAGCAT	11	7	yes
GATCCCAGCTCCAGAGTGCA	26	17	yes
GATCTCATCACTGGAGAGAA	10	8	yes
GATCCTGGCATGTGCAAGTG	4	4	yes
GATCCTGACAACCCTGTGGC	4	5	yes
GATCCAGTGCCTCAAATCAT	1	1	yes
GATCTCACTCTCAGGAGAGC	4003	228	yes
GATCTCACCTAAACATGCTG	3275	313	yes
GATCAGAGTCTCATTCTGCT	3	3	yes
GATCATCAGCCGACGACTGG	18	25	yes
GATCTGATACCAAAGCTGCC	10	10	yes
GATCCAGCTCAGCTTAGATG	21	5	yes
GATCACCGCTGCCGTTATGG	21	8	yes
GATCATACTACTGGTGGTCA	2	3	yes
GATCATAACCTTGCAGGTTG	10	8	yes
GATCCCACGATGTTAGATAT	5	5	yes
GATCAGTTGCCTGATTTCCC	59	58	yes
GATCAGTTAGGCTCTTCCTT	8	8	yes
GATCTCTTCTGGCCTCTGTG	277	100	yes
GATCCACACGGGCGAGAGGG	4	4	yes
GATCCTAATCCATCTTTACG	2	3	yes
GATCAGTGCTTGGGAGAACT	21	21	yes
GATCAGTGCCTCCTGTGTAA	4	4	yes
GATCAGTGAAGGCCAGTGTC	7	6	yes
GATCAGTCTTGCTCAGAATC	12	12	yes
GATCAGTCTTCCGGTCTGTA	18	18	yes
GATCAGTCCTTCCTATCCAT	134	22	yes
GATCTCTTAGTTTGGGTTGT	21	21	yes
GATCCCGTGCCGTTTTGCCC	6	8	yes
GATCAGTACTACTTGGCCAG	13	13	yes
GATCCGCCTGCCTGCTGTGC	35	35	yes
GATCCGCCAGGTGTTTGAGT	7	9	yes
GATCTTATTCCGGATGAAGC	16	15	yes
GATCAGGGCCAAGACCTTCC	13	13	yes
GATCTCTGCTTTCCTATTGG	11	3	yes
GATCTCTGCCTCAGAGCTGA	29	7	yes
GATCCCTGTTTCCCCCCACA	41	15	yes
GATCCCTGCCTTGTCCTGCA	98	29	yes
GATCACATGCGAGAAGCTGG	85	5	yes
GATCCCTCTGGATGCTGCCC	3	3	yes
GATCCCTCTCTCCCAAGTCA	5	3	yes
GATCAGGCTCTGCTCCCTTG	3	3	yes
GATCAGGCTCACCTGCAAGG	1	1	yes
GATCAGGCCTTTAGAGCGAT	400	171	yes
GATCAGGCCTATGACACGTT	2	3	yes
GATCAGGCCCCAGTCAGTCA	73	52	yes
GATCAGGCAGATGTTTGGCG	14	18	yes
GATCTCTCCTTTAATCAGCC	5	5	yes
GATCCCTCCAGGCTGGGTTC	52	15	yes
GATCCCGAGTTCAGAGCCAG	9	9	yes
GATCCAGCTGGAAAACTGAA	163	28	yes
GATCCCGACCATCCGTCCGT	31	4	yes
GATCAGCGTGTAGCCATGCT	3299	205	yes
GATCAGCGTGAGGGGTGTTC	12	12	yes
GATCAGCGCCCTCTCAAGCA	13	9	yes
GATCAGCGCATCGTGCGGGT	47	9	yes
GATCAGCGAAGTGGAGCCCA	33	10	yes
GATCAGCCTTTTTGTTCCAA	8	10	yes
GATCAGCCTTTTGTATAGAG	6	4	yes
GATCAGCCTCAGCAAACAGC	47	4	yes
GATCAGGAGGGCCGAGGACC	35	35	yes
GATCAGCCGGGAGGAGGCGG	136	21	yes
GATCAGCCGAACAACAAGAT	40	40	yes
GATCAGCCCCTCTCGGCCTC	61	44	yes
GATCCCCCTTCTGCAGTCCA	40	3	yes
GATCCCCATGAAGCAACGTG	25	10	yes
GATCCCCATCTGTCTGCCCA	25	7	yes
GATCCCATTTCTGTGAGTTC	1	2	yes
GATCCGGGCGCTGAAGGCTG	656	42	yes
GATCCCAGCAGCAGTCCCGT	20	4	yes
GATCCCAGAAGAGCTAAGAG	32	28	yes
GATCTCACAGTGTGGGGAAA	8	8	yes
GATCGAAGAGAGATGCTGCG	48	47	yes
GATCGAAATGGCACATTGAC	17	17	yes
GATCCCACCTCACCCACCGC	3	4	yes
GATCTTGCTCTCCGCTGGGT	2	2	yes
GATCCTTTTGCCACTTACCA	5	4	yes
GATCCTTTTAGCCGTAGAAA	4	3	yes
GATCCGACCATAACAGATGG	50	50	yes
GATCCTTGTTCTGGTGGCTT	7	5	yes
GATCCTTGGAGGCTGAAAAG	14	11	yes
GATCCTTGCCTACTCTGTAT	3	5	yes
GATCCTTGAGTCCAATTCTT	3	3	yes
GATCCTTGAGATGTCGGTTC	18	3	yes
GATCCTTCTGCCTCCGTGTC	5	5	yes
GATCCTTCTCTTCATTTCCT	1	1	yes
GATCCTTCTCAGTGGGTTCG	29	29	yes
GATCCTTCTCAGAAGCCTTG	7	6	yes
GATCCTTCCTGGCCCCAGAA	8	12	yes
GATCCTTCCTCCTGAATACA	4	5	yes
GATCCTTAGGTCCTCTTACC	55	9	yes
GATCCTTAGCTGAGCAACGC	10	8	yes
GATCCTTAGCAAGACAGAAT	6	2	yes
GATCACCCTTCCTTAGCAAC	4	4	yes
GATCCTTACTGGGAGCCGTT	79	18	yes
GATCCTGTTTTTCTGGGAAA	49	3	yes
GATCCTGTTTTTCAGAAGAC	51	10	yes
GATCCTGTTTTGGTATTCTT	14	9	yes
GATCAAGCTTTCTCCCCGCC	217	53	yes
GATCCTGTTGTCTTCCACAG	7	6	yes
GATCCTGTTGGTGCACTGTG	34	5	yes
GATCCTGTTGCTTCCTGTGG	18	13	yes
GATCCTGTGTGTCCTGAACT	6	7	yes
GATCCTGTGGCTCCCTTCCG	46	6	yes
GATCCTGTCTTCTTCTTTTC	2	2	yes
GATCCTGTCTTCCATCGAGC	166	18	yes
GATCCTGTCTGCACACATTC	5	8	yes
GATCCTGTCTCTAAAACAAT	4	6	yes
GATCGCTCCAAGTCAAGGGA	69	2	yes
GATCCTGTATGAGCTTGGAT	50	10	yes
GATCCTGGTGTCCTTGACCG	13	10	yes
GATCCTGGGTTTAGGCGGCT	22	16	yes
GATCCTGGGTCCTGCCTAAC	6	9	yes
GATCCTGGGGTTGGCTCCTG	2	2	yes
GATCCTGGGGGCACTAGATG	5	8	yes
GATCCTGGGGGACACAGACA	43	2	yes
GATCCTGGGCCTGGACAATG	41	6	yes
GATCCTGGGCAACTTGGTGA	465	16	yes
GATCCTGGGAAGACTGCTAT	9	9	yes
GATCCTGGCTGCCTCTGGTT	8	8	yes
GATCCTGGCTGCAGATGGGG	10	8	yes
GATCCTGGCTGATGTCCTCA	73	18	yes
GATCCTGGCTGAGAAGAGTT	87	12	yes
GATCCTGGCTACTTCCCTTA	46	16	yes
GATCCTGGCAGATGAACAGG	80	12	yes
GATCCTGGAGAGGAAAGCCA	42	4	yes
GATCCTGGACTTTGCCCTCA	278	111	yes
GATCCTGGACTCAGGCCCAC	86	61	yes
GATCCTGGACATTCCTTTCT	21	17	yes
GATCCTGGAACCTGGGTCAG	222	230	yes
GATCCTGGAAAACCCCAAGA	99	59	yes
GATCCTGCTGTGTTCTGCAA	13	11	yes
GATCCTGCTGTACTTCTGCA	111	28	yes
GATCCTGCTCCTGTAAAGAG	21	4	yes
GATCCTGCCCTTGGGTTCTG	1	2	yes
GATCCTGCCCTGGCACTGCT	24	9	yes
GATCCTGCAGGCTCTGGGTG	227	127	yes
GATCCCGACTGGGCTGGAAC	868	47	yes
GATCCTGAGGGAGCTGCAGG	1	1	yes
GATCCTGAGGCACCTCTCCG	8	10	yes
GATCCTGACTGAAGATGCCA	111	14	yes
GATCCTGACCTACCCAGCTC	47	9	yes
GATCCTGGCCCTGAGGCAGG	3	5	yes
GATCCTGGCCCAGGCAGCGG	142	10	yes
GATCAAAAGGCCGTGCTGGT	217	127	yes
GATCCTAACTTGGAGTTTGT	8	11	yes
GATCTCTCTGCTCAGCTGTT	17	17	yes
GATCCTGACAGTGACGATGA	5	3	yes
GATCCTGAAGTCATGTGTTT	52	37	yes
GATCCTCTTGGACCAAGAAT	1	1	yes
GATCCGTCCAGAGCAGTTGA	16	5	yes
GATCCTGCGCCGGCTTCTCA	33	4	yes
GATCCATGGAGCCCACATGG	20	20	yes
GATCCATGGAGAAGTGGTGC	78	38	yes
GATCCGGGCATCAGGACTTC	4	6	yes
GATCGAGCGCATGGTGCAGG	26	10	yes
GATCACCTACGACTACAAGT	8	8	yes
GATCCGCTGTATCGTGGAGT	3	3	yes
GATCCTGAAGGAGCAGCAGC	5	6	yes
GATCCAGTTTGTCTTCTGCA	6	8	yes
GATCCTCTCCAACCAAGGCA	29	19	yes
GATCAGCGCAGAGATTGAGC	6	3	yes
GATCACTGTTTTGTGGGGGC	1	1	yes
GATCCTTGGTGACAGGTGGA	278	39	yes
GATCAGCCATGTGTTAGAAC	26	18	yes
GATCAGCCAGTTCAACAGTG	33	32	yes
GATCAGCAGTTCCAGTGGTT	38	4	yes
GATCAGCACTTGGCCGACAT	2	3	yes
GATCAGCACGTTCCGTATCC	2	1	yes
GATCAGCACAGTCTATGTTG	54	7	yes
GATCAGCAACAACAACCCTC	181	27	yes
GATCAGCAAATCAAAGACTA	8	8	yes
GATCGCCAGTGTGTGACTAG	9	14	yes
GATCAGCAAACTTTTTCTGT	4	5	yes
GATCAGCAAAAGCTGCTCTG	14	14	yes
GATCAGATTTACCATTTTGC	5	5	yes
GATCAGATGTTTATCTCTCC	8	8	yes
GATCTGTCTGCCTCTCCTCT	3	3	yes
GATCTCCCTTCATCTGCAGA	12	10	yes
GATCCACAGCCCCATTGGGA	4	3	yes
GATCAGAGCTGGGAAGCCTC	35	35	yes
GATCAGAGCAGTTGCTAAGC	11	9	yes
GATCTCCATGGAAGAAGTAG	22	31	yes
GATCAGACTCTATCTGTGGC	7	6	yes
GATCAGACAGTGCTGTTCCA	13	13	yes
GATCCTTTGCAGAATGGTAC	16	17	yes
GATCCTTCATGAAACGCAGC	11	9	yes
GATCTGCCACTCTGCCATGC	14	15	yes
GATCAGAACCTTGCTATTCA	9	9	yes
GATCTGCCGCAAGTGCTACG	3430	547	yes
GATCTCATCTCCCGCTTCCG	7	5	yes
GATCTCATCGATGAGGCCTA	65	8	yes
GATCCAGGGCCAGGTACAGT	3	4	yes
GATCCCAGATTCTAAGTAGA	10	5	yes
GATCAGAAAGGGACTTAGCC	12	12	yes
GATCACTTTTTCTGTAATGA	3	3	yes
GATCCAGAACATGGGCCTGT	2	2	yes
GATCACTTAGCCACCACCAT	25	24	yes
GATCACTGTCTTTAGTTGTT	102	5	yes
GATCCTGGCTTTGTCTGTAC	19	14	yes
GATCACTGGGACTTTTAAAC	578	568	yes
GATCACTGCTCTGGGAACTG	147	16	yes
GATCCACGGGACCATCCATG	25	25	yes
GATCCACATGAGCAGGGAGC	4	5	yes
GATCCACAGGAGTGTGCAGC	142	11	yes
GATCACTGACTCTTGGTCAA	47	46	yes
GATCACTCTGGATTCCCAGG	17	17	yes
GATCCACACGGTAGAGGGAT	5	3	yes
GATCCAGCAAAGCAAGAAAC	17	17	yes
GATCCACTGCAGGCTTAGGT	10	3	yes
GATCCACAACTGCAGGCTGT	5	6	yes
GATCGCAGTAAAGTGGTCCT	5	5	yes
GATCACGCTGGTGTCTAGTG	17	4	yes
GATCACCTTGGATGAAGCAT	7	5	yes
GATCACCTTCCTTCATGTCT	2	3	yes
GATCACCTGGTGTCTCTCAG	16	15	yes
GATCTCAACCACCTGGTGTC	7	6	yes
GATCCAACAGCAGCAAATCT	76	27	yes
GATCCAAAAGTACCCAGGGA	841	90	yes
GATCACCTCTTAGACCTGGT	33	26	yes
GATCACCTCCGTCCTTACAT	38	7	yes
GATCACCTACGAAAGCCAAG	23	23	yes
GATCTCCTTTCCGGAAGCCA	23	32	yes
GATCACCGTTGTTCCAGAGC	8	5	yes
GATCACCGGAAAGACTGGAA	64	2	yes
GATCACCCCTCCTCATTCCA	464	144	yes
GATCCCCTCCACAGCCATCG	36	26	yes
GATCTCCACGTAGCTCCTTC	10	7	yes
GATCATCAAGAACAGGCTGG	193	190	yes
GATCCTGCCATGGAACACCC	37	16	yes
GATCATACGACTCACTGGTG	40	30	yes
GATCAGTTTGGTGTTCTTGT	18	5	yes
GATCAGTGTTTCTTTTTCTA	5	5	yes
GATCAGTAGTTGTAGCCTGT	1	1	yes
GATCCCCGCTCCTCATCCTG	203	31	yes
GATCAGGCTTTCTTCAGTTT	23	7	yes
GATCAGGCCACAAGCCAGGT	20	15	yes
GATCAGGAGTTGCAGCTCAA	26	26	yes
GATCAGCGGCTTGAGAGAGC	2	3	yes
GATCCTCTGTGCCTGTGAAT	1	1	yes
GATCCTCTGATGGAGCCAGA	3229	1788	yes
GATCCTCTCCCTTGTGCACT	10	5	yes
GATCCTCGTCCTGCTTCCAC	5	4	yes
GATCCTCGTCATAAACGAGT	2	2	yes
GATCACTTCCTCCCAGAATC	137	20	yes
GATCCTCCTGTCTCTGTCTC	30	2	yes
GATCCCCAAGATTGAGGATG	488	18	yes
GATCCTCCCTGGTGTCTGGT	47	16	yes
GATCCTCCCGTCTCTGCCTG	67	5	yes
GATCCTCCCACGATTCCAGA	139	17	yes
GATCCTCCAGAAGGTTGTAA	12	16	yes
GATCCTCCACTAGGGAGGAA	666	139	yes
GATCCTCCACCTAAAGCAGC	8	10	yes
GATCCTCCACACAGCCTGGC	74	23	yes
GATCCTCATCTTAGTTCACT	9	7	yes
GATCACTCCAGTTTGCTACT	1479	53	yes
GATCCTCAGTTGCTTACAGA	161	29	yes
GATCACGCCCAGTGCCTGAA	10	10	yes
GATCCCACCGTAATCGCTGC	17	2	yes
GATCACCATTGCTTCTGGAC	4	5	yes
GATCACCAGTCTTGGTTTCC	13	10	yes
GATCCTCAGAAAGTCTAAGC	12	3	yes
GATCCTCACTTCCAATTACA	19	15	yes
GATCCTCACCAAAGATGCTA	2	1	yes
GATCCTCAATAACCTAAGCA	3	4	yes
GATCCTCAAGGACTTCGTCA	1	2	yes
GATCCTATGTTCCCTGGAAC	4	5	yes
GATCCTATGAAAGGCTGACC	21	16	yes
GATCCTATCTGTAGTGGTTG	1	1	yes
GATCACACGTTAAGTTTTTG	10	7	yes
GATCACAAGTAGAGGGATGG	20	19	yes
GATCCCTGCTCCATGAGCAA	11	6	yes
GATCCTACGGGAGATGTATG	7	4	yes
GATCCTACCGGCGAGGAGGA	29	3	yes
GATCCTACAGCAGTTCTGAG	5	5	yes
GATCCTACAGAGTATGAAAA	20	2	yes
GATCCTAAGTTTGGGGTCTG	18	4	yes
GATCCTAAGAAGTCCCTGGA	27	44	yes
GATCAAGCCCTACTGCCTTG	10	10	yes
GATCAAGCCAGCTCAGCCAC	63	62	yes
GATCAAGAACTCCTACACAC	13	13	yes
GATCAACCTTGGCCTCAAAG	5	5	yes
GATCTTTCTGAGTTTAAGGC	14	14	yes
GATCCTAACCCTCTGTCTCA	1	1	yes
GATCCTAACATAGCTAGGTG	322	37	yes
GATCCCAGAGGGATGCAGAC	17	17	yes
GATCCTAAAAAGCCGAGAGG	343	160	yes
GATCCGTTTACTGTCCCAAC	4	5	yes
GATCCGTGCAGTGTCCGCTT	7	7	yes
GATCCGTGCAAAAGATTGGG	6	4	yes
GATCAAACGGTGGCATCTCC	12	12	yes
GATCAGACTGCAGGGGCCAT	9	9	yes
GATCCGTCCTGGACAGCATC	8	8	yes
GATCCGGTCTCTGGGTATAA	44	22	yes
GATCCGGTCCTGCATTGAAG	15	11	yes
GATCCGGTCCTCTCCGGGCT	7	2	yes
GATCCGGGTCCAAAGCATCT	51	37	yes
GATCCGGGGAGCAGCCGATG	25	16	yes
GATCCGGCCTCAAGAGGCTT	36	4	yes
GATCCTCGCGGCAACATCAA	205	22	yes
GATCCTCCGGTCTCTTGCCT	30	31	yes
GATCCGGACGCAGCCAATTA	5	6	yes
GATCCGCTCTTGCAAAGGGT	30	13	yes
GATCCGCTCACTGGTCTCAA	3	4	yes
GATCCGCCTCTCCCAGGAGC	85	16	yes
GATCCCAACTACAGCCCCCA	113	76	yes
GATCCGCAGCTGAGCAGAGC	139	11	yes
GATCCGCACAGCCCCTCTCG	23	29	yes
GATCCGCAATCCTGCCAAGC	12	16	yes
GATCCTCATGGAGTTCCTGC	152	108	yes
GATCACGTGGTCGTTCGGTG	7	6	yes
GATCTTTACGAGAAGCTTGG	181	1	yes
GATCTTTACAAGTGAGCAAG	5	5	yes
GATCCGAGTGTCAAGACAGG	17	9	yes
GATCCCTTTTCCCTTCACCC	2	2	yes
GATCCCTTTGGTTCCTGGAA	13	7	yes
GATCCCTTTCCCAAGTGACG	3	4	yes
GATCCCTTTCAGCTCCCCAC	1	2	yes
GATCCTCACTGATGTCCTCC	5	6	yes
GATCCTATGGTGAATCCCCC	10	3	yes
GATCCCTTGCAGTGTTTGCT	4	3	yes
GATCCCTTGAGTCCTAGTAG	15	2	yes
GATCCCTTCTTGCCCGGTGT	14	10	yes
GATCCCTTCTCAGTCCCCCA	41	12	yes
GATCCCTTCCCACTCTGTGG	92	5	yes
GATCCCTTCATTGTCGAAGA	6	2	yes
GATCCCTTACTGGGTACAGC	69	20	yes
GATCCCTTAAGCTATGGAAT	21	21	yes
GATCCCTGTTCTCGCCTCCT	17	4	yes
GATCCCTGTTCTCAGTGTTG	10	10	yes
GATCCCTGTGGGGGTGGGAG	38	38	yes
GATCCCTGTGAGCAACTCGG	72	73	yes
GATCCCTGTGAGAACATTTG	38	2	yes
GATCCCTGTCTTAAATTCAG	4	5	yes
GATCCCTGTCATGATGATGG	127	11	yes
GATCCCTGGTTGAAAGGCGG	5968	5764	yes
GATCCCTGGTGGTGCTGAGC	98	19	yes
GATCCCTGGTGGACAGGCGG	962	528	yes
GATCCCTGGTGGAAGGGCGG	23215	4390	yes
GATCCCTGGTGGAAAGGCTG	188	191	yes
GATCTCACTCGGGTGTGAAG	497	246	yes
GATCCTACTGTGCAGGACTC	31	8	yes
GATCCCTGGTGGAAAGACGG	1237	1118	yes
GATCCCTGGAGAGCTCTACC	5	4	yes
GATCCCTGCTCTCCAAGTGG	52	7	yes
GATCCCTGCCTTTGGGATAC	31	28	yes
GATCCCTGCACTCCAAGTAG	11	8	yes
GATCCCTGCACTACAAGTAG	2	2	yes
GATCCCTGAGGTTTGCTCCA	19	14	yes
GATCCCTGAGCGCATCCAGC	70	33	yes