#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCTCTGGTGTCATGGTGG	18	20	yes
GATCACCTCACATTCTCATG	18	14	yes
GATCATACCCTAGCCGGGCA	9	11	yes
GATCAGTGTGTGCCAAGGAG	745	58	yes
GATCAAGAGAAAGAAGTGGG	16	8	yes
GATCAGTAGAGCTTGGACCC	230	91	yes
GATCAGGGCAATGGTCACTG	67	18	yes
GATCAAGACGCAGGTCGAGG	33	31	yes
GATCAGGCTCTTTGTTTGTG	47	8	yes
GATCAGGCGTGAGCTTCAGA	11	14	yes
GATCGTGCACATCCAGGCCG	62	19	yes
GATCTGGCCACTTTGTGTTT	4	3	yes
GATCTGGCCAACGGCAACAT	166	70	yes
GATCTGGCAGTCATAGCTTG	455	80	yes
GATCTGGCAGTATATTTTAG	11	16	yes
GATCTGGCAACTGTGCGGGG	11	8	yes
GATCTGGCAAAAACTACGGG	54	15	yes
GATCTGGATTTGGTTGAGAT	94	13	yes
GATCTGGATGGAGTGCCTTT	7	8	yes
GATCTGGAGTCTGGTGTGGC	740	194	yes
GATCTGGAGTCTCTTAAAGC	68	59	yes
GATCTGGAGCCAGGCAGACT	5	4	yes
GATCTGGACTTTGCTCAACC	32	13	yes
GATCTGGACTGGTGTTTCTT	11	7	yes
GATCTGGACTCTCACCTAGG	17	12	yes
GATCTGGACTCACCTGGGAG	142	100	yes
GATCTGGACTCAAGGGGCAT	18	29	yes
GATCTGGACGGAAGTGGAGT	10	7	yes
GATCTGGACGATTCTGAGCC	143	25	yes
GATCCTCCTGTTCTCTGGTA	6	3	yes
GATCCTGTGTTTGAATGACA	4	7	yes
GATCAGGCCCAGTACTGCAT	13	11	yes
GATCAGGCCCACTCCAGGAG	83	33	yes
GATCACCATAATGCCTTTGG	8	6	yes
GATCAGGAAGACACGGACTC	10	10	yes
GATCAGCCTACGCTCACATT	19	14	yes
GATCAGCCAGGTCTACACAC	37	11	yes
GATCAGACTGTTGCTTTCGC	173	20	yes
GATCAGCACCAAGTGACTTG	14	7	yes
GATCAGAGTACTCAAGAGAG	13	3	yes
GATCAGAGCTTACCTGGAGC	8	1	yes
GATCAGACTTAGTTCCCTTG	14	13	yes
GATCAACTGCTTAGTGCGAC	13	6	yes
GATCAACTCCCGTACTAGAA	26	42	yes
GATCTGGACCAGGCTTGGAA	32	0	yes
GATCTGCTTTTTGAAATGAA	4	4	yes
GATCTGCTTTGTGCTTGGCT	105	21	yes
GATCTGCTTTCTCAGGACTC	155	15	yes
GATCTGCTTTCCCTTTGTAA	84	16	yes
GATCTGCTTGTGTTGTGTTG	508	52	yes
GATCTGCTTGGCTGCCATTA	104	8	yes
GATCTGCTTGCCCCAAACAA	322	64	yes
GATCTGCTTCTACCTCCCTA	3	2	yes
GATCTCTACCACCCAGGTAC	185	44	yes
GATCTCGGACGCTCAGTGGG	404	134	yes
GATCTCGCTTTCAGTCTGCT	2	2	yes
GATCTCGCTGGTTCGCACCT	17	16	yes
GATCTCGCTGCATTTACATA	55	2	yes
GATCTCGAGCACTCTCGTCC	57	33	yes
GATCTCCAAGGACAAGAGGA	17	25	yes
GATCTCCTTCCTGGCTGTAT	20	6	yes
GATCTCCTGGCCACTGTGGT	16	17	yes
GATCACTGTTTGTGCCTCTG	461	91	yes
GATCACTGTGTCCCAGGCTG	85	6	yes
GATCACTGAGGCATTGAAAG	12	11	yes
GATCACTGACATCTATACCC	52	11	yes
GATCAGAATGGCGGAGGCGG	187	9	yes
GATCACTCTTCCCGCTGCTG	75	17	yes
GATCACTCTGGCAGTCAAAT	8	8	yes
GATCACCTGTGGAGTTGTCA	37	16	yes
GATCTCCTCTCTTCCCACGG	171	2	yes
GATCTCCTCTCCAGGGAGCT	319	21	yes
GATCTCCCTTCCCCGGGGAA	36	8	yes
GATCTCCCTGTGCCGGTGCC	88	37	yes
GATCACATGGGTCGAGGGTT	86	13	yes
GATCACAGAGTGGGAATCTC	124	10	yes
GATCTTGAAGAAGATGAGGC	82	0	yes
GATCAACACTCCCCACGATG	16	15	yes
GATCACACTGTCTGAGGCGT	125	2	yes
GATCACACTCTGGCCCCCAA	41	17	yes
GATCTCAGTCGGATGCACCC	22	24	yes
GATCAAGGCCGTTCAGATGT	10	11	yes
GATCAAGGACATCCATGTGC	81	6	yes
GATCTCAGGTCACGGCTTTG	5	5	yes
GATCAAATCCGACGACGAGG	62	14	yes
GATCAAGAGCAGTGCTGCTC	43	4	yes
GATCTCAGCACTGTGTGTCA	3	2	yes
GATCGCTGCCAACATCCAGG	60	2	yes
GATCTCAGGGCAGAAATGAT	236	113	yes
GATCTCAGAGGCTCGGTATC	155	63	yes
GATCTCACGATGAGCTATGA	8	8	yes
GATCAAACCCAGGGCTTTGT	162	3	yes
GATCACTTTATTTGCTAGGG	177	8	yes
GATCAAAGGAAGCAAGTCAC	29	4	yes
GATCTCAAGTTGAACCGACT	47	51	yes
GATCTTTTTCTCCATCTCTT	11	10	yes
GATCAAACGTGGCTGAGCGC	1147	21	yes
GATCGGTCAGTGTCCCATAC	1	1	yes
GATCCCATCCTTCCAACCCC	11	7	yes
GATCATCTTGTGAAAACCCA	465	19	yes
GATCTTTTCCACCTTCAGAG	15	0	yes
GATCAAACCCGTGGAAGAGG	58	18	yes
GATCTTTTACTTCGTGGCTG	104	8	yes
GATCAAAACCCATCAACACC	50	9	yes
GATCTTTCTGGCAAGGAAAC	1882	246	yes
GATCAAAATGAAGGTCAGGC	1	1	yes
GATCCATTGACAGAGACAAC	3	4	yes
GATCATCCAGAACACAGCCT	1390	111	yes
GATCTTTCTGGGAGCAGTGT	28	2	yes
GATCGAAGCCAGTGAAGGTG	20	5	yes
GATCCTGATGCTGCCACGGA	74	20	yes
GATCTGCGCTTCCAGAGTGC	2398	257	yes
GATCCAGGGATGCTAAGTAG	6	2	yes
GATCCGCTCTGTGGAGACAG	2	3	yes
GATCCTGAGCTTTGACAAGA	186	64	yes
GATCCTGAGCCAGATGTCAT	48	4	yes
GATCCTGAGATGCAGCTCAT	9	5	yes
GATCCTGACTTTGCCAGCTG	44	8	yes
GATCCTGACTCTGACACTAC	80	9	yes
GATCCTGACCTGGGCTTCCT	76	36	yes
GATCCTGACCACATGAACAA	435	226	yes
GATCCTGACAGTGCACCTAA	179	10	yes
GATCCTGACAGAGCCTTGGT	1917	114	yes
GATCCTGAATGACGTTCAGG	207	66	yes
GATCCTGAAGTGGCCTCAGC	88	21	yes
GATCCTGAAGGTCATCCGCA	18	8	yes
GATCCGATTTCTGTGTCTGA	46	1	yes
GATCCTGAAAGCCAAGTTAG	281	43	yes
GATCCTGAAACTGACTCGCT	60	10	yes
GATCCTGAAAATTCTTTGCA	20	2	yes
GATCCTCTTTGCCAACCCCA	149	41	yes
GATCCTCTTTGCACAGAAGA	107	0	yes
GATCCTCTTTCACGCTTCTT	4	3	yes
GATCCTCTTGTTCCACGATG	6	2	yes
GATCCTCTTGTCCACTCCAC	101	23	yes
GATCCTCTTGCTGCAGCTTC	55	7	yes
GATCCTCTTGCGGGACAGTC	66	18	yes
GATCCTCTTGATTCCTTCTG	69	20	yes
GATCCTCTTGATGCAGAGAG	84	16	yes
GATCCTCTTCTTCCTCGTGA	161	17	yes
GATCCTCTTCTTCAGCACAC	577	35	yes
GATCCTCTTCTGCTGTTCTG	4	3	yes
GATCCTCTTCCTGCTCCAGC	294	8	yes
GATCCTCTTCCCATCCATCC	96	15	yes
GATCCTCTTCATCTTGGGCA	758	65	yes
GATCCTCTGTTGGGGCCTCG	136	47	yes
GATCCTCTGTTGCGTATTCT	3	4	yes
GATCCTCTGTGGACTCATCT	42	15	yes
GATCCTCTGTGCCTCACTCC	274	68	yes
GATCCTCTGCTTTAAGTCCT	27	7	yes
GATCCTCTGCAAGAGCAACA	2	2	yes
GATCCTCTGAGGCAGTATTG	53	46	yes
GATCCACCCCTTAAGAACCA	42	32	yes
GATCCACCACCTAGAATCTA	18	5	yes
GATCCCCGCCCTGCCCCCGC	19	13	yes
GATCCTCTGAATGTTTTCCC	631	127	yes
GATCCTCTCTTGTGCTACCT	71	8	yes
GATCCTCTCTGAACCTCCTG	146	25	yes
GATCCTCTCTCGGTGTGGTT	69	19	yes
GATCGTGACACCAAGTCAGC	7	1	yes
GATCCTCTCCTTCTGACCTC	33	3	yes
GATCCTCTCATTCAGTCTTC	2	1	yes
GATCCTCTAGGGGTTATGGG	975	131	yes
GATCCTCGTGCCTGTCTCCC	188	25	yes
GATCCTCGGGCAAGCCAAGA	2677	493	yes
GATCCTCGGGAGACCACTGG	16	17	yes
GATCCTCGGGAATTTTTACC	25	3	yes
GATCCTCGCAGCTTCTATGA	199	62	yes
GATCCTCGAGTGAGGACGAC	2	1	yes
GATCCTCGACAGGAAGCCAC	21	15	yes
GATCCTCCTTGTCAAGTACA	709	41	yes
GATCCTCCTGTGAAGTGCCA	7	7	yes
GATCCTCCTGCGTGCTGACA	57	9	yes
GATCCCTTTCCCCTAACTGG	51	15	yes
GATCCCTTGGAACTAGATTT	13	0	yes
GATCCGGTCCATCGTGCGAG	1	1	yes
GATCCTCCTGCCCCGACAAG	166	17	yes
GATCCTCCTGAGTGCTGGGA	68	14	yes
GATCCTCCTCCTGTGTTTCT	29	3	yes
GATCCTCCTCAGACTTGTCC	85	3	yes
GATCCTCCGTGAGTATGCCT	65	24	yes
GATCCTCCCCTTTACGGACA	236	24	yes
GATCCTCCCCAGGGATGGGG	134	12	yes
GATCCTCCCACAGGGACACT	156	31	yes
GATCCTCCCAAGTGAATGAC	214	31	yes
GATCCTCCAGTCAGTCTATT	13	0	yes
GATCCTCCAGGACAAGGGGT	59	12	yes
GATCCTCCAGCAGAGTGGAC	28	7	yes
GATCCTCCAGCACCAGGCAT	21	5	yes
GATCGCCCTCAAGGGCGGCA	159	14	yes
GATCCTCATCTTCATTCCTT	1	1	yes
GATCCTCATATGAGGACCAT	38	38	yes
GATCCTCAGTTACTCGCTGC	28	12	yes
GATCCTCAGTGGGTAAGTGC	28	4	yes
GATCCTCAGTGCTACTTGCG	13	5	yes
GATCCTCAGGGTCTGCCCTT	14	11	yes
GATCCTCAGGAGTTGCAATG	561	119	yes
GATCCTCAGGAAACAGTCTC	40	11	yes
GATCCTCAGCTGGCTGGAGC	179	47	yes
GATCCTCAGCTGCCCTGCCT	11	11	yes
GATCCTCAGCCCTAACCCAG	18	13	yes
GATCCTCAGCCACCCACAAC	1	1	yes
GATCCTCAGAGACGTGCTCG	20	5	yes
GATCCTCACCATCCACGTTT	113	21	yes
GATCCTCACCAGCCGCGGGC	1204	166	yes
GATCCTCAAGCGCCTCAACC	23	19	yes
GATCCAGTGCCTGTGTAGAA	45	5	yes
GATCCCTGCTCTGCAATGAG	45	2	yes
GATCCTCAACTCCTCCAAGG	18	6	yes
GATCCTCAACATCCGCCTGC	172	19	yes
GATCCTCAACAAGATGCTAT	39	15	yes
GATCCTCAAATCAGGCAACC	12	12	yes
GATCCTATTGAGTTGCTAAG	4	7	yes
GATCCTATTCTTAGGTCTAA	92	21	yes
GATCCTATTCTCCAAAGACT	13	0	yes
GATCCTATTCCAGCCAAATG	54	42	yes
GATCCTATTCAGTGGCACAA	8	2	yes
GATCCTATGTGTTGGCCATT	209	9	yes
GATCCTATGTGGCTCTAAAA	86	23	yes
GATCCTATGTAGCCCAGGCT	18	6	yes
GATCCTATGGTGATTCCAGT	11	6	yes
GATCCTATGGCATATGCAAG	6	2	yes
GATCCTATCTCCCGGTTGGG	142	10	yes
GATCCTATCATTGCTGGTGG	239	51	yes
GATCCTATCACCAGCACTGA	29	14	yes
GATCCTATATTTCCTGCTGA	18	8	yes
GATCCTACTTTGGGAACATG	12	8	yes
GATCCTACTGTGGATGACAC	1186	149	yes
GATCCTACTGATGAAGTGCC	181	68	yes
GATCCCTGAGGCTGCCTCGA	5	4	yes
GATCCAATACCAGCTAGTGG	84	18	yes
GATCCCTCTGCTGCTGCTTC	5	4	yes
GATCATAGTGTAGGTCCCAC	13	7	yes
GATCCCTCTCCCAGGAACAA	14	11	yes
GATCCAAGCTGTCAAGAAGG	891	86	yes
GATCCAAGCTCCATTGTACC	23	9	yes
GATCCCTCCCAGAAGAATCT	7	6	yes
GATCCAAGCAGCCTTCAGGG	2	2	yes
GATCACCGGCTTGGTTCTCT	4	1	yes
GATCCTACGGAGCAAGTCTA	96	24	yes
GATCCTACCTTCTGCTTTCG	100	30	yes
GATCCTACCTGAGTGGCAGC	1294	127	yes
GATCCTACCATCCCTTTGAT	136	8	yes
GATCCTACCACAGAGCCTTA	198	17	yes
GATCCTACATCCATTCGGCT	48	18	yes
GATCCTACAGTGGCTGGCAA	338	41	yes
GATCCTACAGTCACTTCACA	84	22	yes
GATCCTACACTCCTGGCAGT	18	0	yes
GATCCTACACATGGAGGCTG	113	12	yes
GATCCTACACACCTACCAGA	32	7	yes
GATCCTACACACAGTGGTGA	399	69	yes
GATCCTACAAGCCTGTCCGT	54	14	yes
GATCCTACAAAGGTCTTGAA	5	2	yes
GATCCTAAGCAGATTCTGGG	87	10	yes
GATCCTAACTGTGGAACCTC	7	1	yes
GATCCTAACTCTGACCTTTC	94	7	yes
GATCCTAACTAAGCACATGA	5	8	yes
GATCCTAACCTAAGATGCCT	27	15	yes
GATCCTAACCCTGAACCCCA	53	22	yes
GATCCTAACCCAGTGGACTC	53	4	yes
GATCCAAGACATGGGCGCTA	4	3	yes
GATCCCGTTGAAGCACGGTG	4	4	yes
GATCCCGTGTCCTGCAGACG	65	7	yes
GATCCAACACCGGCGGCCAG	25	24	yes
GATCCTGTCCGAGAGGCGCG	53	5	yes
GATCCTAAATTTGACCCAGG	85	27	yes
GATCCTAAAGTTCTTTCAGG	43	4	yes
GATCCTAAAGGCCGGTCACA	953	191	yes
GATCCTAAACTCTGTTGCCA	10	5	yes
GATCCTAAACTCCAAGGGGA	197	60	yes
GATCCTAAAACTGAGGAAAG	7	2	yes
GATCCTAAAACCAAGGGAAT	113	25	yes
GATCCTGGAGCGAACGCGGG	21	21	yes
GATCCGTTTGGCCTCTCAAT	6	5	yes
GATCCGTTGGAAGGTTTACC	18	1	yes
GATCCGTTGCCTCCTTAAAG	16	25	yes
GATCCGTTGCCAGTTACCTG	296	43	yes
GATCCGTTCCTAGGGTACCT	148	29	yes
GATCCGTGTGTTGTTAAGAT	10	8	yes
GATCCGTGTGTGTGTGGGAG	710	65	yes
GATCCGTGTGAAGGTCCCAT	43	18	yes
GATCCGTGTGAAACTGGATG	2108	186	yes
GATCCGTGTCAACCCCTTTT	21	11	yes
GATCCGTGTATGTCTAAACA	12	19	yes
GATCCGTGGCTGCAGCAGAA	99	14	yes
GATCCGTGGAGAAACTTGCC	6	10	yes
GATCCAAAGGAGCTACTTAG	98	8	yes
GATCCCGGAAGGGGAGAAAG	20	5	yes
GATCTCTGATGCCGAGGCTG	4	5	yes
GATCCGTGCTGAGCGTCGGC	232	19	yes
GATCCGTGCTGAATTGGTTT	76	23	yes
GATCCGTGCATCTCATTGGC	104	12	yes
GATCCGTCTGTGGGGGCCTC	2	2	yes
GATCCGTCGCCTGGAGGTGG	89	15	yes
GATCCGTCATCTCCAGGACA	3	4	yes
GATCCGTCAGTGGTCAGTGC	8	2	yes
GATCCGTCAGGCTTGCTCGT	39	17	yes
GATCCGTCAAGCTAACTGGA	36	6	yes
GATCCGTATCAGGTTCATGT	13	21	yes
GATCCGTAGTCTGAGTGATG	127	12	yes
GATCCGTACCCTGGTGCTGA	111	8	yes
GATCCGTAAGAAAGAGAAGG	47	37	yes
GATCCGGTTCTGGGACAGCA	23	16	yes
GATCCGGTCCCAAGACCGCT	1490	89	yes
GATCCGGTCCAAGGCTCTTG	89	5	yes
GATCCGGGTGTCCAGTGACA	884	43	yes
GATCCGGGTGATGCGAATCG	14	6	yes
GATCCGGGGGTTCAATTTAT	116	80	yes
GATCCGGGGGAAATTGGGAT	1	1	yes
GATCCGGGGCACACATTCTC	67	13	yes
GATCCGGGCAAAGCCTGCTC	459	43	yes
GATCCGGGAGTGCTGGACTT	19	30	yes
GATCCGGGAGGTGTGCGGCT	1529	224	yes
GATCCGGCTGTGCCAGGTGT	4	7	yes
GATCCGGCTGGGCCTGGCTC	132	19	yes
GATCCCCTTCTACGTGACCA	43	9	yes
GATCCCCTGGTCTCTCCCGT	3	3	yes
GATCCCCTGGGAGGTACGGA	3	2	yes
GATCCAAAAAGCAGTTCAAC	21	10	yes
GATCCCCTCCGTTGGCCCGG	67	7	yes
GATCCGGCAGAAGGATGAGG	297	23	yes
GATCCGGATGAAACATTGTC	25	39	yes
GATCCGGACTCACCTGGGAG	77	61	yes
GATCCGCTTGGCAGCCATTC	383	70	yes
GATCCGCTTCGTGGAATGGG	42	11	yes
GATCCGCTTACAGAGACTTT	419	22	yes
GATCCGCTGTCAGGAGCTGA	8	7	yes
GATCCGCTGCAACCCGGTGC	51	4	yes
GATCCGCTCTGTGGTCGCCT	44	7	yes
GATCCGCTCTGAGGTTCTGT	206	26	yes
GATCCGCTCCTGGCGACTCC	239	15	yes
GATCCGCTCAGAGCCCAGCA	225	14	yes
GATCCGCTCACGCCCAGCAG	241	54	yes
GATCCGCCTTCTACTCGGAA	16	5	yes
GATCTTGGTTAGGCGAGGAA	9	5	yes
GATCCGCCGCTAAGACCTGG	203	43	yes
GATCCGCCCTGTGAGTCACC	26	10	yes
GATCCGCCCACACCCACGTG	234	42	yes
GATCCGCCAAGTTATTCAGG	2	2	yes
GATCCGCATGATGGGAGGAG	45	15	yes
GATCCGCATCCGCAAGCCCT	133	12	yes
GATCCGCAGGTCAGATGACA	25	4	yes
GATCCGCAGCTTTTCCAGCA	257	20	yes
GATCCGCAATTATGAAGAAC	32	4	yes
GATCCGCAAGGTGCTGGACG	280	51	yes
GATCCGCAAGGACTTCTTAT	5	4	yes
GATCATTTCGGGCCAGTAGG	57	53	yes
GATCCCCGCCCGTGGACTGC	2	2	yes
GATCCAGACAGCCATCAAGG	66	13	yes
GATCCCCGAAGTCTCTCTCC	16	3	yes
GATCTATGGGGCAGGGTTGG	18	20	yes
GATCCCCAGGACACTTTGCT	34	2	yes
GATCCGCAACTGTCCGGAAG	66	5	yes
GATCCGATTTCTGATTTTGC	57	5	yes
GATCCGATTGAAGCCTCAGG	62	54	yes
GATCCGATGGGCCAGCCTTT	248	108	yes
GATCCTTTTATTTCACCGGG	7	5	yes
GATCCGATGAGGAAGATGAC	154	3	yes
GATCCGAGTGAAAGCCGGAG	1357	113	yes
GATCCGAGGCTAGAGGGAGC	208	13	yes
GATCCGAGGCAGATTTTCTT	48	20	yes
GATCCGAGCGACTGTCACCA	111	13	yes
GATCCGAGCCTCACTACCTG	1	1	yes
GATCCGAGCAGCCACATTCC	11	18	yes
GATCCGACAGGAGGGTGTAA	883	97	yes
GATCCGAATAAACCATTCTT	8	2	yes
GATCCGAACTTCACCCTAAT	27	4	yes
GATCCACTGCAAATCAGTCT	5	8	yes
GATCTGCAAGGCCTAATTAC	43	0	yes
GATCCCTCTCTAAGCCCCTT	2	2	yes
GATCACAGCTCCTGTGGCTG	10	5	yes
GATCTCTGACGGCTTCTCGA	14	15	yes
GATCTGCTTCCTGAAGAGTG	11	11	yes
GATCTGCTTCCCATTGTGGT	280	25	yes
GATCTGCTTCCCAACTGTTA	43	9	yes
GATCTGCTTCCATCCATCTC	8	3	yes
GATCTGCTTCATTATTTCAC	6	5	yes
GATCTGCTTATCCCATTTAG	16	19	yes
GATCCTAGCTCAGAGAGGCT	269	19	yes
GATCTGCTGTTCCTCACGAA	16	1	yes
GATCTGCTGTGGCACAGGGC	28	3	yes
GATCTGCTGTCTACTACCTA	55	6	yes
GATCTGCTGTAGCATCAAGC	39	8	yes
GATCTGCTGGTCATTAAGGG	695	102	yes
GATCTGCTGGCAGTAGTAGT	128	3	yes
GATCTGCTGGAAGATAATCT	13	10	yes
GATCTGCTGGAAGAAACACA	25	5	yes
GATCCTTCTCTTGTTGGCCT	3	4	yes
GATCTGCTGCCTGCTCCCAC	177	18	yes
GATCTGCTGCCAGGTTTTGC	29	12	yes
GATCTGCTGCAGGGTTCTGT	260	56	yes
GATCTGCTGCAGCTAAAGTA	48	4	yes
GATCTGCTGATGTTACGTCG	16	15	yes
GATCTGCTGATGATGGAACA	8	5	yes
GATCTGCTCTTGCTAATAAC	129	16	yes
GATCCCCAACACCCACCCTC	44	6	yes
GATCCAAGTCCAGGAACCCC	3	3	yes
GATCTGCTCTCAAAAATTCC	16	5	yes
GATCTGCTCTAACCAGGCGT	4	5	yes
GATCTGCTCCTTCTGTCCCA	190	16	yes
GATCTGCTCCTTAACGTTTT	6	4	yes
GATCTGCTCCTGGAGGTGGT	7	3	yes
GATCTGCTCCTGAGTGCTGT	8	1	yes
GATCCCTACAAGACAAGCGC	12	3	yes
GATCTGCTCCCAAGTTATCT	22	5	yes
GATCTGCTCCAACTACAGGA	142	24	yes
GATCTGCTCAGTGACTTGTG	101	5	yes
GATCTGCTCACTCTATTACT	36	12	yes
GATCTGCTCAACAACTCCTT	6	6	yes
GATCTGCTATGTACTCCAGG	120	11	yes
GATCTGCTAGAGCTGTAATA	69	5	yes
GATCTGCTACTGGAGATGTT	36	6	yes
GATCTGCGTATGGCGGCCAT	2008	144	yes
GATCTGCGGTGACTTGATGT	2160	197	yes
GATCTGCGCTATAGAAAAAA	41	7	yes
GATCTGCGCCTGCCTTGTCT	56	16	yes
GATCTGCGCCTGAGCCAAAG	195	9	yes
GATCTGCGAAGCCAGGCTTC	48	10	yes
GATCTGCCTTGGATTTCCTC	47	2	yes
GATCTGCCTGTTACCTCTTC	64	14	yes
GATCTGCCTGTCACTGTGGC	16	4	yes
GATCTGCCTGAACGTGTGTA	16	11	yes
GATCTGCCTCAGGAAAAATA	5	4	yes
GATCCTGCTCACAGAATCAC	2	2	yes
GATCCTGCAGCACGTTATCG	30	5	yes
GATCTGCCGCAGTAAGCGAG	2	0	yes
GATCTGCCCTTTCTGGGTGA	387	34	yes
GATCTGCCCTTGCACCCGGC	47	19	yes
GATCTGCCCGAAGCCATGAG	13	3	yes
GATCTGCCCCATGGTGTTTT	73	20	yes
GATCTGCCCAATCCTTCCTC	12	8	yes
GATCTGCCATGGAGGAATCT	30	36	yes
GATCTGCCAGTTTTGGTGCC	151	24	yes
GATCTGCCAGTCCGAGGTTC	643	86	yes
GATCTGCCAGGACAAGCTGG	80	7	yes
GATCTGCCACTTGTTTTAAT	33	26	yes
GATCTGCCACTGCTTCTCTA	68	18	yes
GATCTGCCACAGCAAGAGTG	54	2	yes
GATCTGCCACACAGTAGACT	117	19	yes
GATCTGCCAATGGTGCCGTT	23	2	yes
GATCTGATTGCCTTCATGGA	13	12	yes
GATCTGATGTTCTGTGTTTT	73	12	yes
GATCTGATGTTCTCTTCTGG	111	29	yes
GATCTGATGTCCACTTCTGG	84	12	yes
GATCTGATGTCAGTCGTGGT	7	5	yes
GATCTGATGTATGCCAAGCG	306	32	yes
GATCTGATGGTCCACTCTGC	4	4	yes
GATCTGATGGGTTTCTGGCT	78	20	yes
GATCTGATGCCTTCTGGTGT	70	7	yes
GATCTGATGCCTGTTAAGCA	1	1	yes
GATCTGATGCCCTTTTGTGG	39	37	yes
GATCTGATAGTCAAGTGTAT	48	20	yes
GATCTATCCTAGCCGGGAGG	1208	161	yes
GATCTATCCCATCTAGTGGT	50	54	yes
GATCAGTCTCCATCAGACTT	21	19	yes
GATCTGAGTGGGTGGGGGGT	115	125	yes
GATCTGAGTCCTCACACTGG	91	72	yes
GATCTGAGTCAGGAATAGTT	3	4	yes
GATCTGAGGGTTGATTGACA	3	4	yes
GATCTGAGGCCTTGTTTTTT	185	110	yes
GATCTGAGGAGCAGATGATG	57	61	yes
GATCTGAGGACAGTTTTCAT	9	10	yes
GATCTGAGCTTTGTATAACA	3	4	yes
GATCTGAGCTGCCCTCTGCT	42	12	yes
GATCTGAGCCTCCACCTGTG	245	88	yes
GATCTACTGTGAAAAGCATG	70	76	yes
GATCTCAAAACCTTGCACAG	60	7	yes
GATCTACTCCCGGGCCCAGC	98	24	yes
GATCTTTGCCAAAATGTGTG	40	3	yes
GATCTTTGAGGTGCTAAGTT	31	1	yes
GATCTATGGATTTTGAGGAG	20	21	yes
GATCTTTCGGAGGAGATGTC	53	11	yes
GATCTATACAGTCGGGAAAC	638	23	yes
GATCTGAGCCCCACTGTTCC	2	2	yes
GATCTGAGCCCAGATGGAAG	32	5	yes
GATCTGAGCAGGTGAAAAGT	110	12	yes
GATCTGAGAGCCGTGGTGCC	96	55	yes
GATCTGAGAGAGGAAACCTT	17	19	yes
GATCTGAGAAGATGTGGATG	68	34	yes
GATCTGACCTGTCCCAGCAA	2	2	yes
GATCTGACCTCTCCTGGCAC	14	14	yes
GATCTGACCTCGGAGTGTGC	59	22	yes
GATCTGACCAACAAGACCAC	83	11	yes
GATCTACCGTAATGGCTCCA	9	9	yes
GATCTACCACCCTAACATCG	43	2	yes
GATCTTTCCAGAAGGTCTTC	28	4	yes
GATCTACACATGGGGCAACC	1518	14	yes
GATCACTGACTGCCCCAAAC	44	14	yes
GATCTACAATGAAGCTCTGA	45	49	yes
GATCTAGGTTCAGAGTTCAG	26	19	yes
GATCTAGCTTCCTGGGAGAC	14	17	yes
GATCTTTACAAGTCTGGCAC	28	11	yes
GATCTTGTTTGTGTCTCTGC	15	10	yes
GATCTTGTTGGGAAACTAAT	6	5	yes
GATCCTGAACAACCTTCTAC	5	0	yes
GATCTTGTTGCCAATGGTAC	53	49	yes
GATCTGAATTTCTTCCTCTT	87	18	yes
GATCTGAATGTCCGAGAGAG	246	82	yes
GATCCTCTGGGGAAATGGAC	3	4	yes
GATCTGAATGCTGCAATGAA	5	4	yes
GATCTGAATGCTCTGGGGGC	229	35	yes
GATCTGAATCTACTTGTGAA	3	4	yes
GATCTGAAGTCTGAATGGCA	22	16	yes
GATCTGAAGTATCTGTACAG	11	9	yes
GATCTGAAGCTGCTGATGAA	61	21	yes
GATCTGAAGATTTCCCTATC	65	7	yes
GATCTGAACTCCAGAGAACA	58	52	yes
GATCTGAACCTGCCTGGAAA	17	13	yes
GATCTGAACACCCAGCGAGG	26	32	yes
GATCTCTTTTGGTGTGTCTG	5	4	yes
GATCTCTTTTGCCAAGAAGT	70	8	yes
GATCTCTTTGTGTTCAAGAC	14	1	yes
GATCTAATTGCAGTGGTTAA	122	9	yes
GATCTACGCACGCATCAGCA	131	8	yes
GATCTTGTCTCAAAAAGCAA	24	7	yes
GATCTACCCTGACTCAGGTT	50	3	yes
GATCTTGTATTCTCTGGCTT	28	9	yes
GATCTTGTACAAACCGGTTT	29	8	yes
GATCTACAGTGCATCGAGCG	4	2	yes
GATCTTGGTGGAGTGGGTCT	23	25	yes
GATCTCTTTGCCCTTGCACT	36	4	yes
GATCTCTTTCTTGTTCCCCC	282	93	yes
GATCTCTTTCTGAGACCTTT	18	18	yes
GATCTCTTGTGAAACGAAAC	74	3	yes
GATCTCTTGTCTGTAACTCT	2	3	yes
GATCTCTTGAGTGTTTGAGG	1	1	yes
GATCTCTTCTCGCGCTCTCC	26	21	yes
GATCTCTTCCATGTTACAAG	18	1	yes
GATCTCTTCAGAAGGGCACT	23	4	yes
GATCTCTTCACTGTTTTTCT	94	6	yes
GATCTTGGGGAGTTTGACTG	15	16	yes
GATCTTGGGCTCTGCCATAG	47	51	yes
GATCTTGGGAAGCAAGAAAC	24	26	yes
GATCTTGGCTCTGTGGAATG	386	23	yes
GATCTTGGATGCAGACTCGG	48	52	yes
GATCTTGGAGGCTGAGTTGC	14	15	yes
GATCTTGCTTTGTGACTTTT	3	4	yes
GATCTCTTACCAGTTTACAA	4	3	yes
GATCTCTGTGTTCAGGCTCT	9	6	yes
GATCTCTGTGGGCCTTTGGG	25	7	yes
GATCTCTGTGCTGGCGCCTG	215	8	yes
GATCTCTGTGCGCCTTCCTG	3	3	yes
GATCTCTGTGAGCCTAGGAG	8	9	yes
GATCTTGCTTCAGCCAACGC	2128	372	yes
GATCACGATGGCTATGGCGC	54	13	yes
GATCTTGCCCCTGCCAGTGG	280	121	yes
GATCACCTTTTTTGACGAGT	21	19	yes
GATCTTGCATCCGCCAGCCA	5	6	yes
GATCTTGCAGGACGTTCTCT	22	15	yes
GATCGTTTCAAAGCCAGAAG	2	2	yes
GATCGTCTGCTGTGAAACGT	185	16	yes
GATCGTCCCCAAAATTGCCT	67	9	yes
GATCACCGTACAGCTGGACA	86	20	yes
GATCGTCCAGAGTCACTCAA	55	19	yes
GATCGTACGGGGCTGGAAAC	60	4	yes
GATCGGTGGGACCCGGGCGA	544	81	yes
GATCGTGGGCTTCAGCACCC	239	46	yes
GATCACCTCACAGGAGACAA	25	4	yes
GATCTTCTGGTTCTCTTGCC	7	7	yes
GATCGGTCTGAGATGACTCC	77	12	yes
GATCACACTGAAGATGCCTC	91	1	yes
GATCGGCTTTGAGAGAGGGT	15	16	yes
GATCACCGGTTTCCGACTGA	2	1	yes
GATCGGCCAGTTCCAAGTTT	5	0	yes
GATCTTCGTCCCCGACCATC	35	11	yes
GATCTTCGAGGAGGGCGAGT	7	8	yes
GATCTCAGCCTTCAGAATGC	3	2	yes
GATCGGAATCGGAAGGAGAC	36	33	yes
GATCAGTTGACAGTGGCAAT	281	145	yes
GATCTTCCTGCCTCTGCTTC	18	4	yes
GATCTTCCTCTAGTGTCCAA	2	2	yes
GATCTTCCGAAAGTCGGTCC	48	15	yes
GATCACCAGCCTTTTGCAAA	27	12	yes
GATCGGCGGGAAATGGCGGA	75	6	yes
GATCGGCGCCGTGAGATTCG	377	15	yes
GATCTTTGCTTCACTGAGAG	4	6	yes
GATCTTTGAAGAGCAGGGAA	28	30	yes
GATCAGGTTTCGACTGGCGT	2	2	yes
GATCGCTCATTGGAACAGCT	1418	44	yes
GATCCGCTGCCGCCCCCTGC	5	5	yes
GATCTTCCCAACAGTGCTGC	10	11	yes
GATCGCCCTTGCTGGTCTGC	96	15	yes
GATCTTCCAAGTCTCTCATT	15	16	yes
GATCGGAGAACCGAACTTGC	5	4	yes
GATCGTGGCGCCCACGCTTG	3	3	yes
GATCTTCAGCCTCTTGGGGA	90	20	yes
GATCTTCACTCACGTCCGGC	94	8	yes
GATCGCCTGCTAGTGCGGGA	1	1	yes
GATCTTCACCGGAAGGTGCA	281	59	yes
GATCGCCTCTCAGTGCTGGT	2	3	yes
GATCTTCACAGTGCATGGCT	6	5	yes
GATCTTCACACACAGCAGAT	10	8	yes
GATCTGTTGGTGCTGCTACT	8	9	yes
GATCAAAAGGGACTCGTGTA	142	2	yes
GATCCGCTGTACAGTCTGCC	55	11	yes
GATCTCTTTTCAGAAGTGTC	158	20	yes
GATCTCTTGTTTTGTGTTGT	2	2	yes
GATCTGAGCCGGTCGAGCCC	46	20	yes
GATCACTGGAGAGCCTCATG	6	7	yes
GATCCCTCCGTTTCACCTCT	32	7	yes
GATCCCCAAAACCCAGGTAA	1	1	yes
GATCATGTTCACAACGCAGG	39	12	yes
GATCTCTGTGCTGTAAACTA	59	5	yes
GATCTCCCTGAGGGTGTGGA	3	4	yes
GATCGCCAGCCTCTGTGTGT	4	3	yes
GATCCCTTTTCCATTCTGGA	130	8	yes
GATCCCTTTGGGGTGTGGAA	730	53	yes
GATCCCTTTCTCTGGCCCAG	1054	158	yes
GATCCCTTTCCACCTAAAAC	52	18	yes
GATCCCTTGTGAGCCCTAGT	80	9	yes
GATCCCTTGTCATGGTTTGG	19	10	yes
GATCCCTTGTAGCCAGAGTT	199	8	yes
GATCCCTTGGGCAAGTATCA	81	7	yes
GATCCCTTGCTTGCCTCTTG	172	34	yes
GATCCCTTGCTTCAACCTCC	14	10	yes
GATCCCTTGCTACATCTCCT	283	4	yes
GATCCCTTGCCTCCTGAGTT	91	18	yes
GATCCCTTGCAGTTCTGTGC	88	15	yes
GATCCCTTGCACACAGCCCA	635	34	yes
GATCCCTTCTGCTCTACCTC	5	5	yes
GATCCCTTCCTTTGAAGTGA	29	21	yes
GATCCCTTCCTGCCCTCTTT	349	14	yes
GATCCCTTCCTAGGGATTGG	33	4	yes
GATCCCTTCCCCAGCGGTTC	215	27	yes
GATCCCTTCCAGCTGAGCCC	92	25	yes
GATCCCTTCCAAATCTGCTC	25	4	yes
GATCCCTTCATTGGGGACCC	72	4	yes
GATCCCTTAGGTGTAGGTCC	3	4	yes
GATCCCTGTTTGGACATCAG	4	3	yes
GATCCCTGTTTCTGCGGAGA	1	1	yes
GATCCCTGTTCCCCTGAGAA	22	19	yes
GATCCCTGTGTTCTACATGG	29	5	yes
GATCCCTGTGGTCACTTAGC	79	12	yes
GATCCCTGTGGATTTTGAAA	13	6	yes
GATCCCTGTGAGTTCAAGGC	76	52	yes
GATCCCTGTCTGATTTCTGA	1	1	yes
GATCCCTGTCTCGGGAGGTC	2	2	yes
GATCCCTGTCTAGTCCCTGT	105	12	yes
GATCCCTGTCCTTTCTGTTT	6	8	yes
GATCTTGCTGCTGTAGGAAG	22	15	yes
GATCATGGGTTGGGAGCTCA	196	32	yes
GATCTTGCCAAAGGAGTGAC	6	6	yes
GATCATGGGCAAAAAGCCCG	989	92	yes
GATCAGGAGCTGGAGAGGAA	99	70	yes
GATCCCTGTACACTATGTCT	31	8	yes
GATCCCTGGTTGCATCTTCG	38	11	yes
GATCCCTGGTGGCTGCCCTT	477	64	yes
GATCCCTGGGTGCCAGTTTT	253	22	yes
GATCCCTGGGGTCCACTTTC	2	3	yes
GATCCCTGGGGGCTGTGATG	82	30	yes
GATCCCTGGGGCTGCCTGTC	826	127	yes
GATCCCTGGGGCATGTTGTA	126	20	yes
GATCCCTGGGGAGCCTGCGG	7	6	yes
GATCCCTGGGAGGATATGAG	11	2	yes
GATCCCTGGGAACGAAGCTG	18	3	yes
GATCCCTGGCTCAGTGAACA	38	11	yes
GATCCCTGGCGTCCCTATCA	367	21	yes
GATCCCTGGCCCCTGTGCCA	132	1	yes
GATCCCTGGCCAGAAGTACA	10	7	yes
GATCCCTGGCACTGCTGCCT	47	13	yes
GATCCCTGGCACCCAGCATC	65	5	yes
GATCCCTGGAGTGACCAGAG	2893	161	yes
GATCCCTGGAGTCTCTGAAG	61	15	yes
GATCCCTGGAGGCTGGAGAG	88	20	yes
GATCCCTGGAAGCTGTGATG	6	5	yes
GATCCCTGGAAGCAGGGACA	291	75	yes
GATCCCTGCTTTTGTGGCCT	719	43	yes
GATCCCTGCTTCCTGCCCAG	339	32	yes
GATCCCTGCTGTTGGCAATA	13	10	yes
GATCCCTGCTGTGGGCCTTC	4	3	yes
GATCCCTGCTCTTAGGTGCT	75	7	yes
GATCCCTGCTCTGGACCCTC	473	25	yes
GATCCCTGCTCCCCTCTGGG	222	33	yes
GATCCCTGCTCCAGGTCCTC	178	29	yes
GATCCCTGCTAATGGAAGAA	32	0	yes
GATCCCTGCCTGTGGGGGGT	285	28	yes
GATCCCTGCCTGTCCTGAAA	51	6	yes
GATCCCTGCCTCGTCTGCCT	269	23	yes
GATCCCTGCCGAGGTGCTCA	327	30	yes
GATCCCAGGGACTCTGTTTT	5	0	yes
GATCATGGCTTTGAGGCCAG	21	6	yes
GATCATGGCGGTCAGCAGAA	62	11	yes
GATCATGGCAGTGGGAGACC	65	4	yes
GATCATGGCAGGGATACGCA	16	10	yes
GATCATGGCAGGCCTTTAAC	51	16	yes
GATCTTGATGCGGGTGGAAC	134	24	yes
GATCGCCATCTGTTTCTGCC	3	0	yes
GATCCCTGCCCTTTGGCCTG	120	20	yes
GATCCCTGCCCATGCTGTTC	7	6	yes
GATCCCTGCCACCTCATTGG	35	24	yes
GATCCCTGCATTTCCTCAAG	137	29	yes
GATCCCTGCATAGGACTGTT	27	4	yes
GATCCCTGCAGTACCATCTG	215	19	yes
GATCCCTGCAGGTCGCTCAG	48	18	yes
GATCCCTGCAGCGCTGTTTG	265	35	yes
GATCCCTGCAGAAGGGGGGT	8	6	yes
GATCCCTGCACAAGGTGTTT	156	19	yes
GATCCCTGCAACAGCAAGGG	97	15	yes
GATCCCTGAGTTTACCAGCG	38	7	yes
GATCCCTGAGTTCAAGGCTA	66	31	yes
GATCCCTGAGTTCAAGGCCA	46	38	yes
GATCCCTGAGTAAACTTCTT	13	4	yes
GATCCCTGAGGTCTCCTGCC	310	29	yes
GATCCCTGACATAGCAGGAC	68	18	yes
GATCCCTCTTCTGGTGTGTC	105	19	yes
GATCCCTCTTACCTGCAACG	580	36	yes
GATCCCTCTGTACAGCATCC	28	11	yes
GATCCCTCTGGTGACTCCAC	83	22	yes
GATCCCTCTGGGTCATGTCT	272	6	yes
GATCCCTCTCTTCAATGATG	6	2	yes
GATCCCTCTCTCTGGGGAAT	109	13	yes
GATCCCTCTAAGCCCCCTCC	98	34	yes
GATCATGCCATCGCAACTCA	13	3	yes
GATCCCACTTCTGCGTCTTA	149	17	yes
GATCCCACCTGTAACTGAGG	2	2	yes
GATCCCTCGGTGACCACATT	522	50	yes
GATCCCTCGACGGCCAAGCC	472	46	yes
GATCCCTCCTTGTGAGCAGC	205	5	yes
GATCCCTCCTGTCACTGCAG	1	1	yes
GATCCCTCCTGGGCATTGCT	78	15	yes
GATCCCTCCTCAGGCATCTG	925	42	yes
GATCCCTCCCTTGGGCCTCC	374	53	yes
GATCCCTCCCTCCGAGGCCA	675	42	yes
GATCCCTCCCCTCCCTGGCT	13	7	yes
GATCCCTCCCCACCCTGCTC	25	19	yes
GATCCCTCCCAGAAACCTGC	5961	497	yes
GATCCCTCCCACTCTGGCTC	12	5	yes
GATCCCTCCAGCCTCTACTG	68	8	yes
GATCCCTCCAGACACCAAGG	265	25	yes
GATCCCTCCACAAGATTCTG	18	6	yes
GATCCCTCAGGGTGTGTGCC	10	4	yes
GATCCCTCAGGAACAGAGGG	469	42	yes
GATCCCTCACCTCCTTCATC	362	28	yes
GATCCCTATGCTGACCCCAA	46	9	yes
GATCCCTATGAAGTGTCTTA	1	1	yes
GATCCCTAGTGGCCCATCAT	35	2	yes
GATCCCTAGGGAGAAGGTGG	349	21	yes
GATCCCTAGCCCCATCCCAA	12	8	yes
GATCCCTAGCATTCTGTACT	171	12	yes
GATCCCTAGAGCCAGCACAT	24	8	yes
GATCCCTACTGCACCACCTT	160	41	yes
GATCCCTACTCGTTTCAACA	4	5	yes
GATCCCTACTATTGATTCTG	120	26	yes
GATCCCTACTACGTGCTGGA	2096	26	yes
GATCCCTACCTACAACCCTA	178	15	yes
GATCCCTACCCCCCATCCTC	3	4	yes
GATCCCTACCCCACATGCTG	336	49	yes
GATCCCTACCCATGGGAATG	127	10	yes
GATCATGAGCTGGAGGCACC	46	11	yes
GATCATGAGAAAGCTCAGGT	44	37	yes
GATCATGACCATAGAGCTCC	16	11	yes
GATCTTCGGTGCCACCGGCA	18	21	yes
GATCATGACATTGTAGCCAG	2	1	yes
GATCATGACAGTCCCCCCAC	48	17	yes
GATCCCAAGTGGCACTGTTT	9	2	yes
GATCCCTACCCATGGACCCT	367	73	yes
GATCCCTACCACCTGCCCGA	17	5	yes
GATCCCTAATGAGAGCAGAG	103	16	yes
GATCCCTAAACTACCTCTTG	90	5	yes
GATCCCTAAAAGCTCCAAGA	2	3	yes
GATCCCGTTTGTGAAGCCTG	127	9	yes
GATCCCGTGGACTGTTTGCT	22	7	yes
GATCCCGTCCAAGGAGCATC	781	27	yes
GATCCCGCGAGGCCCGGAAG	1615	155	yes
GATCCCGCCTGCCCAGCTGA	215	40	yes
GATCCCGCCGTTCCACCCTC	279	32	yes
GATCCCGCCAAAAGAATTAC	213	38	yes
GATCCCGCACATCCACAAGT	170	32	yes
GATCCCGAGATTGCCAGCCT	818	101	yes
GATCATCTGCTAGGGTGTGG	2	3	yes
GATCCACAAACTTCCTGACA	40	8	yes
GATCCATTGCGTAGCTGTCC	4	5	yes
GATCCCGACACCAAGGAGAT	2467	137	yes
GATCCCGAAAACCAGAACTT	24	10	yes
GATCCCCTTTTTGAACAGGT	288	21	yes
GATCCCCTTTCTTTACCTTC	24	4	yes
GATCCCCTTTACCTTCTGGG	1023	45	yes
GATCCCCTTGGTTGCTGGAT	459	22	yes
GATCCCCTTCTCAGGGTCTA	329	14	yes
GATCCCCTTCCTACCTCTAG	179	31	yes
GATCCCCTGTTGACTTACAA	77	14	yes
GATCCCCTGGGTTGAGAGAT	4	3	yes
GATCCCCTGGGGCAAGCTGC	203	35	yes
GATCCCCTGGGAGGAGACAG	338	27	yes
GATCCCCTGGCAAGAAGGAA	5	4	yes
GATCCCCTGGATACATGGTC	212	17	yes
GATCCCCTGGATAAAAGCGT	69	4	yes
GATCCCCTGCTACACTGATG	80	13	yes
GATCCCCTGCCTCCACCTCC	10	12	yes
GATCCCCTGCCTCAGCTCCT	98	21	yes
GATCCCCTGCAACAGACATT	2	3	yes
GATCCCCTCTTCCCAAATAA	11	8	yes
GATCCCCTCTGGGCCTCCGA	142	9	yes
GATCCCCTCTCCTGCCCACA	4	4	yes
GATCCCCTCGGACCCCCTTG	714	37	yes
GATCCCCTCCTTTCTGCCTG	2	3	yes
GATCCCCTCCTCCAGGCAGT	227	36	yes
GATCCCCTCCCTTGCTTTCT	98	11	yes
GATCCCCTCCCAGGCTGTCC	4	3	yes
GATCCCCTCCCACAGAATAG	3474	82	yes
GATCCCCTCACATGTGCTAT	101	37	yes
GATCCCCTATGGGGAGGAGG	632	69	yes
GATCCCCTATGCAAGCTGTG	90	7	yes
GATCCCCGTTGTACCTGGTG	162	18	yes
GATCCCCGTGTGTTTGCAGG	91	17	yes
GATCCCCGTGCCCCTGCCTA	511	38	yes
GATCTTTCTCTAGGGGGTCC	82	23	yes
GATCATCCCCTGGCAAAGGC	17	0	yes
GATCTTCACTGCAGATGTGG	97	12	yes
GATCATCAGACTGCTAGGAA	2	2	yes
GATCAAACTGAATGAAACAC	28	3	yes
GATCCCCGTCTGTGTCTGTG	423	31	yes
GATCCCCGGTGCTCTTCGTG	425	47	yes
GATCCCCGGGAAAGTGTAGT	8	5	yes
GATCCCCGGAAGCTTCACTG	11	5	yes
GATCCCCGCAGAATCAGGAA	169	11	yes
GATCCCCGCAAAGTGAGCGA	16	1	yes
GATCCCCCTTTGCTGCCTCC	10	7	yes
GATCCCCCTGATGGAGAGAA	4	2	yes
GATCCCCCTCCCTGCTCTCA	7	5	yes
GATCCCCCTCCCCCGCTGGC	28	26	yes
GATCCCCCTCCCCCCAGTGG	1424	1134	yes
GATCCCCCCCTTTTTTTGTC	85	12	yes
GATCCCCCCCAGCACACTCT	40	5	yes
GATCCCCCCACCCCACCACC	650	353	yes
GATCCCCCCAACTGTGTGCC	33	9	yes
GATCTCTCTGACATCCCAGC	2	2	yes
GATCCCCCAGGTCTCAGAGG	265	12	yes
GATCCCCCAGGGAAAGACTT	7	6	yes
GATCCCCCACCTCCTCGGCC	2	2	yes
GATCCCCCACATCCTGGGGC	252	7	yes
GATCCCCATTTGCAGTAAGA	35	14	yes
GATCCATCCACCTTCAATGT	20	4	yes
GATCCCCATGTTGAGCTCTG	156	33	yes
GATCCCCATCTGCAGTACAA	7	3	yes
GATCCCCATCTGACTCAGTA	113	12	yes
GATCCCCAGTCTTTAGTCCC	484	35	yes
GATCCCCAGTATGCAGTAAT	2	1	yes
GATCCCCAGGGGCTCCCGGT	162	21	yes
GATCCCCAGGGAGGGAATGT	35	15	yes
GATCCCCAGGAGATGAGGTC	1	1	yes
GATCCCCAGCTGGTAGAAAT	1	1	yes
GATCCCCAGCCTTGGATAGT	222	10	yes
GATCCCCAGCCCAATCTTTC	2	2	yes
GATCCCCAGCATTAGGCCAT	117	14	yes
GATCCCCAGCAGTAACACTT	6	6	yes
GATCCCCAGCACAGGAAGGC	62	43	yes
GATCCCCAGAGTCCCCTGTG	770	55	yes
GATCCCCAGAGCCTTGGGGA	178	20	yes
GATCCCCAGAATCCCCAATA	1	1	yes
GATCCCCACTTTTGTGACTT	8	10	yes
GATCCCCACTGTGCCTTTTT	229	30	yes
GATCCCCACCAGCCACCCCC	658	28	yes
GATCCCCACAGGTGTAGTCT	4	3	yes
GATCCCCACAGCTGCGTATG	482	30	yes
GATCCCCAAGTCTGTGACAC	122	17	yes
GATCCCCAACTCCTGCCCAG	3	3	yes
GATCCCCAACAATGTGAAGA	686	10	yes
GATCCCCAAAGGGCAGGTCC	21	14	yes
GATCCCCAAAGCCTGGAGCC	390	33	yes
GATCCCCAAAGAGCCAAAGG	16	3	yes
GATCATACCCACGTTGCCCA	16	4	yes
GATCATAAGTTCAAGGTCTT	12	9	yes
GATCATAAACCTTGCCTGGA	29	8	yes
GATCAGTTTGTGCCCAACAG	10	0	yes
GATCCCATTTTTGACAGCAA	79	8	yes
GATCCCATTGGAGCTCTGTT	38	14	yes
GATCCCATGTTCAAGCTGGT	550	94	yes
GATCCCATGTGTCTTTTTGC	32	9	yes
GATCCCATGTGTCTCCCCCA	265	11	yes
GATCCCATGTGCCACCATCA	348	35	yes
GATCCCATGTCCTGCTTTCT	217	24	yes
GATCCCATGCTTTGAAAAAT	44	6	yes
GATCCCATGCTAGCCTCTTG	308	17	yes
GATCCCATGCCTGGAATTTG	14	0	yes
GATCCCATGCAGAGCGGCCT	59	21	yes
GATCCCATGAATCATTTGCC	62	16	yes
GATCCCATGAAATCCCCAAA	42	9	yes
GATCCCATCTCCTGGAAGGA	188	15	yes
GATCCCATATCCCTGTGAAA	45	4	yes
GATCCCATACCTGACATGAC	29	9	yes
GATCCCATACAATGCCGCCC	40	23	yes
GATCCCAGTTTGCTTCATGA	38	9	yes
GATCAGTTTCTAAGATTGCC	6	1	yes
GATCAGTTACTTACCCACTC	30	28	yes
GATCCAAACTTCTACAGCAA	42	4	yes
GATCCAGGTGTGAGATGATG	3	3	yes
GATCCAGGGGGTGTGGCTGC	2	3	yes
GATCAAGGCCACGGGGAGGA	181	27	yes
GATCCCAGTTCATAATGAAC	7	7	yes
GATCCCAGTGTTGCTACGTG	107	13	yes
GATCCCAGTGTGAATCATGG	79	8	yes
GATCCCAGTGGTATTCCGCC	66	15	yes
GATCCCAGTGGATGAAGTGT	79	11	yes
GATCCCAGTGCTGTGGAAGT	115	11	yes
GATCCCAGTGCTGGTCAGTT	267	8	yes
GATCCCAGTGAGATGCTGGT	24	17	yes
GATCCCAGTGAAGGGTTTCT	122	15	yes
GATCCCAGTCTGAGTGATTA	71	13	yes
GATCCCAGTCCTCCTGGGCA	69	13	yes
GATCCCAGTCCGAAATGGGG	154	10	yes
GATCCCAGTACTTGGGAGGC	385	45	yes
GATCCCAGGTGTCCCCATTT	40	6	yes
GATCCCAGGTGGAGCAACCC	224	37	yes
GATCCCAGGTCCCTCTGGGA	190	21	yes
GATCCCAGGGGTCCTAGGGG	62	12	yes
GATCCCAGGGGGCTGGATGT	3	4	yes
GATCCCAGGGGCTCTTCTGC	47	0	yes
GATCCCAGGGAAAGTGCTAT	339	13	yes
GATCCCAGGCTCCACCAGCG	113	10	yes
GATCCCAGGCTAGCAAGCAA	339	45	yes
GATCCCAGGCGTCAAGCTCG	12	6	yes
GATCCCAGGCAAGGGATGGT	175	14	yes
GATCCCAGGAGTCAAGCTCT	32	7	yes
GATCCCAGGAGAGAGGCTTC	43	8	yes
GATCCCAGGAAGGACCATCA	111	45	yes
GATCCCAGGAAAGTTCTAAT	76	18	yes
GATCCCAGCTGGAGAAGCCC	45	8	yes
GATCCCAGCTATGATGTAGC	33	4	yes
GATCCCAGCGCTTAGCCACC	8	7	yes
GATCCCAGCCCTGGCTCCCC	367	30	yes
GATCCCATTTGGGAGGACTT	1	1	yes
GATCCTCTTTGACTTCACGT	341	14	yes
GATCCTACTATGAGCAAAAA	25	24	yes
GATCCATAACTCCAAAGCCA	24	3	yes
GATCCCACAGTGTCCTCTGG	3	3	yes
GATCGGCTCCATGAGCGGTC	10	7	yes
GATCACTCTTGTACAGTTGG	18	4	yes
GATCACTAATGGGATGGGTT	3	1	yes
GATCCTCAAGTTCCTCAAGT	1	1	yes
GATCTCTGTCTTTCCCTGGT	169	3	yes
GATCTCTGTCACATCCGATG	221	136	yes
GATCTCTGTATGTTCGAGCC	333	104	yes
GATCTCTGTAAACAGTTTGG	50	27	yes
GATCTCTGGGGCAGACGGTG	9	10	yes
GATCTCTGGGCAGTCATGGT	52	56	yes
GATCTCTGGCTCTTCATCCT	53	16	yes
GATCTCTGGCCTGTGGAGTA	322	16	yes
GATCTCTGGCCAGGCAAGTT	89	36	yes
GATCTCTGGATGGAAATGTA	24	26	yes
GATCTCTGGAGGTCCCGGTG	33	36	yes
GATCTCTGCTGTGGGAAAGG	1741	73	yes
GATCTCTGCTGTCGGTTTCT	25	11	yes
GATCTCTGCCCCAAATCCAA	97	12	yes
GATCTCTGCCCAAACCAGGC	418	58	yes
GATCTCTGCCACCCACCCAC	224	54	yes
GATCTGGGCGTGGTGGCACA	33	1	yes
GATCTCTGCAGCTGGAGTCT	61	66	yes
GATCCGAGTGTCCCCTCTGC	16	1	yes
GATCCCTGGGGGTGGGGAGG	37	10	yes
GATCACAGTCTAGGTCTAGG	1	1	yes
GATCTCTGCAAGCAGTTGTC	60	17	yes
GATCTCTGCAAAATAGACTT	27	3	yes
GATCTCTGATGGCTGGGGAG	70	34	yes
GATCTCTGAGCGTGTGGGTC	7	7	yes
GATCTCTCTTGTTGGAAGGA	54	8	yes
GATCTCTCTTCCCAGAGGAA	836	101	yes
GATCTCTCTGCTCATACCCT	31	7	yes
GATCTCTCTCCTTGGCCTTC	120	17	yes
GATCTCTCTCATCGAGAGCA	35	25	yes
GATCTCTCGAGCAGCAGCAG	35	32	yes
GATCCGGCCTGTGCTGCTGC	16	11	yes
GATCTCTCCCCAGAGCAACG	18	17	yes
GATCTCTCCATATCAAGCGA	2649	226	yes
GATCTCTCCAAGCTCACAAG	2	2	yes
GATCTCTCACTGGACCAGCG	47	14	yes
GATCTCTCACAGACCTGGTC	1	1	yes
GATCTCTCAAATCTTGGATT	5	4	yes
GATCTCTATCCTAACGTCCA	7	11	yes
GATCCCAGTGGCATCATCGG	9	5	yes
GATCAAGATAACGGTGGCTT	207	9	yes
GATCCGGGCCTGGATGTGTA	4	4	yes
GATCTCTACTTTGGAGTCCT	25	18	yes
GATCTCTACTGGCAGGCCAT	231	45	yes
GATCTCTACTGCTGTTAGGT	45	14	yes
GATCTCTACTCCCAGGAGAT	127	27	yes
GATCTCTACCACCCAGGTAG	716	76	yes
GATCTCTACAGACAAAATCT	4	7	yes
GATCTCGTTCATTGGCAAAA	36	33	yes
GATCTCGTGCAACTGTTGTC	427	28	yes
GATCTCGGTTTCGTTTCGCT	83	26	yes
GATCTCGGTGTCATCAGAGG	20	21	yes
GATCTCGGTCTGTGCCGGGG	395	44	yes
GATCTCCTTTGTGAATGGTG	37	3	yes
GATCTCCTTTCCGGAAGCAA	83	6	yes
GATCTCCTTTATTCTGCCCT	5	4	yes
GATCTCCTTGGGGAGGTGGG	13	10	yes
GATCCCACTGTCACCCTCGC	3	4	yes
GATCCATGAGAATGAGAAGC	2	2	yes
GATCTCCTTGGAGTCTCAAG	846	301	yes
GATCTCCTGTGTTCGTCTTT	25	19	yes
GATCTCCTGTCTGAGGTGTC	18	12	yes
GATCTCCTGTCTATGTGGGC	164	29	yes
GATCTCCTGGAAGCTAGCAG	18	12	yes
GATCTCCTCTTCGGGGTTCT	24	2	yes
GATCTCCTCGCTGGAAAAAG	29	4	yes
GATCTCCTCCTTGCTTTCCT	9	2	yes
GATCTCCTCCTTATTCCCCA	449	36	yes
GATCTCCTCAGAGAAGTCTG	26	2	yes
GATCTCCGTCCCTCAGCTCC	578	94	yes
GATCTCCGCGGCCCGAGTGC	11	9	yes
GATCGCAGAGAGGCGAGAGC	240	27	yes
GATCTCCGCACTGTGTGTAC	412	38	yes
GATCTCCGAACAGCAACACG	5	6	yes
GATCTCCCTTTGTACTGTCT	7	11	yes
GATCTCCCTCTTGGAGGCCA	18	14	yes
GATCTCCCTCGTGCAGTGGC	56	38	yes
GATCTCCCGTGTTACCAATG	51	55	yes
GATCTCCATTCTGGAGCTGA	33	13	yes
GATCCTTTCAACTCAAAAGC	7	7	yes
GATCCTTGGTGTAGCTTCTG	105	127	yes
GATCTTAGGCAAGTTCTTGG	36	39	yes
GATCTTAGAGAAAGGCCAAC	204	123	yes
GATCTTAGACAGGCGATGTG	36	39	yes
GATCGCAGCACTGAAAACAA	2	3	yes
GATCTCCATGCTAGGTGTGT	13	9	yes
GATCTCCATCTTCCAAATAC	6	4	yes
GATCTCCATCGTGCAGGGAT	79	20	yes
GATCTCCAGTCCAAGGCTTC	18	14	yes
GATCCAGAACTCCATTTGGA	8	6	yes
GATCTCCAGCTTCTCTGCCT	15	3	yes
GATCTCCAGCACAGCAGAGG	69	6	yes
GATCTCCAGAGTCGCTTGGA	1	1	yes
GATCTCCAGACCGTTCCACT	4	4	yes
GATCTCCAGAATAGACCTGG	46	44	yes
GATCTCCACTTTCTACAACA	97	12	yes
GATCTCCACGGGTGCTTAGT	55	9	yes
GATCTCCACATCTCCAAGGA	11	9	yes
GATCTCCACATCCTAACCCT	18	2	yes
GATCTCCACAGGCCAGCCTT	62	20	yes
GATCTCCACAGCGTGTTCAT	1	1	yes
GATCTCCACACAACAGGTGA	76	6	yes
GATCTCCAATGTTGTGCTAA	6	4	yes
GATCTCCAACTTTGAAAGGC	28	44	yes
GATCACAGCAGTAAATGTGA	145	21	yes
GATCACAGCAGCTGAGCTGT	427	18	yes
GATCACAGATTTAAGGGGAG	58	15	yes
GATCACAGATTGCTTCTCTG	7	1	yes
GATCACAGAGAACACAGAGG	18	6	yes
GATCACAGACTTCGGCCTTG	35	2	yes
GATCACAGACTGTTGGCCCC	185	18	yes
GATCACAGACACCTGCACTG	53	49	yes
GATCACAGAAGTGAGCGGAT	105	8	yes
GATCCTTCTGCAGACACCGA	106	6	yes
GATCCACCACCCAGAGTAAT	75	21	yes
GATCCTTCTGACTTGGCTTT	12	1	yes
GATCCTTCTCAGAAGAGTCT	172	32	yes
GATCACACTTCCCACAACCC	98	35	yes
GATCACAGGGAGCCTGTGTT	107	46	yes
GATCTTAAATGGCGTAGTAT	180	23	yes
GATCACAGCAGAGATGGCCA	96	11	yes
GATCTCATTGTTCTTGGAGA	18	3	yes
GATCTCATTCCCGAGAGAGG	76	6	yes
GATCTCATGTTCCTTTACAC	8	8	yes
GATCTCATGTGTGGGAACCA	47	7	yes
GATCTCATGTCTCTGGAGGA	93	7	yes
GATCCCCTTGGGCCCAACTG	39	7	yes
GATCTCATCCAGTCTGCTGT	69	6	yes
GATCTCATCACAGGAGCATC	5	4	yes
GATCTCAGTTTGAGTGGATG	82	12	yes
GATCTCAGTTTCGCTGATGT	21	22	yes
GATCTCAGTTCTGTGTTTAC	23	25	yes
GATCTCAGTTCACGGGGTGG	107	39	yes
GATCTCAGTTCAACAGCTCC	382	197	yes
GATCTCAGTGTGGAGAGCAT	7	7	yes
GATCTCAGTGCTGGGGAGGT	79	125	yes
GATCACACTGAGCAACACCC	46	6	yes
GATCACACGGCAAAACAGTA	81	36	yes
GATCACACCTTGCTGTTCCC	38	1	yes
GATCACACCTGTCCCTACAC	2099	166	yes
GATCACACCTGCCCCAGTGG	21	13	yes
GATCACACCTGCAGTTTGGG	16	1	yes
GATCACACCGTTTCTTCCTA	5	1	yes
GATCACACCGAGATTCTTTT	1	1	yes
GATCACACCGAGACCAGTGG	150	15	yes
GATCACACCATTGAGTTCCG	120	3	yes
GATCACACCAGTCCTGTGAG	39	19	yes
GATCACACCACCGTGTCAAA	5	5	yes
GATCACACCAAGCCCCAGGA	54	12	yes
GATCACACATTTGCAAGGGA	286	48	yes
GATCACACACTCAGTCCTTG	82	26	yes
GATCACACACGGCAACCGAC	36	13	yes
GATCACACAAGTGTGGGTTT	42	7	yes
GATCACACAAAACTGTCAGC	1702	142	yes
GATCACAATCTAGTCAATGC	4	4	yes
GATCACAATCAGGAACTCAC	35	0	yes
GATCACAAGTTTGAGACCAG	29	7	yes
GATCACAAGTTAAGGTCAGC	11	2	yes
GATCACAAGTGCAGCATTCT	78	35	yes
GATCCTTCATGTTGAGCCAG	150	44	yes
GATCACAAGGCTGAAAACAA	6	5	yes
GATCTGTTGTTTGCGTTGAA	15	16	yes
GATCTGTTGGTGGTATAGGC	32	0	yes
GATCCTTGACTCTCAAGCCC	43	23	yes
GATCCTTCTGTCGGCTTCCT	8	2	yes
GATCTGTTCAGCACACCTGA	737	134	yes
GATCTGTTACTTTGGCGAGG	929	100	yes
GATCTGTGTGTCATCAGATG	52	3	yes
GATCCTTCTCTGCCCTTCCC	37	4	yes
GATCTGTGTGGGACCAAGGC	58	62	yes
GATCTGTGTGGCTCCTCTGC	23	22	yes
GATCCTTCCTTTCCCTTGGC	200	25	yes
GATCCTTCCTTCTTCTCTTC	58	11	yes
GATCTCAGTAACTGTCGAGC	94	41	yes
GATCTCAGGTGTTTGGTCAT	2	3	yes
GATCTCAGGGTTCCCATGGT	15	10	yes
GATCTCAGGATTTGTTGGGG	24	26	yes
GATCTCAGCTTGCATAGCAT	396	25	yes
GATCTCAGCTCCACTGTGAA	15	10	yes
GATCTCAGCTAAACTTTCAA	17	14	yes
GATCTCAGCCATAGTCGTTG	2413	126	yes
GATCTCAGCACTGTGGCTGT	414	43	yes
GATCTCAGACAGCTCTGTGT	23	25	yes
GATCTCACTGTTTGCTAACA	14	11	yes
GATCTCACTGTTTCATGCTG	100	9	yes
GATCTCACTGCCTCCCTCTC	117	2	yes
GATCTCACTCAGCAACAAGT	59	12	yes
GATCTCACGGGCCGACCGAG	17	19	yes
GATCACAAGAGGCCCGTTTG	53	49	yes
GATCACAAGAAGTTAGTTTG	8	2	yes
GATCACAACTTCTGAAACAC	57	9	yes
GATCACAACTGTAGGGAATA	107	19	yes
GATCACAACTGATTCCTGCT	5	4	yes
GATCACAACTGAGCCTACAG	57	13	yes
GATCACAACGGCTTGCGTGT	269	21	yes
GATCACAACCCTGATGGCAG	1030	24	yes
GATCACAACCCCCAAGTCAG	61	9	yes
GATCACAACCCAGATGAAAT	67	3	yes
GATCTGATGGAGATTGGGAA	10	2	yes
GATCACAAATACAGATTCTG	142	5	yes
GATCACAAAGTTTGAGAATG	1549	25	yes
GATCACAAAGGTGGAATGTT	135	12	yes
GATCACAAAGAACAAGTGTA	5	4	yes
GATCACAAACTTCTGCAAAA	3	3	yes
GATCACAAACATCACAGAAG	18	2	yes
GATCACAAAAGGCTGTTTTG	3	4	yes
GATCAATGGGCAGCAGCAAT	31	34	yes
GATCTGTGTATACCCCACTC	172	49	yes
GATCTCTAAGTGTAAGTCAA	3	3	yes
GATCTGTGGACGACGAGAAC	149	28	yes
GATCCTGTGTGTTCCCTTCT	54	7	yes
GATCCTGTGTGAGCAGATTG	2	2	yes
GATCCTGTGGCTAATCCTGT	1	1	yes
GATCTGTGCGATGTTGTGGC	4	2	yes
GATCTGTGCCATCCCATACA	286	27	yes
GATCCTGTCTCCCGTGGACA	11	3	yes
GATCTCACCCTGTAACACCT	7	6	yes
GATCTCACCCCTGGGACATT	8	10	yes
GATCTCACACGAACTAGAAA	8	2	yes
GATCTCACACAAGCTGGGGA	14	17	yes
GATCTCAATTTTTTGGTTAC	3	4	yes
GATCTCAATGAAAGAGGACT	98	66	yes
GATCTCAACTGACTCCTCTT	382	80	yes
GATCTCAACTCTGCTCTAGT	19	13	yes
GATCTCAACAAGATGACCTT	3	4	yes
GATCTCAAACTCAGAGGTTT	1	1	yes
GATCTATTTTTTCTTGCGAT	31	1	yes
GATCTATTTTCCTAACCGTT	12	11	yes
GATCTATTTTACAAGTGCAT	102	17	yes
GATCAATGCAATGACGTGGG	403	50	yes
GATCAATGAGGCCTTTGCAA	494	117	yes
GATCAAGTCCGGGAACTCTC	426	35	yes
GATCAATCTTCTGGTTCATC	20	4	yes
GATCCTGGGTACTGCACAGT	1197	166	yes
GATCAATCCAGGAGTCTCTG	254	44	yes
GATCAATCACATGGACACTA	68	1	yes
GATCTAGCCTTCCGTGACAG	3	4	yes
GATCCTGGCGCCCATGTTTC	13	9	yes
GATCTCCAGTTCCTTGCTTT	43	11	yes
GATCCTGGGGTTGGACCCCA	31	34	yes
GATCCTGGGACATAATCACC	39	10	yes
GATCCTGGGAAGCCTCCTCA	101	18	yes
GATCTGTCTCAACAGTCTGG	76	24	yes
GATCTTCCAGTTCTTACCCG	57	19	yes
GATCTGATTCTAGAGCACTT	3	3	yes
GATCAATAGGGAAACACAGG	290	250	yes
GATCCTGGAAACCCTGAAAC	1	1	yes
GATCCTGCTTGGGAGGAGGA	66	15	yes
GATCAATAAAGTGGGTTTTT	5	4	yes
GATCCTGAGGCAATGTGAGC	44	24	yes
GATCCTGCGGGTGGGAGGAA	12	12	yes
GATCGCGAAAGTGGGCCAGA	3	3	yes
GATCAAGTTTGTGGTGTGTT	7	3	yes
GATCAAGTTTCAGGAAGGCT	197	56	yes
GATCAAGTTTCACATCCTTC	33	5	yes
GATCCTGCATATCTCAAAGA	39	10	yes
GATCCTGCATACCAACGGCC	2	2	yes
GATCCTGCAGCAGGAGTGCA	234	19	yes
GATCTGTCCTGATGAAGGCT	456	51	yes
GATCTGTCCTCAGAGCCCGA	2	2	yes
GATCCTGCAAACTTCCCTGG	155	28	yes
GATCCTGATTTAGGAAGTGT	42	8	yes
GATCTGTCCATCTTGGAGTT	12	3	yes
GATCTGTCAGTGTTATGGAA	32	7	yes
GATCTGTCAGCTGTGCTCTC	28	26	yes
GATCCTGCCAGCCAGACCAA	125	17	yes
GATCTGTAGGCGAGGGAATC	12	12	yes
GATCCTGCAGACACTCAGAG	54	2	yes
GATCTCTGCTTTGCTAGGGG	29	4	yes
GATCAAGTTGAAAGAGTGTG	172	15	yes
GATCAAGTTCAGTGCGCAGG	7	11	yes
GATCAAGTGTTTGCAGGACG	32	12	yes
GATCAAGTGTGACCCAGAAA	6	5	yes
GATCAAGTGTCGGATGGAAT	51	4	yes
GATCAAGTGGATTCGGCGGT	130	15	yes
GATCAAGTGAGCTGTATCAG	32	30	yes
GATCAAGTCTTGTCAGTTTG	32	9	yes
GATCCTGAGTGGCTTGCTAG	33	10	yes
GATCAAGTCGTGCTTCTGGC	1958	70	yes
GATCAAGTCCTTTGTGAAAG	374	44	yes
GATCAAGTCCGAGGTCCCCC	35	2	yes
GATCCTGAGGAGTCAAATAT	6	2	yes
GATCCTGAGGAAGGCCAGGC	229	40	yes
GATCAAGTACTACTGTTGGC	32	23	yes
GATCAAGGTGTTGCCTGGTG	460	37	yes
GATCAAGGTCCTAAAATTTC	42	29	yes
GATCAAGGTCCAGGTGGAAG	16	3	yes
GATCTGGTTTTAAGTGCCTC	130	15	yes
GATCCTGAATGGGCAAGAGT	45	14	yes
GATCCTGAAGCTCTGGCTGA	61	57	yes
GATCTGGTGGGGTTACTGGG	12	12	yes
GATCTGGTGCTGATAGGAAG	13	14	yes
GATCTGGTGATGTGTGAGAC	27	12	yes
GATCTGGTATGAACATCGGC	332	20	yes
GATCTGGGTTTGTCAACAGG	19	14	yes
GATCTGGGTTGTGAGGAGGT	23	16	yes
GATCAAGGTCCACTTAGTGG	51	37	yes
GATCAAGGGTTCCCTTCCAA	43	37	yes
GATCAAGGGGTTCTCGCGCT	131	47	yes
GATCAAGGCTTTCCTCGGGC	2	2	yes
GATCAAGGCTCCCGGTTTTG	1330	94	yes
GATCAAGGCCTTTCTGTCCT	354	45	yes
GATCAAGGCCCACTGTGGAG	18	10	yes
GATCAAGGCCACTGTGTAAC	22	0	yes
GATCCTGAAAGACCGGGAAA	15	5	yes
GATCAAGGATTGAAGGAATG	57	1	yes
GATCAAGGAGGTAGATATGG	550	176	yes
GATCAAGGAGGCTGTTGCTG	114	12	yes
GATCAAGGAGGAAGTGTTGT	58	11	yes
GATCAAGGAGAGAAGCAGGA	68	6	yes
GATCCTCTGGCAGATGTTTG	70	9	yes
GATCAAGCTTAGCAGTCAAG	359	51	yes
GATCAAGCGGGCTTTCCTTA	528	54	yes
GATCTGGGTGGGACAGTCAC	12	12	yes
GATCCCTTTGGTGCCCCTGA	7	3	yes
GATCTGGGCTGAGCTTGGTT	18	3	yes
GATCTCGCAGGAGAGGAGAG	2	2	yes
GATCTGGGCACCCACTGCCT	13	10	yes
GATCTGGGATAAGGAGAGCG	59	31	yes
GATCAAGCCCTTCTTCCATT	297	18	yes
GATCAAGCCATCCATCAACT	396	29	yes
GATCAAGCATCATGATGCTC	54	1	yes
GATCAAGCAGTTTCTGGAGT	14	1	yes
GATCAAGCAGTAGAGTTTTT	7	7	yes
GATCAAGCAGCGAGAGGCTG	838	337	yes
GATCAAGCAGCAGCACGGGG	29	27	yes
GATCAAGCAGAACCTGGAGA	165	9	yes
GATCCCGCGCATCGACTACG	2	3	yes
GATCAAGAGGATTTGGATTT	5	4	yes
GATCCTCCTGCACCATGCCT	5	5	yes
GATCCTCCTCACTTAGCACC	37	12	yes
GATCAAGACTGTGACTTTTG	16	13	yes
GATCAAGACTCTCCTGGAGA	12	8	yes
GATCAAGACGCCTGTCATTT	27	25	yes
GATCAAGACCCTCCAGAGGT	20	17	yes
GATCAAGACCACCACTGCAT	76	71	yes
GATCCTCCCAAAAGCCATCT	50	4	yes
GATCAAGACAACCAAGGCTA	32	19	yes
GATCCTCCAGCTCCATCAGC	17	19	yes
GATCAAGAACAGAATGGGCT	8	8	yes
GATCCTCACTGGCAGCAGCT	149	17	yes
GATCCTCACCCTTTTCAGAA	9	2	yes
GATCCTCACCCACCTGCTGG	251	52	yes
GATCTGGGAAAATGGCAGTT	37	40	yes
GATCTGGCTTTTGTTTTCCA	4	5	yes
GATCTGGCTTTACTTCTCTG	27	3	yes
GATCTGGCCTGAGCCTGTCC	76	15	yes
GATCTGGCCGAATGGTAAAA	229	28	yes
GATCTGGCCCTTTTGTCCTT	54	36	yes
GATCAACTTTTTTCCCCCAA	10	12	yes
GATCAACTTTCAGCTGGGAA	2970	295	yes
GATCAACTTGCTGGGACCTA	485	254	yes
GATCAACTGTGCAGACAACA	1117	337	yes
GATCAACTGCTACGATGTGT	15	2	yes
GATCAACTGCGACATCTAGG	29	15	yes
GATCAACTGAGGTCTTTCTT	48	31	yes
GATCAACTCTTTGTTTTGGC	38	4	yes
GATCAACTCTTGGCTTTGAC	48	49	yes
GATCAACTCTAAGTCCCCTG	40	5	yes
GATCAACTCGGTGATGGCAA	66	22	yes
GATCAACTACCTGCAGGAAG	362	28	yes
GATCTGGCCCAGGAGATGGA	1	1	yes
GATCTGGCCAACACAAGAAC	43	21	yes
GATCTGGCATAAACCCTACT	62	39	yes
GATCTGGCAGATGTGAGGTT	250	16	yes
GATCTGGCACTACTGCCGAG	10	10	yes
GATCTGGAGTAAGGGCTGTT	53	25	yes
GATCTGGAGGTGGACGGACA	42	39	yes
GATCTGGAGGTGGAAGTGGT	50	12	yes
GATCAACGCGATTTAGCTGA	6	5	yes
GATCGCCAATTGGTTCTGGG	9	8	yes
GATCAACCTGAACTTGGGAC	15	5	yes
GATCAACCTCCTGGGCTTCA	52	30	yes
GATCAACCGACAGCTGGAGG	127	136	yes
GATCCCAGCATCATCTTTGC	23	4	yes
GATCAACCACTGCAAATTCG	328	27	yes
GATCAACCACTGACCTGCCT	202	11	yes
GATCAACATGTTCGTGATGT	8	8	yes
GATCAACATGAACTGAGATT	13	12	yes
GATCAACAGCTGCCCTGCCT	107	113	yes
GATCCCCAGAAACTGAGTGT	5	5	yes
GATCATGAGTCCTGAATCAT	35	1	yes
GATCCCACTCTGCAACTACT	3	3	yes
GATCCAGGACAGCTAGGGCT	7	7	yes
GATCATACCTGGCATGTGAC	7	2	yes
GATCAGCTCCAACTATGGTG	37	14	yes
GATCCTGCGGGAGGCCTATG	39	3	yes
GATCAGTGCAAATGTTTTTG	18	17	yes
GATCAGTGAATGGGTCAAGA	46	4	yes
GATCCAGGCTCCCCTTGTCT	1	1	yes
GATCCAGGCTATCTCCTCTG	95	16	yes
GATCCAGGATGCACCACTGA	17	9	yes
GATCAGTCCTTCCCTCGAGA	23	3	yes
GATCTTCTGCCTGATGCAGT	4	3	yes
GATCAGTTTCAAGAAGCGTG	6	1	yes
GATCCCAGCATTTCTCAATT	28	4	yes
GATCCCAGCATCGGCAAGCG	105	20	yes
GATCCCAGCAGCTGTTACCT	64	23	yes
GATCCCAGCACTGCAAAAGA	66	8	yes
GATCCCAGCACACACCGTGA	190	19	yes
GATCCCAGATGATACCCACT	1	1	yes
GATCCCAGAGGAAAGGGTTT	43	14	yes
GATCCCAGAGACAATCTCAT	160	18	yes
GATCCCAGACGCCTCAAATG	8	2	yes
GATCCCAGAAGCCGCACAGG	4	3	yes
GATCCCAGAAGCACACTGGC	133	50	yes
GATCCCAGAACCATTGCCTG	90	7	yes
GATCCCACTTCACCTGTTAT	47	14	yes
GATCCCACTGCTCATTTGAC	137	23	yes
GATCCCACTAACCTGCAGTG	6	6	yes
GATCCCACGGTAGAACCTGA	226	21	yes
GATCCCACGAGCCAGAGAAC	494	69	yes
GATCCAGGAAATGCTGGAGA	1	1	yes
GATCCAGGAAAAAGTGTTTC	3	1	yes
GATCCTAGCGGACCTCAACC	31	1	yes
GATCTTCGCTTGTGCTGCTG	7	2	yes
GATCTGTCTCTTTCACGGAA	7	1	yes
GATCTGTCTCCCTTTTAGCT	13	12	yes
GATCAGGTTGTGTGAGACTG	14	13	yes
GATCTGTCCAGGGGACATTA	53	4	yes
GATCCAAGTCAGGGAGAAAG	8	9	yes
GATCCCACCTTCACCTCCCT	16	11	yes
GATCCCACCTCACGTGTGAT	525	181	yes
GATCCCACCGGTCCAGTGGA	8	2	yes
GATCCCACCGCAGCTACCAG	290	21	yes
GATCCCACCCCGAGCCTGGT	11	13	yes
GATCCCACCCCAGTAGGAAG	753	46	yes
GATCCCACCATTCTCCTTGG	312	11	yes
GATCCCACCATCCTACCTAC	36	5	yes
GATCCCACATTTCCCTTGCC	52	3	yes
GATCCCACAGGCCGGTGGAG	52	9	yes
GATCCCACAGCCAGGCTCAC	77	7	yes
GATCCCACAGATGTAGTTTG	3	2	yes
GATCCCACACTTAAGACTTC	35	10	yes
GATCAGGTGGATGTGCAGGA	31	6	yes
GATCTCATTTATTGCCACAG	18	17	yes
GATCAGGTCCTAAACATGGC	54	16	yes
GATCCAGCAGCCGAGACTGA	80	7	yes
GATCCCACACAGCAGACAGA	88	3	yes
GATCCCAATTGGTGGAAAGG	76	8	yes
GATCCCAATTCTGTCCCAAT	149	34	yes
GATCCCAATTACAACCCACT	3	4	yes
GATCCCAATGGTCACACACC	18	2	yes
GATCCCAATGCTGCCCCATC	196	6	yes
GATCCCAATGATAGATTCAA	1	1	yes
GATCCCAATGAGCCCACCTA	70	22	yes
GATCCCAATAAACCCATGAG	13	12	yes
GATCCCAAGTTCAAAGCCAG	67	7	yes
GATCCCAAGTGCTGGGAAAG	40	14	yes
GATCCCAAGTCCAACACCCA	25	4	yes
GATCCCAAGCCTCACCGGCT	52	8	yes
GATCCCAAGCCAAGAAACAC	13	7	yes
GATCCCAAGAGGAAGGGTAT	16	5	yes
GATCCCAAGAAAGGATGGAA	20	2	yes
GATCCCAAGAAACTACTTGA	338	38	yes
GATCCCAACTGTCAGTGCCA	52	7	yes
GATCCCAACTGTAACAGCAA	9	4	yes
GATCCCAACTCTGCAAGAGC	6	5	yes
GATCCCAACGTGACCATCAT	18	4	yes
GATCCCAACATTTGAGAGGC	2	3	yes
GATCCCAACATTGTTGGCAA	18	8	yes
GATCCCAACACCCATATCCA	17	9	yes
GATCCCAACACAGCGATATG	579	28	yes
GATCCCAAATTGGGTTGTCA	34	7	yes
GATCCCAAATCTGTGGTGTG	112	11	yes
GATCCCAAAGGCTCCAGGGT	47	0	yes
GATCCCAAAGCACAATGGTG	53	3	yes
GATCAGGGGCCAAGGTCCTT	74	6	yes
GATCTCATCCAAGCAAATGG	43	7	yes
GATCAGGGCTCCAGTGGTCC	25	3	yes
GATCAGGGCCTGGACTCTGG	98	10	yes
GATCCAGAGCTCCTAGCACT	105	6	yes
GATCCCAAACTGTATCCTTG	24	11	yes
GATCCCAAACTGAGGCAGCA	209	35	yes
GATCCCAAACTACTTAATAG	18	7	yes
GATCCACGTGCCTTTGTCTC	18	4	yes
GATCCCAAACAACTAAGAAT	163	21	yes
GATCCCAAAATGCTGCGGAG	198	22	yes
GATCCCAAAATAGGTGTTGA	5	2	yes
GATCCCAAAAGGGACATTGT	7	4	yes
GATCCCAAAAACCGTGCAGC	91	6	yes
GATCCCAAAAAATCTGTGCC	33	1	yes
GATCCATTTTTCTGTGACAT	2	2	yes
GATCCATTTGCTTACACTGT	13	9	yes
GATCCATTTGATGCTTCCAG	17	8	yes
GATCCATTTCTTCTGCATGA	44	12	yes
GATCCATTGTGTGGTTTAAC	82	16	yes
GATCCATTGTATGGCTTTAT	33	6	yes
GATCCATTGGTTTCTCAGTC	144	14	yes
GATCCATTCAGTGAACAAGT	15	4	yes
GATCCATCTTCTGTTTCACC	8	6	yes
GATCCATCTTCAGCTGACTG	149	14	yes
GATCCATCTCTTTCCTTCTG	8	4	yes
GATCCATCTCCTCTGGCTCT	285	29	yes
GATCCATCTCCAGCACATGC	49	9	yes
GATCTGGTCCCCTGTTCTCC	5	4	yes
GATCCAGAATGTCAGCTGGA	120	26	yes
GATCCAGAAGGGTCTCTCTC	13	12	yes
GATCAGGCCGGGGCGGCAGG	238	163	yes
GATCAGGCCCTAAAGCATTG	28	26	yes
GATCCATCGACTGTGATAGG	75	13	yes
GATCCATCCTTACTTGGTTT	2	2	yes
GATCCATCCTATCCATCCGT	67	16	yes
GATCCATCCCCGGCAAAGAG	17	4	yes
GATCCATCCCAGAGGGACTG	767	17	yes
GATCCATCCAGCAAAGAGGA	33	4	yes
GATCCATCCACCAGCAGGAG	6	5	yes
GATCCATCCAATGGCTTACC	248	21	yes
GATCCATCATAAGAAAGCTC	9	9	yes
GATCCATCAGGGCTGAGCCT	51	9	yes
GATCCATCACAGGACTATGT	32	9	yes
GATCCATCACAAGGCAAAAC	143	4	yes
GATCCATATCTTTTTGCTGT	72	11	yes
GATCCATATCACTGGATGTA	10	15	yes
GATCCAGAAACAGCAAGGCC	1	1	yes
GATCAGGAGCAGGCAACACC	475	442	yes
GATCCACTCCCTGTTCCCTT	23	10	yes
GATCCATACCCACCACTGTG	9	3	yes
GATCCATACAGCATTTTGCG	11	11	yes
GATCCATACAATTTGTGCCA	616	59	yes
GATCCATAATGGCTCAGTAT	28	10	yes
GATCCATAAGTTTGCCCAGT	23	5	yes
GATCCAGTTTTGGGAAAGGA	115	19	yes
GATCCAGTTTCTGACTCGGG	82	9	yes
GATCCAGTTGTGCAGTAGAG	7	11	yes
GATCCAGTTGGAGAGATTTG	18	15	yes
GATCCAGTTGCTCTAAGTTT	62	4	yes
GATCCAGTTCTGCTCAACTA	54	13	yes
GATCCAGTTCTACGAGCGGC	352	38	yes
GATCCAGTTCTAAAACTTGT	89	10	yes
GATCCTTGACCAGAAGTCTC	59	1	yes
GATCCAGTTACCAGAAGATG	281	64	yes
GATCCAGTGTGTTGCTGGCA	204	39	yes
GATCCAGTGTGGACCAGCTC	111	40	yes
GATCCAGTGTGCTGGTCTTT	4	6	yes
GATCCAGTGGCAGCCTCAGC	136	23	yes
GATCCAGTGCTGGGGAGATG	9	9	yes
GATCCAGTGCCTTCATCAGG	2	3	yes
GATCCAGTGCCTCATTGTTG	18	6	yes
GATCCAGTGAGAGCCAGACA	226	40	yes
GATCCAGTGACGTCAGACGC	49	78	yes
GATCCAGTCTGTCCTAGATG	15	1	yes
GATCCAGTCCTGGAGGACAG	579	9	yes
GATCCAGTCCATTCAGCAGT	8	5	yes
GATCCAGTCAGGAGTACTCA	49	19	yes
GATCCAGTCAGGACATATGA	15	13	yes
GATCCAGTCAGCCCCTGGGG	235	60	yes
GATCCAGTCAGCAGCGTGGA	23	8	yes
GATCCAGTATCTGAAAGACC	144	69	yes
GATCCAGTACTTGGTTTGTG	29	10	yes
GATCCAGTACTACCAGAATG	40	8	yes
GATCCAGGTTCAGTAAATTA	45	7	yes
GATCCAGGTTCACCACCGGG	64	4	yes
GATCCAGGTTCAATTTCCAG	183	15	yes
GATCCAGGTGTGCTGAGTGG	143	43	yes
GATCCAGGTCCGTGAACCCC	149	36	yes
GATCCAGGGTGTGCAGTGGG	817	106	yes
GATCCAGGGTGCCCCTCCAA	53	9	yes
GATCCAGGGTCCTCTGCCTG	58	4	yes
GATCCAGGGGGGACACCTGC	27	10	yes
GATCCAGGGCTCAGGAGCAC	29	9	yes
GATCCAGGGCGATGTTGGGG	167	12	yes
GATCCAGGGCCTGGTGGAGG	199	27	yes
GATCCAGGGCCACTTTGTCT	94	12	yes
GATCAGCGGCCGAATGTCCC	56	6	yes
GATCAGCGCAGGCCCCAGCC	14	22	yes
GATCCACCATCCTCTTTTTG	7	6	yes
GATCTGGCACTGCTTTAGCC	92	9	yes
GATCCACCACAGCAGGCAGG	7	1	yes
GATCAGCCTCAGTCTTCAGG	20	15	yes
GATCCTTCAGAACACTGCTG	4	4	yes
GATCCAGGCTGCGTATGAAG	11	8	yes
GATCCAGGCTCTCTATGGCA	18	4	yes
GATCCAGGCTCGGGAGCTAA	11	7	yes
GATCCAGGCTCACAGTGTGA	16	1	yes
GATCCAGGCTAAAATCCCCG	29	22	yes
GATCCAGGCGGCCCTGCCAG	13	14	yes
GATCCAGGCGGCCAAGAACT	376	68	yes
GATCCAGGCGGAGGATGACG	7	3	yes
GATCCAGGCCTCTGAACTGG	13	3	yes
GATCCAGGCCTCCCTTCTTG	47	15	yes
GATCCAGGCCTACTTCGCGT	18	4	yes
GATCCAGGCAGCTGTGTACA	26	18	yes
GATCCAGGCAGAGCTCTTCA	18	6	yes
GATCCAGGAGTTCAAAGAGG	411	88	yes
GATCCAGGAGGGGTTTGCTC	6	6	yes
GATCCAGGAGCAGGAGCTGC	11	18	yes
GATCCAGGAGCACGTGAAGA	44	34	yes
GATCCAGGACCTGGAAGTAT	1	1	yes
GATCCAGGAAGTTTTGTTGT	6	6	yes
GATCCAGGAACTACTCCACA	34	11	yes
GATCCAGGAAAGCAGCCTGT	563	69	yes
GATCCAGCTGGGTGAGGGAT	3	4	yes
GATCCAGCTGGGCGAGGATG	69	9	yes
GATCCAGCTGGGCAAAATTC	53	8	yes
GATCCAGCTCCTAAACTGTT	120	69	yes
GATCCAGCTCAGGCGGTGTC	75	0	yes
GATCCAGCGCTCTCGGGACT	65	11	yes
GATCCAGCGAGAAAGAAGAA	96	23	yes
GATCCACAGACCACCAGCCT	3	2	yes
GATCCACAGAAGACAGGCCT	3	3	yes
GATCAGCAGTCCGCGAGCTT	15	10	yes
GATCAGCAGTAGTGTTAACT	7	6	yes
GATCCTGTCCGCAGTGCACA	14	4	yes
GATCCAGCCTGAGCTCAGTG	10	5	yes
GATCCAGCCTGACCTGCACA	145	19	yes
GATCCAGCCCCTTTGTCACC	3	4	yes
GATCCAGCCCATACAGAAGA	69	11	yes
GATCCAGCCATTTGTGGGTG	8	6	yes
GATCCAGCCAGTCTCTCATT	1	1	yes
GATCCAGCAGTTAAAGCAGT	209	30	yes
GATCCAGCAGAGAGGGCAGG	8	7	yes
GATCCAGCAGAGACTCCACA	6	10	yes
GATCCAGCACCGTGTGTACC	85	28	yes
GATCCAGCACATACAAGTCT	47	2	yes
GATCCAGCAAACTTGGTTGG	58	9	yes
GATCCAGCAAAACTACTGCT	18	9	yes
GATCCAGATGATGGTTCTTT	141	5	yes
GATCCAGATACAACGCTCAC	6	5	yes
GATCCAGAGTGGCACAGGGT	197	40	yes
GATCCAGAGTGGAACTGTCC	13	15	yes
GATCCAGAGGTGTTAGCTAC	3	3	yes
GATCCAGAGCTTCTGCAAGG	14	5	yes
GATCAGCAACTCCTGCTTCA	83	6	yes
GATCCAGAGCGTGTTAACAG	2	3	yes
GATCCAGAGAGATGGGTCAG	16	16	yes
GATCCAGAGAGACTTGGTTG	70	4	yes
GATCCAGAGAACTCAGCTGT	152	36	yes
GATCCAGAGAAAGCAAAGGC	13	2	yes
GATCCAGACTTGCCTTATAA	59	11	yes
GATCCAGACGAATCTTGTCA	40	14	yes
GATCCAGACCTGCCACAGAC	100	15	yes
GATCCAGACCCGGGAAGGGA	261	30	yes
GATCCAGACACTGGCATCTC	13	5	yes
GATCCAGAATTGCTTTCCCA	225	62	yes
GATCCAGAAGTTGGGAAAAC	2	1	yes
GATCCAGAAGCAGTGGAATC	652	87	yes
GATCCAGAAGAACCTACCAC	18	1	yes
GATCCAGAACCTCTCAGCCA	18	3	yes
GATCCAGAACATTCTAGAAA	1	1	yes
GATCCAGAACAGTACAGCGT	211	62	yes
GATCCAGAACAGCGACGATG	20	0	yes
GATCCAGAACACATTAACCT	93	20	yes
GATCCAGAAAGAACGATTTG	64	20	yes
GATCCACTTGGGCTCTGTCA	100	25	yes
GATCCACTTGGAACTGGCCA	8	1	yes
GATCCAGATATGAAGGGGAG	66	17	yes
GATCGCCACCTACCGCCGCC	4	5	yes
GATCCTCAGAGTCAAGGACC	20	18	yes
GATCCCTAGACTTCATGTGA	2	1	yes
GATCTTGTGTTCTTTGTGCC	13	14	yes
GATCAAGTTTGCCGTCCATG	51	8	yes
GATCGCCTTAACTACTGTAA	3	4	yes
GATCCCAGGGGAGCTGAGGG	6	4	yes
GATCTTGCTGTTGTGGATGT	11	10	yes
GATCAACACTACGGTGCCAG	48	45	yes
GATCTTGACCTTCTCTTTGG	3	2	yes
GATCACCTTCAAGGTCAACA	25	30	yes
GATCCGTGCTTCCTGCACCC	60	7	yes
GATCCCAGACCGCCTGCAGT	4	3	yes
GATCCCCTCTGAACCCCGGG	4	4	yes
GATCCCACGAACACATATTG	5	5	yes
GATCAAGATAAGTGGGGAAG	15	14	yes
GATCTGATTTTAAGGGAAAT	100	4	yes
GATCTGAGCAGAGGGAAAAG	3	4	yes
GATCCTCACATGGAAAGTAC	33	1	yes
GATCCTCAACGAGGATGGCA	512	45	yes
GATCCTATGTTGCTGGAGCT	110	21	yes
GATCCTATGAGACCGGGGAC	65	9	yes
GATCCTAGTTAGAAGGCTGT	44	1	yes
GATCCTAGTGGGTCTACCAG	604	83	yes
GATCCTGTTCTGAAGCTGGC	5	4	yes
GATCCTAGTGCTGCTCTGGC	135	2	yes
GATCCTAGGTGTCTTCTGTT	13	0	yes
GATCTGAATGTGCCGTCTCT	30	5	yes
GATCCTAGAACTTGAGAGAA	42	51	yes
GATCCTACCGCCTTTAACAA	133	18	yes
GATCCTACAGAAGGCCCACT	68	29	yes
GATCAAGAATTTGGTGTCGA	7	11	yes
GATCCTCAACCAAGTGGAGC	52	9	yes
GATCTGGACTTCTGAATCTG	14	2	yes
GATCTGGACTGTAGGGAGAG	30	1	yes
GATCTGGTTGTACTGTCCAA	77	23	yes
GATCTGGAAGTTGGCAGATG	135	13	yes
GATCAACAAATCTCCTAGGC	26647	15792	yes
GATCAAATTGGTCTTCACCT	17	16	yes
GATCAAATTGGTACAGAAAT	8	8	yes
GATCAAATGTGCCATAGCAC	66	6	yes
GATCCGTGTCCCTGCGTGCA	262	7	yes
GATCCGTGGGCCTGGCCTCC	109	27	yes
GATCCGTGGACAGTCTTCAC	22	35	yes
GATCAAATGAGAACACTGCT	1	1	yes
GATCAAATCCAGATGCAGCA	13	12	yes
GATCTGGAAGAGACTTTGGC	4135	1173	yes
GATCTGGAACCTGGTGTGCG	27	43	yes
GATCTGGAAAGCTCTGGGGA	22	2	yes
GATCCGGGTGTTGTGCCTAA	6	4	yes
GATCTGGAAAACGCTGGAGA	10	7	yes
GATCTGCTTGCCAGGCCACT	83	7	yes
GATCAAGAATTTGGTGTGGA	4430	408	yes
GATCTGCTTCCAGGTCCTCA	76	15	yes
GATCTGCTGTCCAGAGCAAG	469	18	yes
GATCTGCTGTAGTCATTCTT	3	4	yes
GATCTGCTGCTGGTGCTTGC	42	3	yes
GATCAAATCACTGGCAGACA	69	13	yes
GATCAAAGTGAGGGAAGCGG	23	2	yes
GATCAAAGTCTCCATAGTTG	37	14	yes
GATCAAAGTCATTGCGGTTA	18	6	yes
GATCCGGGCAGCCCAGGAAA	19	14	yes
GATCCGGCCCTACTGTGTGT	126	27	yes
GATCAAAGGAAAGGGGAGGG	816	85	yes
GATCAAAGCTGGCAAGGTAC	2299	275	yes
GATCAAAGCCTACTTTTCTT	4	3	yes
GATCAAAGCCCGGAAAGGCA	1518	11	yes
GATCAAAGCCAATGGTGTGA	4	3	yes
GATCAAAGCCAAGTATCCTG	158	13	yes
GATCAAAGCAGCTGCCTTAC	2	2	yes
GATCAAAGCACGCCTGCATG	53	6	yes
GATCCGCTGTACTCTCCTCC	113	15	yes
GATCTGCTGCAGGACCTGGG	20	4	yes
GATCTGCTGACAAGACTTGA	3	3	yes
GATCCGCGAATGCTCGGAGG	1771	98	yes
GATCTGCTGAAGGAGAAAGC	125	13	yes
GATCTGCTCTCGGGCCTCGC	186	39	yes
GATCCGCAGTGGCATGTTCT	1364	25	yes
GATCCGCAGCGCCTCTTCTT	73	19	yes
GATCCCTGTCTAAGCTAGAT	18	17	yes
GATCTGCGGGTTGTCACTAG	51	44	yes
GATCCGTTGCTGACCTTGCG	66	6	yes
GATCCCAGCCCACAGGATGT	14	3	yes
GATCAAAGAGTTCAGCAAGA	125	18	yes
GATCTCCCCAAGAATTGGGA	1	1	yes
GATCAAACTGAGTCTGAAGG	360	6	yes
GATCATATCTGAGAGGGGCT	16	8	yes
GATCAAACGAGTTGTGTGTC	5	5	yes
GATCAAACCAGCCTGTTTTT	2	2	yes
GATCAAACAGTAAAGGTGTG	37	7	yes
GATCCGAGAAAGAGAGAGGC	36	4	yes
GATCCGAATGGGTCGACTGA	91	15	yes
GATCAAAATGTTTGTTGCTT	18	1	yes
GATCAAAATGTGGTGCCAGA	68	12	yes
GATCCGTGGTATCAGTGGGA	88	11	yes
GATCCCTGTGCCTAGCTGCT	23	36	yes
GATCCGTGACATCGAGGAAG	6	10	yes
GATCTGCCTGAAACCAGGGG	56	39	yes
GATCTGCCTCAGTCCACAAG	152	58	yes
GATCTGCCTATCTGTCTATC	3	1	yes
GATCCGTCACAGAGAGCAGG	3	3	yes
GATCCAGCCTCCCATTTCTA	50	10	yes
GATCCAGCCGTCCATCTCGC	5	2	yes
GATCTGCCGAAGCGGGCTTG	2	2	yes
GATCTGCCCTGTATTGTTAA	1	1	yes
GATCTGCCCCTGACCCTCCA	76	52	yes
GATCTGCCCATAAGACTTCC	12	1	yes
GATCCAGAGCCTGGGCTGTG	1	1	yes
GATCACGGCAGTGTGCAATT	3	3	yes
GATCTCAGCCAAAAGACTAA	5	4	yes
GATCAAAATGCTTGGAGAAA	10	7	yes
GATCAAAATGAGGCAGAGGA	46	3	yes
GATCAAAATCGCAGTTACTG	29	1	yes
GATCAAAATATGCTGCAGAC	61	41	yes
GATCAAAACTCAAGAAAAGG	69	8	yes
GATCCCTGGTCCTTAGGTGG	175	4	yes
GATCAAAACCTGTGACGGAG	5	4	yes
GATCCGGGGCCTCTGGAAAG	4	6	yes
GATCCGGGCGTCGGCAGAGC	4	5	yes
GATCTGCCCAAAGAAACCCT	2	2	yes
GATCTGCCAGGAACATGAGA	40	27	yes
GATCTGCCAGCCGTACATCC	44	8	yes
GATCCCTGATTGCCTCCATG	457	76	yes
GATCCCTGATGCAAAAGAGA	245	32	yes
GATCGCTCTTTTGGAGGAGG	6	4	yes
GATCCCAGGCAAAACCACAC	2	2	yes
GATCTGCAGTTCCTGGAAGG	125	2	yes
GATCTGCAGGTGCCTGGGAA	64	20	yes
GATCAGCAACTTCTGAGTGG	3	4	yes
GATCCCTCTGCAAACCAAAC	133	15	yes
GATCCCTCTCCCAGCTCTTC	129	35	yes
GATCTGCAGGAGGATGTTGA	5	5	yes
GATCTGCAGGAGGATGGTAA	31	3	yes
GATCTGCAGGAGGATGCCTG	331	2	yes
GATCTGCAGGAGCCGTTTGC	23	2	yes
GATCTGCACTCGGTACCCTC	13	12	yes
GATCTGCACAACTGTGGCCC	15	14	yes
GATCACTACTGGCACTTTTT	18	8	yes
GATCAGTGCCATGTGCTATT	23	1	yes
GATCCCTCAGTGTAGCATAG	120	30	yes
GATCCCTCAGTCTGCCGTAG	28	16	yes
GATCCCTCAGCTTTCTCCAA	115	50	yes
GATCCCTATTAAAGGCCTGC	30	7	yes
GATCTGCAAACGGGAAGGAG	5	5	yes
GATCTGATTTTGACCAAGAT	20	16	yes
GATCCCGTCAACTTCAAGCT	12966	837	yes
GATCCCGGGGGCTCCAGGAA	170	25	yes
GATCCCGGGGCAGTCCAGCC	29	8	yes
GATCCGAGTTGGGGAGCCTG	98	32	yes
GATCAAATTCCCACTGCCCC	801	222	yes
GATCTGATTCCCGCAGGTTC	175	29	yes
GATCGCAAGCAGAGTGGCTA	6	6	yes
GATCCCGGGCAATGCTTTCA	57	10	yes
GATCTTCTGTTCGGTGGTCT	16	3	yes
GATCCACCCACCTCTGCCTT	3	3	yes
GATCCCGCCCAGAGTGGAAG	3	4	yes
GATCCCCTTGGGATTAAAGG	7	8	yes
GATCTGAGTTCCCGAAGCAA	2	3	yes
GATCTGAGTGGCTAGCAGGG	4	6	yes
GATCTGTCCTTTGTGTGCAG	2	2	yes
GATCATCAGCCTGACAGAGA	14	10	yes
GATCCCCTGAGAAGCTGTAT	94	13	yes
GATCCCCGGCGTCTGTTTGA	3629	101	yes
GATCCCCCAGCCAGGCCAAA	73	4	yes
GATCCCCCAAGTTCAAGCCA	38	13	yes
GATCCCCATTGGAGCAAAGC	32	2	yes
GATCTGAGGCTGAGGGTATA	21	22	yes
GATCTGAGGCAGCGACTGAG	9	10	yes
GATCTGAGCCCCCTGAGGTT	64	1	yes
GATCCCTGGAGCCACCAGCT	84	58	yes
GATCCCTGCTTTCATGGAAG	144	25	yes
GATCTGAGAAACGGGGAAGC	180	27	yes
GATCCCTGAGAAGTTCCAGC	60	7	yes
GATCAGCTGAGCTCCTGTTT	15	14	yes
GATCTGACTCCACTGCCCAG	224	81	yes
GATCTGACGCCGAGGAGGTA	164	24	yes
GATCTGACCTGGGTCCTGAC	31	13	yes
GATCTGACCCTAGATTTCTC	22	0	yes
GATCCCTATGGACACTGACA	71	16	yes
GATCTCCCGCTGGTACTTTG	9	10	yes
GATCCGCGCTGACAAGCACA	9	2	yes
GATCAGCACCTGCATCCTGC	20	17	yes
GATCTATTTTTTCCAGCCAT	21	4	yes
GATCTATTTTTGCACTGGAA	18	15	yes
GATCTGCGGATGCCCGTACT	18	8	yes
GATCGGCACTAGCTACTCTT	2	2	yes
GATCGAGCTCAGAGGCGAAA	38	46	yes
GATCCAAGAGGACATGGACT	43	3	yes
GATCCACTTGAAACCGGGAG	65	6	yes
GATCCACTTCTTAATCCTAA	2	2	yes
GATCCACTTCAGAAGCAGCC	81	16	yes
GATCCACTGTTGTCCAGAGG	76	1	yes
GATCCACTGTCTTCCTAGAG	222	7	yes
GATCCACTGGGCCAAGGAGC	67	22	yes
GATCCACTGGCTGGATATAG	53	9	yes
GATCCACTGGAGATACAGGT	2	3	yes
GATCCACTGCTGGAAGTACC	995	44	yes
GATCCACTCTTTTCATACCC	176	36	yes
GATCCACTCGGGGGCTGTGA	52	9	yes
GATCCACTCCTGCAGAGCAC	46	11	yes
GATCCACTCCAGGCTGCGAG	192	12	yes
GATCCACTCAGACGAACAGT	100	10	yes
GATCCACTACTACCAGGGAC	33	15	yes
GATCCACTAATGCAGCTGGT	272	47	yes
GATCCACGTCTCGTCGTCAG	1127	24	yes
GATCCACGGGGCACCCGCAC	51	6	yes
GATCCACGGGCTGGAATCTG	6	2	yes
GATCCACGGACACCAAGTTA	95	20	yes
GATCCACGCAGCCATCTTGG	10	1	yes
GATCCACGACTACTTGGACA	54	7	yes
GATCCACGACAGAGTGGAGA	1	1	yes
GATCCACCTGTTTCTATCTC	2	3	yes
GATCCACCTGTGGTGCTAGT	91	4	yes
GATCAGAGCTACACAATGGC	16	6	yes
GATCAGAGCGACAGGACAGC	1	1	yes
GATCAGAGCCGCCTGACTTC	221	8	yes
GATCAGAGCATAGCCTATGT	10	10	yes
GATCAGAGCAGGAAGTTTTC	12	1	yes
GATCAGAGCAATGCTGGAGC	147	4	yes
GATCTGCTCGTGTTCCTGTC	15	2	yes
GATCATGTTCCGCCAGCGGT	11	3	yes
GATCCACCTGCTTCTCCCTT	20	10	yes
GATCCACCTGCTTCTACCTC	14	5	yes
GATCCACCTGCTGCTGCCTC	25	2	yes
GATCCACCTGCCTGTGCCTC	32	24	yes
GATCCACCTACTTTTTCAGC	10	3	yes
GATCCACCCTGAAAGTGTCT	17	8	yes
GATCCACCCCTATCTGAGAA	82	24	yes
GATCCACCCACCCTGGGCAT	89	13	yes
GATCCACCCACCCCTGCCTC	12	9	yes
GATCCACCATCTGTAATGTC	1	1	yes
GATCCACCAGTGCTTCTGCT	337	44	yes
GATCCACCAGTCCTTGAAGC	48	6	yes
GATCCACCAGGATGTTTGAT	37	8	yes
GATCCACCACATGTGCCAAA	630	74	yes
GATCCACATTTGCTGGTTTG	381	22	yes
GATCCACATTGCTGTCCTAT	4	2	yes
GATCCACATTACCATCAAGC	12	1	yes
GATCCACATGTACCATCAAC	23	8	yes
GATCCACATGCGTGTAGCAG	657	37	yes
GATCCACATGAGGAGATACT	100	4	yes
GATCCACATCTCCCTCCCCT	76	18	yes
GATCAGACAGTTAAACTGTG	13	14	yes
GATCGCCCTTCCCAACAGTT	5	5	yes
GATCCACAGTCCCTATGTGT	34	4	yes
GATCCACAGGGTACCTCCCT	119	27	yes
GATCCACAGGCAGTTGTGCC	19	13	yes
GATCCACAGGAGGGTTCCAA	25	5	yes
GATCCACAGCAAATTGAACA	7	3	yes
GATCCACAGATTCTGCCTGT	3	4	yes
GATCCACAGAAGCACTGCAG	11	5	yes
GATCCACAGAAGACCTGATT	3	3	yes
GATCCACACTGCCACTAAAA	6	7	yes
GATCCACACTAATATCGCTG	9	2	yes
GATCCACACGGAAGGGGAAA	30	8	yes
GATCCACACCTGAAATGCTA	9	2	yes
GATCCACACCCTAACTCCCA	82	22	yes
GATCCACACACGACTCTCCA	253	24	yes
GATCCACATCTTCAAATGCC	47	10	yes
GATCCACAAGTCTTAGCTGT	98	15	yes
GATCCACAAGGCCCTCATCA	1	1	yes
GATCCACAAGCGACTCATTG	1573	47	yes
GATCCACAACCTGATTCCCG	913	40	yes
GATCCACAAATGCATGGATT	46	13	yes
GATCCACAAAGTTAATGAGG	9	11	yes
GATCCACAAAGGCAGAGCCC	42	2	yes
GATCTGCCATCCCCTTCAGA	4	4	yes
GATCATTGCCAAGCCAGGCT	5	4	yes
GATCCAATCGACTGGGTTTC	444	93	yes
GATCCAATCCCTGTGCAGCA	4	6	yes
GATCCAATACTGTCTGGAAA	9	3	yes
GATCCAAGTGTTTAACCATA	50	12	yes
GATCCAAGTGCCCTTCTGCT	62	26	yes
GATCCAAGTCCAGGAACCCT	687	28	yes
GATCCCGGTCTTCTTCGCCT	1	1	yes
GATCCAAGTCATGATTTGAA	372	26	yes
GATCCAAGTCACCCCCCGAA	10	10	yes
GATCCAAGTATTGGCACCCA	14	12	yes
GATCCAAGTACACCTAAGGG	62	48	yes
GATCCAAGGTCAAGGCAGAG	214	24	yes
GATCCAAGGCCTCAGGTCAC	302	29	yes
GATCCAAGGAGTGGTACCCA	33	7	yes
GATCCAAGGACTTCTCTTCC	3	2	yes
GATCCAAGCTCTGGGAAGCA	3	4	yes
GATCCAAGCGTTACAATCGC	6	2	yes
GATCTGCCAAACGCTATGGC	66	13	yes
GATCATGTGCCTACCCTGAC	2	3	yes
GATCTTGGCTCCTGATTTTG	1	1	yes
GATCCAAGCGTGAGCCAGTC	118	9	yes
GATCCAAGCGGACAGAGTGA	5	3	yes
GATCCAAGCATTTGAGGAAT	4	3	yes
GATCCAAGCAGGCCCCTTAT	81	10	yes
GATCCAAGAGGAGGAGCACA	62	11	yes
GATCCAAGAGACCACCTTTG	64	13	yes
GATCCAAGACCAGGGTGGCT	210	38	yes
GATCCAAGAAGTCAGTCGGC	125	15	yes
GATCCAAGAAGAAAAGCAAG	115	18	yes
GATCCAAGAAAGGAAGAAGA	26	7	yes
GATCAGGTTATTTACTGGGG	1	1	yes
GATCCAACGTGTTAGCCTTG	212	9	yes
GATCCAACGAAAAACACTTG	3	3	yes
GATCCAACCCCACCTCAAGT	88	21	yes
GATCCAACATTGTCTTCTGG	2	2	yes
GATCCAACAAAGGTTGTGAG	494	30	yes
GATCACTTCCTTCTGGAATC	124	24	yes
GATCACTGTCGTGTTTGGTA	63	11	yes
GATCATGGTTCGGTGGCAAT	105	14	yes
GATCACTGGCCCCGATGGTG	40	9	yes
GATCACTGGAGCAGGCCTCC	44	3	yes
GATCATGCTTACCCTGGACT	13	16	yes
GATCATGCTGCTCCGCAATA	3	3	yes
GATCATGCTCTGGCTGAGTT	80	10	yes
GATCCAAATATTGTCATAGC	33	4	yes
GATCCAAAGTTGGCCAGCAT	209	12	yes
GATCCAAAGTCACACCTCCA	104	27	yes
GATCCAAAGGCAGCAAGAAG	73	7	yes
GATCCAAAGCTTTCCCATTT	39	15	yes
GATCCAAAGCTGCTTAAATC	119	18	yes
GATCCAAAGCTCAGGAGACA	4	6	yes
GATCCAAAGCCCCAGTAGAA	10	3	yes
GATCCAAAGCAGTGCTCCCA	113	5	yes
GATCCAAAGAGAGAAAGAGC	25	2	yes
GATCCAAAGACTCAGGTGTT	25	5	yes
GATCCAAAGACACAGTCTGT	220	4	yes
GATCCAAAGAAGACAAAATG	13	7	yes
GATCCAAACTTAACGAGCCC	79	20	yes
GATCCAAACCCCAGTGTACC	283	43	yes
GATCCAAACCCAGAGACCAA	10	7	yes
GATCCAAACAAGAAGACTGA	6	8	yes
GATCCAAACAAAGACACAAG	59	6	yes
GATCCAAAAGGTTACTGAAA	18	6	yes
GATCCAAAAGGAGACTTCTA	64	14	yes
GATCACTGCAGCCCCAAACT	36	25	yes
GATCATGCACAAACCACTAC	11	2	yes
GATCACTGAAGTGGGGCTGT	42	8	yes
GATCATGACTCTTTGAGATT	8	5	yes
GATCTTCTTGCTGGTCTTGC	123	26	yes
GATCCAAAAGCCTGCTCGGT	111	13	yes
GATCCAAAAGCAGCGTTTGC	148	6	yes
GATCCAAAAGAGCCTGATGG	84	15	yes
GATCCAAAACAGCAAATAGG	232	35	yes
GATCCAAAAATGGGGATGTT	8	5	yes
GATCCAAAAATGCTGGACTT	13	9	yes
GATCCAAAAATACAGCCTGC	17	0	yes
GATCATTTTTCTGTAGCCAT	46	11	yes
GATCATTTTTATTGTGGGGT	9	10	yes
GATCATTTTGTCGAGTGAGT	285	4	yes
GATCATTTTGTAAAGTACAG	21	19	yes
GATCATTTTCTGACTTTTGT	13	0	yes
GATCATTTTCCCAACGTTAC	22	13	yes
GATCACTCCTTGCTTTGCCA	8	6	yes
GATCATCTGCTACCCAGCAG	74	25	yes
GATCACTCAGGGTGGGCAGT	107	30	yes
GATCACTCAGGACGGTACCC	42	39	yes
GATCACTCACGAGAACATCT	2	0	yes
GATCACTGTCAGTATAGCAG	33	1	yes
GATCACTAAAGGGTTTCCTG	89	13	yes
GATCATCCTTGGAGCTGTGG	2	2	yes
GATCATTTGTCCAGGAGTGT	110	28	yes
GATCCTATTCTGAACAGACA	1	1	yes
GATCATTTGCGTTTGGAGGT	211	14	yes
GATCCCAAATGTGAAGACAG	43	10	yes
GATCATTTGAAAACTGAGAA	15	7	yes
GATCATTTCTTTCTGGCCTG	35	7	yes
GATCATTTCTCGCTCAGATT	9	9	yes
GATCATTTCGGTGACTGAAG	27	19	yes
GATCATTTCAGTGAGATTGG	6	5	yes
GATCATTTCAGGTGAGCAAT	22	20	yes
GATCATTTCACTGGTGGCTG	649	24	yes
GATCATTTAACTGGCATTTT	19	18	yes
GATCACGGCATCGAAAGGAA	30	13	yes
GATCACGATAAGCTCATCAG	11	2	yes
GATCATTGTGAACACCTCGT	21	19	yes
GATCATTGGTTGAATCGGTT	4	4	yes
GATCATTGGAGAGGGGTCTG	32	23	yes
GATCATTGCCACGGAAAACA	21	15	yes
GATCATTGAGAGCAAGCGAG	44	6	yes
GATCACCTAGATGACACTTG	47	9	yes
GATCACCGCTGCCGCCTGGG	2	3	yes
GATCACCGCCTGCACCGCAG	153	8	yes
GATCATACCCGTCCCTCTCT	4	4	yes
GATCACCCTGTCTCTTTACC	23	22	yes
GATCACCCTGGGCCTGGTCA	398	138	yes
GATCACCCTCAGCTGAAGAC	69	15	yes
GATCATACCCAAAATCTTTG	15	2	yes
GATCTGAGAGGAGTGTGTGG	1	1	yes
GATCATTCTTGGCTACATAG	6	5	yes
GATCATTCTCCAAAGGCAAC	287	50	yes
GATCATTCCCTAGCTCCTTC	4	4	yes
GATCCAGTTTTTGAAATGTC	1	1	yes
GATCATTCAGGACAAAGGAG	337	3	yes
GATCATTCACAGAACAGAGT	20	3	yes
GATCCAGACCATTGCGCAGT	2	1	yes
GATCATTAGTTCAAGGCCAA	37	8	yes
GATCATTAGGGGTTTGGTCT	104	41	yes
GATCATTAGCCCACATACCC	103	14	yes
GATCATTAGCCAGAAATCAA	79	10	yes
GATCATTAGCATGCCAGGAA	74	2	yes
GATCATTACACGGAGAACAC	54	6	yes
GATCCCGGCAGCACTCGCTC	9	1	yes
GATCCCTAGGGCTTGTGGCT	39	6	yes
GATCACTTCCGTGCCTCCTT	1	1	yes
GATCCCTTCCCTCCAAACTA	49	2	yes
GATCACCTCCTTTGATGCAT	1	1	yes
GATCCTTGTCCTCACTCTCC	11	1	yes
GATCACTATCTTGATTCAAC	24	10	yes
GATCTCTCCATATCAAGCGT	2	2	yes
GATCCACTTCCCTCTGCCTC	20	14	yes
GATCCATGACCGGGATGAGA	8	3	yes
GATCCTTCTGAATGCCTGCT	151	11	yes
GATCATTTCACTGGTGGGTG	57	53	yes
GATCCACATGATACAGGCCT	2	1	yes
GATCCTTGCAATACCCTGTC	45	30	yes
GATCTGTTTACAAGGTTTGT	91	8	yes
GATCTTGGCAAGCGGATGGC	31	34	yes
GATCCCCACTTATCTGACTT	39	13	yes
GATCTTCAACCAGTCCCGGG	4	6	yes
GATCCAAGACTTCCCAGCAG	3	2	yes
GATCCCCAATATGCTGTTGA	47	2	yes
GATCCCCAAGGCAGCTACCA	88	61	yes
GATCCCTTCTCTGACCTTTG	385	28	yes
GATCCCTCAGGATACAGGCT	11	17	yes
GATCCCAGTGGATGAGCATG	65	5	yes
GATCTGACCCACCACGGAGA	23	4	yes
GATCTGACAGGACCGCAGAG	50	12	yes
GATCCCAGCAGCAGAGCATG	7	1	yes
GATCTGACACTCTTCTGGAG	15	14	yes
GATCCCAGCACCGAGGGGAA	1019	58	yes
GATCCCGGACGCGAACCCGG	38	6	yes
GATCTGAATCTGAAATCCCA	48	24	yes
GATCTGAAGTTCAAATTCCG	9	13	yes
GATCTGAAGTCTTACAAAGC	11	1	yes
GATCCAAGCAAATTGCTTCT	1	1	yes
GATCCCAGAGCTTTGTGCAA	42	39	yes
GATCCCAGAATCCAAGAAGT	4	5	yes
GATCCCACTGCACATAGGAC	52619	4102	yes
GATCCCACGGGGTGCAGTGA	902	68	yes
GATCCCACGAAGAATTCTTC	85	11	yes
GATCCCACCTAGCAGCCACC	232	18	yes
GATCTGAAGGGGTGCCCTAT	27	29	yes
GATCCCACCCTCATCCACAG	66	1	yes
GATCCCACCACCATGTTCAG	57	11	yes
GATCAAACGGTCCCTGCGCT	32	30	yes
GATCTGAAGGAGTCCAGGGT	122	69	yes
GATCTGAACTTTGTACAGGA	46	3	yes
GATCAAACAACCCAACAGGA	5233	1748	yes
GATCTGAAAGTAGACTCTGC	119	5	yes
GATCCCAAGTTTTTCCTTAA	16	4	yes
GATCTGAAAATTCTAAACTG	14	15	yes
GATCTGAAAATCACATGAAG	5	5	yes
GATCTCTTTTCCTGACCCTC	395	13	yes
GATCCCAAAGCCTCGTATGC	58	18	yes
GATCCCCAGTCCAGGATGTG	33	2	yes
GATCTCTTCTCAGTTGATTT	83	16	yes
GATCCACAACACCCGAGTAT	4	5	yes
GATCCCCACGTGAGTATCGG	1	1	yes
GATCCATTCTGACGTGTGGA	3	2	yes
GATCCATTCGCTGTAACATG	8	9	yes
GATCCATTCCAGAGGGACAT	34	4	yes
GATCTCTCCCCCTCGCCTCT	23	8	yes
GATCCATGTTGGGGGTTGGG	170	49	yes
GATCCATGTTGACCAAATGC	40	10	yes
GATCCATGTGTTGGTTGAGA	152	34	yes
GATCCATGTGATGGACTGCA	128	4	yes
GATCCATGTCCTTTGGCTCC	221	10	yes
GATCACGTACTGTGCCTTGT	1	1	yes
GATCCCCAAGAAGTCTTATT	7	4	yes
GATCCATGGTGGGGCCATTT	57	22	yes
GATCCATGGTAGTCAGATAG	46	1	yes
GATCTCTGTGAGTTCAGGGC	16	17	yes
GATCTCTGTGAGTTCAAAGA	42	45	yes
GATCTCTGTCCGAACTGTGA	94	14	yes
GATCTCTGTCCACTGTATGC	41	9	yes
GATCCCATCCATGAATCAGG	2	1	yes
GATCATGCCTACTGTGGTTC	23	8	yes
GATCTCTGGTCTCCACAGGC	121	44	yes
GATCCAGCAACTGGATGGGG	42	5	yes
GATCCATGGGCCTTAGGGCT	79	15	yes
GATCCATGGGACTAAACAAC	5	2	yes
GATCCATGCTCTGATGAGCG	39	6	yes
GATCCATGAAGTTTTCAGTC	45	0	yes
GATCCATGAACTCTAACTCC	10	3	yes
GATCCATCTGCATTTGCGGC	3628	270	yes
GATCCATCTGCACATGGCTC	43	7	yes
GATCCATCCTCTGTCCTCTT	1	1	yes
GATCTCTGGGAAGGGCTGCG	6	7	yes
GATCTCTGCTCCCCGCCTTT	18	12	yes
GATCTCTGCTATGAGGCTAC	180	31	yes
GATCCCAGGAAGTCCCACGA	13	2	yes
GATCTCTGAGCTGCTGCCGT	5	5	yes
GATCTCTCTGTTCTCCTGTG	5	4	yes
GATCAAGTTTCAGGGCAGCC	40	4	yes
GATCTCTCTCCCTCTACACA	94	31	yes
GATCTCTCGCCTGGACCCCT	23	2	yes
GATCTCTCCATATCAAGCGG	5	4	yes
GATCTCTCCAAAGCACACGC	95	23	yes
GATCTCTCAGGCCATGGGTC	195	60	yes
GATCCAGTTTCCTCACAAAT	33	22	yes
GATCCAGTGTGGAAGAGGTG	118	13	yes
GATCTCGGTGGCCAGCTTCC	12	12	yes
GATCTCGGGAATCAGAGTTC	57	61	yes
GATCTCGGAATGGACCCCAA	395	41	yes
GATCCAGGTTGAATTCCCAG	6	6	yes
GATCTCGCCCTGTCAAGCAT	283	68	yes
GATCTCGCAGCCTTCCCCTC	222	49	yes
GATCTCGCAAGCACAAAGCC	9	9	yes
GATCTCGAGTCACAGCCAGC	57	61	yes
GATCTCGACCAGTTATACCT	9	9	yes
GATCAAAGCATGCACCTGTA	47	2	yes
GATCTCCTTTGCCGATTACA	4	4	yes
GATCTCCTTGGTCACCCTAG	11	17	yes
GATCCAGGGTGGGAAGGAAG	227	53	yes
GATCGTCTTGACTCAGCTTC	3	3	yes
GATCCAGGAGACTCGAAGAT	187	9	yes
GATCTCAGCACATGCTACCA	8	7	yes
GATCTGTGTGCTGCTCCTGG	7	7	yes
GATCCAGCTTCCCTCCGAGA	402	60	yes
GATCTATTCCTCAACCCTGT	2	2	yes
GATCTCCTGCCTAACCACTC	24	21	yes
GATCCAGCGAGGGAGCTGCC	46	10	yes
GATCTCCGCCCGAGCCTACG	143	12	yes
GATCACCAACGAGAAGCCGG	88	24	yes
GATCCAGCATGGGTGTCCCG	23	8	yes
GATCCAGCATCACCCAGACA	151	20	yes
GATCCATTTTGTTCGTGGAC	25	15	yes
GATCTCCCCTCTTCCTGGAT	189	50	yes
GATCCATTGTACTACAAGTT	1	1	yes
GATCTCCCCACCACCCCAGG	82	56	yes
GATCAGCTGGAAAACAGGCT	51	47	yes
GATCCATTAGCTTTGTCTGA	2	2	yes
GATCTCCCAATTTTCAGGTT	16	1	yes
GATCTCCAGGGTGGATTTCT	4	4	yes
GATCAGCTGCCCTTGACCTT	6	5	yes
GATCTCTGCCCAGGATGGAC	2	2	yes
GATCCTTCTCTGTGTCAGCT	8	8	yes
GATCCTGCTCACCTTGGGCT	4	4	yes
GATCTCCACACAGCACACAG	280	33	yes
GATCTCCAAAGTCCTGCTAG	42	28	yes
GATCTCCAAAATCAACAACA	88	69	yes
GATCCATATCCTGCTCCACC	1	1	yes
GATCTCATTGCTGGAAGGAG	13	6	yes
GATCCTGCTGCAAGATTTGT	48	1	yes
GATCGCCGAGGAATTTGCCA	2	3	yes
GATCAGTTCCTCTTCAGAAT	5	2	yes
GATCACCAGAAGCCATGCTC	21	19	yes
GATCATGTTTCAGGAAGGAA	32	9	yes
GATCATGTTCTTTCCGCAGG	1675	158	yes
GATCATGTTCGCCTGGACAC	230	57	yes
GATCATGTTCCTGGAGGTCA	65	16	yes
GATCATGTTACACTTGCCAG	50	15	yes
GATCATGTGTCAAAAGCAAA	7	11	yes
GATCATGTGTAAGTGTCAAA	4	5	yes
GATCATGTGGCGTTCTCTCT	4	2	yes
GATCATGTGGATTCCAGGAA	4	4	yes
GATCATGTGGATGCCTTCCC	97	14	yes
GATCATGTGCTCACCTGCAT	11	2	yes
GATCAGTCTTCTGCCCTGTC	7	6	yes
GATCAGTCCTCTTCAGTTTC	1	1	yes
GATCACATTCGTTCATCAAG	6	5	yes
GATCACATGGTGACTCTAGC	24	23	yes
GATCATGTGAGCATCGTGGA	208	21	yes
GATCATGTGAGAACAGGCAT	10	7	yes
GATCATGTGACAAGTGAGAG	20	2	yes
GATCATGTCTTCTCCATGTT	410	25	yes
GATCATGTCTGTGAAATGAC	4	2	yes
GATCATGTCTGAAAAATCCA	23	10	yes
GATCATGTCTCAAGGTGGCA	54	18	yes
GATCATGTCTATCTCAGGGG	158	11	yes
GATCATGTCCCACAGGCATT	32	18	yes
GATCATGTCATTGCCTGTTA	6	2	yes
GATCATGTCAGCATGAGTAG	3	3	yes
GATCATGTCAGAGGGAGATG	166	9	yes
GATCATGTACAGAGGTCTTT	9	6	yes
GATCATGTACAAGCTGATGG	342	15	yes
GATCATGTAAAGACGCTGGG	81	13	yes
GATCATGGTTCAAGTGACAA	172	52	yes
GATCATGGTGTGGCTTGTGG	54	6	yes
GATCATGGTGTCTTGTGGTT	11	14	yes
GATCATGGTCTTCGGAAAAC	40	5	yes
GATCATGGGTGTTGCTACCA	69	20	yes
GATCATGGGTGTGCCAGGGG	107	14	yes
GATCATGGGGCTGGAGAGAT	16	7	yes
GATCATGGGGATGGACGGGG	141	29	yes
GATCACAGTTCATGTAATGC	26	14	yes
GATCATGGCCTTTACGATGC	32	6	yes
GATCATGGCCTTCAGATATG	126	7	yes
GATCATGGCCCAGACCTGAG	97	11	yes
GATCATGGCAAAGGATGACC	395	22	yes
GATCATGGATGTGTGGGGAA	4	5	yes
GATCATGGACATGAAGGAAG	132	13	yes
GATCATGCTTTCTTCTCTAT	62	22	yes
GATCATGCTGTGTTCGTGAT	10	8	yes
GATCATGCTCCTGCAGCTGA	114	18	yes
GATCATGCTCCTGAGTGGCA	40	12	yes
GATCATGCTCATCTTCACTG	168	24	yes
GATCATTGGGGGAGGGTAGT	231	63	yes
GATCATGCTACCACTGCATC	11	8	yes
GATCATGCGCCTTTCTAAGC	84	23	yes
GATCACAGCTATGCCCTTTC	30	11	yes
GATCGTGTGTTGCCATTTTG	87	15	yes
GATCACAGCAGCCCAAGCTC	24	16	yes
GATCCGGGGGCTGCTGGGAA	13	3	yes
GATCATGCCGTGCTACGCTC	40	30	yes
GATCATGCCCACTGTTGAAA	4	3	yes
GATCATGCCCAAAACAACCA	257	50	yes
GATCATGCAGTAGTTCACAG	10	7	yes
GATCATGCAGACTGTTCCTT	1356	324	yes
GATCATGCAGAAGAACGGTG	212	14	yes
GATCATGCACTGTATTCACA	16	5	yes
GATCATGATTTCCGAGCTAC	2	3	yes
GATCATGATTCTCCCTCAGC	123	15	yes
GATCATGATAGCAGCACAGA	127	110	yes
GATCATGAGTGTCCCACTAC	31	7	yes
GATCATGAGGGAGTTCCGGT	375	41	yes
GATCATGAGCCATTTTTAAC	4	4	yes
GATCATGACGCTGGTAGATG	26	13	yes
GATCATGACCCTTAGACTCA	13	9	yes
GATCATGACATTCCTCAGAT	20	3	yes
GATCACAGACCATGGTCTCA	15	3	yes
GATCATGAACATCATCCAGG	200	25	yes
GATCATCTTTTCTCATTTCG	31	3	yes
GATCATCTTGTTGCGTTTCT	47	15	yes
GATCATCTTGCTGCTTGACA	25	2	yes
GATCATCTTGAAGTGTGCAA	3	2	yes
GATCATCTTCATCCTGGGTT	55	7	yes
GATCATCTGGTGCTGTGTCG	46	1	yes
GATCATCTGGCAAGCAGAAG	1	1	yes
GATCATCTGCCCTTTCTATC	62	2	yes
GATCATCTCACAGGACAGGG	337	25	yes
GATCTTTCTCGTCTTCCCTT	23	6	yes
GATCACACCACTCTCAACCA	24	8	yes
GATCACACATCTGGGCAGTG	79	56	yes
GATCAGCCTGGCTCCAGGGA	14	13	yes
GATCACACAACCCACCTCAG	21	15	yes
GATCTCTGTAACAGAGCCTC	30	32	yes
GATCATCGTGTCGGGATGAT	45	10	yes
GATCATCGTGCTTTCAGACT	7	6	yes
GATCATCGTCAGTGACGTTT	15	18	yes
GATCATCGGCATGGCATACG	1308	85	yes
GATCTACACACAGGTACACA	19	7	yes
GATCATCGAGTTGTGGATGG	178	15	yes
GATCATCCTTGTGTTGTGAA	105	11	yes
GATCATCCGCAAAGTTGTGA	29	3	yes
GATCATCCCGGAATTCGGCT	4	5	yes
GATCATCCACCTGCTCACTG	980	175	yes
GATCATCCAAGCTGTTGTAA	6	2	yes
GATCATCATTCGTGTGCAGA	4	6	yes
GATCATCATGGAGCTGGTGA	15	4	yes
GATCACAAGATGGCGTTATC	15	5	yes
GATCTCTGACAAAGACAACG	14	15	yes
GATCAGGTCATCGCCTCCTT	1460	22	yes
GATCAGGGTTAAGGAGGAGC	111	22	yes
GATCAGGGAAGCAGACATTG	329	81	yes
GATCTGTTGAAGAACTCAGC	29	6	yes
GATCAGGCTACTACAAACTT	4	5	yes
GATCAGGCGAGACATGTTCT	50	46	yes
GATCGGGCTGCGAAGCGGAG	5	4	yes
GATCAGGAAAAGAAAAAGCA	21	19	yes
GATCATCAGTTAGAGTTCTG	9	10	yes
GATCATCAGCTGAGGCAAGG	31	10	yes
GATCATCACTCACGGACATA	2	2	yes
GATCATCAAGTGTCCTGGCG	3	3	yes
GATCATAGGCAAATCAGTTA	1	1	yes
GATCATAGGATTCTGATTTT	10	10	yes
GATCATAGCTTCCTGTCCCC	40	3	yes
GATCTCTCCCAGGCTTGCTG	6	6	yes
GATCACAAACATAGCCAATG	65	20	yes
GATCAATGCCTGGACGGCTC	1414	17	yes
GATCAATGCCTCCAGCAAGG	12	11	yes
GATCAGAGGCCACATAGCTT	2	2	yes
GATCAGCTCTGTAGCAGCAG	6	5	yes
GATCAGCGTGCGCCTAGCGG	186	13	yes
GATCAGCGGTGGGAATGACG	102	14	yes
GATCAGCGCTGAGCTCCAGA	10	7	yes
GATCAGCGACCTTCCAGCAG	51	12	yes
GATCAGCCTTCAATAGCCAT	36	33	yes
GATCAGCCTCTTTCCCATCA	8	8	yes
GATCAGCCCTGGCAAGGAAG	155	12	yes
GATCCCAGGCGGCGGCGGCA	11	2	yes
GATCAGCCCAAAATGAGCGA	47	28	yes
GATCAGCCATCCTGGATGGA	9	9	yes
GATCCTTGGAAACGGTTCTT	3	2	yes
GATCCTTAAAGACTTCCTTC	34	5	yes
GATCATAGCTGATGGCCTTC	41	7	yes
GATCATAGCTCTAGCAGAAC	145	21	yes
GATCATAGCTACTTTGTGCT	75	9	yes
GATCATAGCAAAGATGGACG	190	31	yes
GATCATAGATTGGGCTACAT	12	11	yes
GATCATAGATGACTTTGCCT	129	27	yes
GATCATAGAGGTGTGGCTTT	22	8	yes
GATCATACTGTTAGTCGGCT	1	1	yes
GATCATACGTAGTTGTGAAA	31	3	yes
GATCATACGCCCAGGGAGAG	29	12	yes
GATCATACCCTCTCTGGCTT	32	7	yes
GATCATACCAAGAGGTGAGG	663	77	yes
GATCATAACAGTTCTGTGAA	4	4	yes
GATCCTTTGGACCGGGCTTT	48	34	yes
GATCAATCAGAGGGATTACC	120	14	yes
GATCAGCAGGTGGTTATCAA	59	8	yes
GATCAGCAGCTGCTTTTGCA	17	12	yes
GATCAGCAGATGTTGGTGGC	53	10	yes
GATCAGCACTGGGGTCAACG	9	9	yes
GATCAGCACTCTCGGTATGC	67	13	yes
GATCAGCACGCTGACTCTTT	91	8	yes
GATCAGCACCACACTGGACT	2	2	yes
GATCCCAGAGGAGTCAGAAG	14	1	yes
GATCAGAGTGTCACGGTAGG	6	3	yes
GATCAGAGCCCTGTCGATGG	39	5	yes
GATCCTGCCAGTCCAAGAGT	2	3	yes
GATCAGAGAAACTGGGTAGA	47	14	yes
GATCAGACTAACCCCGGAGT	83	17	yes
GATCAGACCATGGTACTGGC	58	2	yes
GATCAGTTTTTGGTGTCATT	372	25	yes
GATCAGTTTTGGAGTGCAGC	7	3	yes
GATCAGTTTTGACCTCTTAT	59	6	yes
GATCAGTTTGTTTTCACTGT	27	25	yes
GATCAGTTTCTGTGTAGTCT	2	2	yes
GATCAGTTTCATGTTTTTTC	24	3	yes
GATCAGTTTATCAGTCCGTT	59	10	yes
GATCAGTTGCCAAATGATTG	10	10	yes
GATCAGTTGAAACTTGGAAA	25	0	yes
GATCAGTTCCTGGTATACAG	51	1	yes
GATCAAGTGCTGTGACAGTG	1	1	yes
GATCTCCTGAGACTGGAGTT	25	39	yes
GATCAAGGTCGGAAAGAAAT	573	86	yes
GATCAGACAGTATCAGGGCT	38	13	yes
GATCCTGCTGGAGGTGAACA	5	6	yes
GATCAGAATGAGGGACCTCC	75	12	yes
GATCAGAACCCGCAGACCAA	2	2	yes
GATCTGTGCAGGGTATTAAC	790	1007	yes
GATCAGAAACCCGAGCTGAA	31	29	yes
GATCACTTTGACTTCATCCT	40	7	yes
GATCTGTGCAAAAGCAGTGA	1183	66	yes
GATCACTGCTGTAGGAAAGC	171	24	yes
GATCACTCTTCAGAGAGTGA	1	1	yes
GATCACTCGCCGAGGTGTGG	7	3	yes
GATCAGTTCCATGTTACACA	6	5	yes
GATCAGTTCAGTGTGCATCG	136	9	yes
GATCCGGGCAGAGGTGCAAG	7	3	yes
GATCCGCCTTCGAAGCAGTG	2	3	yes
GATCAGTGTTTCTGCGAAGG	13	12	yes
GATCAGTGGCTTCAGTCACA	15	24	yes
GATCAGTGCTGTACTTCACT	42	39	yes
GATCAGTGCTCTGCTAACGC	403	6	yes
GATCAGTGCCTTTGTTGGCA	203	4	yes
GATCAGTGAGTGTGAGTGTG	3	4	yes
GATCATACGGAGCATGAGAG	3	3	yes
GATCACTCAGTAACTGCTGG	122	21	yes
GATCACTCAGCCCTTGAGCA	10	10	yes
GATCACTACTCCTTAGACGT	127	28	yes
GATCACGTTTGTGTTGTCTT	9	1	yes
GATCACGTTGAGTTCTATTT	2	2	yes
GATCACGTTCTGATTGAGCT	65	12	yes
GATCACGTGTATGTGTCGTG	64	3	yes
GATCACGTGGGCTGCGTTTC	548	116	yes
GATCACGTGGCTGTTCTTGT	38	35	yes
GATCACGTGACCACCCTTTC	52	48	yes
GATCACGGTGCCTGGTTACA	23	17	yes
GATCACGGAGCTGGAGTTCG	194	181	yes
GATCACGCAGTCTTAGAAAT	30	7	yes
GATCACGACGACGCCCACGC	32	5	yes
GATCACCTGCTCTAATGTCC	224	162	yes
GATCACCTGCCAGACTGTTA	46	6	yes
GATCTGTCTGTTTAGTGGAT	6	10	yes
GATCACCTCCCAGATTCTGA	134	12	yes
GATCACCGTTCCCATCCCCG	3	3	yes
GATCCCTCCCTCCGAGCCCA	3	4	yes
GATCCCCTCTCCCAGCTCTT	7	5	yes
GATCCCAAAGAAGGCTATGG	2	2	yes
GATCACCAAGGAATCCAAGG	157	17	yes
GATCACCAACTCACGTCATG	80	74	yes
GATCACCAACCACCCCAGCA	94	74	yes
GATCACCAAAAACATCCAGG	44	23	yes
GATCACATTGGCTGCGTGCT	9	9	yes
GATCACAGTGGAATCTTCGG	51	10	yes
GATCACAGTGAGATTCTCAT	36	11	yes
GATCACAGGTCTGAGCAAAG	25	8	yes
GATCTCTGTGAGGTGGACAC	1	1	yes
GATCACAGAGGGGCCAGGAT	4	4	yes
GATCCCCACCGACAGGCTGA	4	3	yes
GATCCCCAACCACTCTGAGG	4	3	yes
GATCCCAGCCTTGGCTCCCC	28	1	yes
GATCCCACCAAGCTTGGCCG	4	4	yes
GATCACACTTGGGGAAGATG	33	1	yes
GATCACACTGGAACAGAACC	61	13	yes
GATCACACCTGTGGGGTCAA	75	17	yes
GATCACACCTGTAGACAAGA	17	16	yes
GATCACACCCAAAGCTGTCC	47	7	yes
GATCACACAGGGAGGCCTTG	266	22	yes
GATCACACACTACTGAGGGC	1	1	yes
GATCACAACTGATGGCGGGT	836	4	yes
GATCAATGTCGTCATCATCC	9	9	yes
GATCAATCCACAGACGACTG	60	56	yes
GATCAATCACCAGCGCGAAG	208	18	yes
GATCAAGATTTGGCCAATTG	16	19	yes
GATCCCTGTCAGCTAGCTGG	208	5	yes
GATCACGTGCTTGTGCCAGG	29	4	yes
GATCAACTCATGGAGCTGGC	117	44	yes
GATCAACGCCATGACCTACC	111	13	yes
GATCAACCTGCTGTGACGCG	31	8	yes
GATCAACCCGTGTGCATTGC	33	17	yes
GATCAACCCCTACCAGCCAG	42	16	yes
GATCAACACTTTTCTCTCAG	1	1	yes
GATCAAATTCCCAGGGACAT	51	16	yes
GATCCGAATCTGTGCCCAGC	365	3	yes
GATCATGTTGTATCCCGCCT	23	28	yes
GATCACCACCAGGACGCTGG	10	3	yes
GATCACCAAGGCTCGGGAGT	7	6	yes
GATCCCGTGTTCCTTTCAGC	2	2	yes
GATCGACACATGTGTGGGGA	36	33	yes
GATCCCTTTATGAACCTTGT	15	5	yes
GATCATAAAGGCTATTTTGA	3	3	yes
GATCCCACAGCCTCATAGTG	5	5	yes
GATCCTGAGCTGCAACCAGT	5	4	yes
GATCTGGTCCTGCTCCTACC	24	17	yes
GATCCCTTCCCCTTCCACTA	7	8	yes
GATCAAGACTACCATGGTCA	1	1	yes
GATCCAGAGAGCTTCCTAAA	105	19	yes
GATCTGTGCTGGTGGGGTGG	7	6	yes
GATCCAGAACACTTGACACT	2	2	yes
GATCCACTTTTAACCTCTGG	19	23	yes
GATCAGAGGCTCCCAACCGG	21	16	yes
GATCCCTCTTGGTTTGTGAC	15	4	yes
GATCCACTGCGTTTCCATGC	196	1	yes
GATCCACCTTGTGGCCTGGC	352	12	yes
GATCTCATGGTTGACTCTCT	2	3	yes
GATCCCTCCCATGTTGGGAG	36	2	yes
GATCCACCGTACCAGGAAGC	217	37	yes
GATCTCAGTTTTTGGTTACA	3	2	yes
GATCCAGTCGTTCTGCTGCG	54	5	yes
GATCTCAGTCCCCGCCTGCA	24	26	yes
GATCTCAGGAGACTTCACCA	44	47	yes
GATCAGGCGAAGCAACTGCT	9	9	yes
GATCACAGATGTGATGGGGT	33	8	yes
GATCCTGCCCCCACGCTGGG	35	7	yes
GATCCACCAAGGTAGAAAAC	69	16	yes
GATCCACAGGCTCCTGGGCC	88	5	yes
GATCCACAGCAGTTATGCTG	1	1	yes
GATCCACACGGGCGAGAAGC	18	10	yes
GATCCACACAGGAGAGAAGC	88	15	yes
GATCCAGGAGTCCTGTCAGA	52	3	yes
GATCCAGGACACAGCGTGGT	22	0	yes
GATCTCACTGGACTTGGTGT	292	44	yes
GATCCCGTGTAGCCTTCGTT	25	13	yes
GATCTCACTAACCTGCCACC	92	11	yes
GATCCAGCTGCAGAAGCCAG	16	1	yes
GATCTCACGGCCTGCGGGGT	155	35	yes
GATCCAGCTCTCTTAGACAG	2	2	yes
GATCTCACGGCCAGACAGAC	106	38	yes
GATCTCACGCCTCTTGGGGA	12	7	yes
GATCAAGCCTAGCCAGGACC	22	3	yes
GATCCAATTTCATCGCTGCA	12	8	yes
GATCCAAGTTATTGGCACAC	16	6	yes
GATCCAAGGGCCCTGTATGT	15	14	yes
GATCTCACAGTTAGTAGTCA	79	35	yes
GATCGAGTGTATCACGCAGG	2	2	yes
GATCTCAAGGACAGGAGGTC	6	6	yes
GATCTCAAGCGCTTTGCTCT	29	31	yes
GATCTCAAGCAAGTCAGAAG	3	4	yes
GATCCAGCAAATCGGGACAG	11	8	yes
GATCTCAAAGTGGCTGATGC	55	13	yes
GATCTCAAAGGGAAACTGAC	3	4	yes
GATCTCAAAGGAACTTCTCC	31	13	yes
GATCTCAAACGGGCACTTAA	1	1	yes
GATCAGCATCCAGAGTGAGG	18	5	yes
GATCCCTTACAAGATGGTCT	30	4	yes
GATCCCATCCAGCCCTCCAC	2	2	yes
GATCCAACTGACTGGCTAGC	689	105	yes
GATCCAACTGACAGATGAGG	7	7	yes
GATCCAACTCTGTAAAGGCT	120	12	yes
GATCCAACTCAGTTAGGCTT	13	4	yes
GATCCAACTCACCCCATCAG	456	12	yes
GATCCAACGCAGCACCGTCT	136	2	yes
GATCCAACCCCCTCTCCTGA	3	3	yes
GATCGAGCCAAGAGCTGTAA	221	24	yes
GATCGAGCAGGCCCGGCTGC	87	3	yes
GATCCAGAGCACAGCCCACG	71	17	yes
GATCCAAAGACGCTAGATGT	80	28	yes
GATCTATTCTCCCACTGGAC	27	6	yes
GATCTATGAGACAGAACTGG	117	52	yes
GATCCAGGTGACCATGGCAT	8	2	yes
GATCGAAGCCTGCCGGGGTA	163	43	yes
GATCCACTTGCGTTGTGAGC	7	5	yes
GATCCTTCTACCCTGTCTCG	3	3	yes
GATCTAGCCTTATGCCCGGG	16	19	yes
GATCTACTTGTGTGTGTGTG	166	12	yes
GATCTACTTGCTACCAGTCT	20	14	yes
GATCTACTGTGTGACACCTG	22	18	yes
GATCTACTCCTTCAGAGCCT	65	4	yes
GATCCACGGGGTGACTTCCA	52	6	yes
GATCTACGGTTCCCACGCAT	125	44	yes
GATCTACGGCCTGGACTTCT	50	35	yes
GATCCCCAAATTCCAGCATC	2	2	yes
GATCATTTCGGGTGACTTAA	39	37	yes
GATCCTGTCTCTGGCAACCC	11	0	yes
GATCTACCTGACCTTGTTGA	10	7	yes
GATCTACCTACCCGTGGTGT	87	23	yes
GATCTACCAGGTGGACACCC	61	20	yes
GATCTACAGGGCACAGAGGG	9	10	yes
GATCTACAGCGTGCCCTGGA	56	9	yes
GATCTACAGCACTGCCTTTC	14	15	yes
GATCCACCAGCGTGTGCATG	46	17	yes
GATCCAGGGTGAGTTCTTAA	3	4	yes
GATCATGACCGAAAGCTCGA	33	40	yes
GATCATTCCAAGTTTCACGT	51	22	yes
GATCTACAAAACACAGGGAG	59	4	yes
GATCTAACTTAATCAGGCAC	15	9	yes
GATCTAACTCTGTATGTCCT	6	1	yes
GATCCACACAATGGAGACCT	32	4	yes
GATCTAAATCTTTCCTCAGC	1	1	yes
GATCTAAACTGTGGTGTGAA	134	12	yes
GATCTATCACATGTGGAAGT	10	4	yes
GATCCAGAGGAGAAACTAAG	1	1	yes
GATCTAGTCCTCCCGTTCAT	7	5	yes
GATCATTATTTTGGCACCAT	18	22	yes
GATCCTTCCCATCCCACTCT	28	9	yes
GATCCAATTGTGTGCTGTGC	29	1	yes
GATCGTGTGGAGTGAAAGGC	5	4	yes
GATCGTGTCCGGCATGAAGT	841	21	yes
GATCGTGTAGCAGGGTAAGG	6	6	yes
GATCGTGGTGAGGAGGCTGG	169	8	yes
GATCACAATCAAGTGCATGG	3	3	yes
GATCCTCTCAGAACTTTTGT	1	1	yes
GATCCTCTACTGGGTTCCGT	1	1	yes
GATCGTGGTCCAGAGGAGCA	2	1	yes
GATCCAAGGCGGCGACCCGA	28	4	yes
GATCGTGGGAACCATTGTCA	58	25	yes
GATCGTGGCTAGTGAGATAG	12	11	yes
GATCCAAGGACTGCGGTGCA	196	31	yes
GATCGTGGCACCTCCGGGCT	6	7	yes
GATCGTGAAGCCGCTGAATC	1	1	yes
GATCTTTGGAGGAATCACGG	74	19	yes
GATCGTAAGTTCTGGGACGC	18	4	yes
GATCGGTGTCGAGCACGGAC	53	1	yes
GATCGTCTCCTCCACAGATG	4	3	yes
GATCTGTGCTGAGGGCAACG	23	18	yes
GATCAGTGAAGTTCTGTCTT	13	12	yes
GATCAGTCTTTTCAGTATTT	2	3	yes
GATCAGTCTCGTCTACAGAG	14	3	yes
GATCAGTCCTCTAGCATTTC	196	102	yes
GATCAGTCCTACAAAGTTCC	13	0	yes
GATCAGTCCCTTCCCCCAAC	103	24	yes
GATCAGTCAGGTCCTAGATG	33	6	yes
GATCAGTCACAGGCAAACTC	13	7	yes
GATCGGCTGCTTTTGTCTCT	27	4	yes
GATCGCTTTAGCTTGCCTAC	7	7	yes
GATCATCTTAGGCTTGGCTG	17	13	yes
GATCAGTAGGAAGCACAGGT	2997	39	yes
GATCAGTAACAGCTCAGACA	9	9	yes
GATCAGGTTTGGACTCCTTC	5	4	yes
GATCAGGTTTGCACCAAGGT	39	3	yes
GATCAGGTGTTTGGATGGCA	41	15	yes
GATCAGGTGTCAGTTTTCTA	127	17	yes
GATCTGCGATGAACTGGGAG	621	48	yes
GATCGCACCCTGAAGGTGGA	16	15	yes
GATCCCCCGGCCTCAGCCTC	24	23	yes
GATCCATTTGGAGCTTACTC	5	4	yes
GATCCAGTTGTGGCCTCTAC	46	17	yes
GATCAGGTGAAGACCCTCTC	17	16	yes
GATCCAGTCGACTGGGTTTC	4	6	yes
GATCAGGTCAGAGATGCGGT	214	17	yes
GATCCAGGTTCTGACTCCTC	8	3	yes
GATCCAGCGCATAGTGGGTG	13	5	yes
GATCAGGGGTGGACTTGCTT	25	27	yes
GATCAGGGGGAAGGGGTCAG	25	30	yes
GATCAGGGCTGTTACCTATG	10	7	yes
GATCCACTTCTCACAGCCCC	47	5	yes
GATCAGGGCGTGGTAGAGAA	47	9	yes
GATCAGGGCCGTGTGGATGC	82	18	yes
GATCAGGGCCGAGTGATGAG	105	2	yes
GATCAGGGCCCATTAGTGAG	52	35	yes
GATCAGGGCCAGGGGAGGTC	295	33	yes
GATCAGGGCCAAGGCATCCC	1	1	yes
GATCAGGGCAGAGATGGAAG	182	12	yes
GATCAGGGCAAGGGCTAGCC	6	5	yes
GATCAGGGCAAGAGGATTGT	109	7	yes
GATCAGGGCAAAGTGGCTTT	120	10	yes
GATCTTTGCGGACTGCAGCT	48	1	yes
GATCGACTCTGCAGTGGAAA	4	2	yes
GATCCACCAACACCATGCGT	4	3	yes
GATCAGGCTGTTGTGTGTGA	18	3	yes
GATCAGGCTGAGCTGAATGT	13	7	yes
GATCAGGCTACTACAAAGTT	320	115	yes
GATCCAAACACACACTAGGA	79	4	yes
GATCAGGCCTGAACCCGTCC	144	101	yes
GATCAGGCCCACAGCCGAGT	113	11	yes
GATCAGGCCATCAAGTCACA	12	9	yes
GATCAGGCCATACGTAGCCT	83	26	yes
GATCAGGCCAAACACTTGGG	3955	578	yes
GATCATGCGGATGGCTGAAG	8	6	yes
GATCAGGAGTTTAAGTGGTT	15	4	yes
GATCTTTGGAGAAATGGAAC	27	5	yes
GATCAGGAGGGTCTATTTCC	32	26	yes
GATCAGGAGGGTCAGCTGTG	423	53	yes
GATCAGGAGGCTGTCCCTAA	2	2	yes
GATCAGGAGGCAGTGTGTGG	14	11	yes
GATCAGGAGCTGGCATTGGC	170	129	yes
GATCTTTCTCAAGAGCAGTG	9	2	yes
GATCAGGAGCCAGGGAGCTA	334	265	yes
GATCAGGAGCACCTGTGGCT	194	181	yes
GATCAGGACTTGGTGGAAGC	51	3	yes
GATCAGGACTCCTGTGACTC	51	47	yes
GATCAGGACAGCAAAGACAG	27	43	yes
GATCAGGAATGTGTGCAGCA	33	31	yes
GATCAGGAAGATGACTGGCA	23	16	yes
GATCAGGAAGATGAACACTT	12	11	yes
GATCCGTATGGGCACTGACA	4	6	yes
GATCAGCCCCATGCAGTGGT	43	7	yes
GATCAGCCCAGCCATTCTTT	15	10	yes
GATCAGCGGTGGGAATGACA	2132	109	yes
GATCAGCGCTATTTCCTGAG	38	7	yes
GATCAGCGCCTCCAGTTCCT	39193	602	yes
GATCAGCACTGACCAGGGCA	110	14	yes
GATCAGCGAGTAAACTGGTA	5	3	yes
GATCAGCCTTTTCTGTCTTG	88	14	yes
GATCAGCCTTCAGTTCATTT	20	15	yes
GATCAGCCTGGGCCACCTTG	105	72	yes
GATCAGCCTGCTCCTGGGGC	79	14	yes
GATCAGCCTCCATCCGCTCA	13	7	yes
GATCAGCCGTTCCTCTGGTG	69	5	yes
GATCAGCCGCTCAAGATTCT	488	21	yes
GATCCTCTGCCTCATCAACG	2	3	yes
GATCAGCCCTAATCCTCTGG	18	5	yes
GATCAGCCCGACTGTCTGCT	5	4	yes
GATCAGCCCATCCACTCTTT	12	9	yes
GATCAGCCCAGCCCATGTGA	290	6	yes
GATCAGCCATTTCTTGGGGT	12	8	yes
GATCTCTGACCTCCTCCCCA	13	12	yes
GATCAGCCAGTATCTTGAGT	6	5	yes
GATCAGCCACTTAGAATTCA	32	13	yes
GATCCTCAAGAGGGCTGTGA	17	8	yes
GATCCACCCGTCACCGTAGC	2	1	yes
GATCAGCCACAAGATTTCAT	30	7	yes
GATCAGCCAAGGGTTCAGAG	13	12	yes
GATCAGCATTCTTGAGCTGG	82	8	yes
GATCAGCATGGTTGTTCTTC	49	8	yes
GATCAGCATGGGCACACAGC	54	31	yes
GATCAGCATAGTTGTAGATT	21	17	yes
GATCACATTTTTCGGTGGCT	24	8	yes
GATCAGCAGTGTCGGCCATT	305	6	yes
GATCAGCAGTGCCTTGTGTT	159	14	yes
GATCAGCAGTCTTCAGCTCT	2	1	yes
GATCAGCAGCCTACGACCTT	14	2	yes
GATCAGCAGAGTGGTTATGG	200	11	yes
GATCAGCACTTGCCTGGAAA	6	2	yes
GATCACAGACATCCAGCACT	96	1	yes
GATCAGCACTCTGCCTCCAA	28	4	yes
GATCAGCACTCAACCATTCT	6	6	yes
GATCAGCACTAAGACTGCTA	69	5	yes
GATCAGCACCTTGAAGAAGT	14	10	yes
GATCAGCACCTCTCCAAGAA	14	22	yes
GATCAGCACAGGGTCAACTA	33	14	yes
GATCAGCACAGACACCATTT	49	6	yes
GATCAGCAAGTGACATTGAT	17	4	yes
GATCAGCAAGCAGGAGTGCG	128	134	yes
GATCTATGGGGCGCCACACC	13	14	yes
GATCATCCCGCGGGACCTCT	57	27	yes
GATCCTCAAGAGAAGCTTCA	106	26	yes
GATCAGATTTGTCCACAAGG	142	9	yes
GATCAGATTTGGTCTATCGG	7	7	yes
GATCAGATGCATCTGACCAA	11	9	yes
GATCAAACCCCGCTACACGT	17	16	yes
GATCAGAGTATTCCTGCCAG	22	6	yes
GATCAGAGTATGTCTTGTGT	10	3	yes
GATCAGAGGTTCAGAATATC	7	7	yes
GATCAGAGGTTAGGACGTGA	91	15	yes
GATCGAGGAAAAAGTGCGGA	17	19	yes
GATCCAAAGAAACCAAATTG	44	10	yes
GATCCATTTATGGGACACTG	40	9	yes
GATCAGAGGCTCCCAACTGG	361	23	yes
GATCAGAGGAGACTTCCTCG	13	9	yes
GATCAGAGCTCCAGGCTTGG	38	2	yes
GATCAGAGCCAAGAAACGCC	120	13	yes
GATCTGCTTCTCGTCGGGGC	43	13	yes
GATCAGAGAGTGTCAACTTA	5	4	yes
GATCAGAGACAAGTTCATTA	42	13	yes
GATCTCTGCATGTTGTGGGC	6	6	yes
GATCAGACTGGTGAGAAAGC	51	1	yes
GATCAGACCTGTGGCTGAGT	18	22	yes
GATCAGACCTGGGCGTGAAA	95	5	yes
GATCAGACCCAAAGAAAAGT	113	3	yes
GATCAGACACTGACTGGTGA	59	11	yes
GATCAGACACTCCCTCACCA	44	6	yes
GATCTCTCCCTCATATAACT	91	1	yes
GATCTGGCTTTCCAGATGGC	6	5	yes
GATCCGTCGCCACTGGGGAG	2900	75	yes
GATCTTACCCTGAAAATGGC	5	0	yes
GATCAGTAGTTGCATAGGGA	28	26	yes
GATCTGCAGCACGTAGACAG	38	20	yes
GATCCAGACCTCTGGCTTGC	14	3	yes
GATCACTGCCACCCTGAGGT	17	0	yes
GATCTTCCAGAGTAAGAGGA	5	5	yes
GATCACCAACCAGCCAGGAA	5	5	yes
GATCGGCGCCTCCGGAGTAC	190	17	yes
GATCAACCCCTCAGTCTGCA	23	12	yes
GATCTATACCATGTTCTTTG	30	7	yes
GATCATTCTGGTTTCAGAAC	2	2	yes
GATCCTCTTGTCTCGGCAAA	14	13	yes
GATCATCTTCTCTGTGTAAC	2	2	yes
GATCGCCATATGGACCACCT	21	32	yes
GATCCTTGAGAGGCAAGACG	568	114	yes
GATCAGGTGGAGTTGAAGGA	127	9	yes
GATCCTGAGCCCCTGCCACT	3	2	yes
GATCACTCATTGTTCAGGTG	31	4	yes
GATCGGGTCAGTCACCTTTG	120	16	yes
GATCGGGCTGCCTGGCGTGG	33	31	yes
GATCGGGCATATCGAAGGAC	9	9	yes
GATCGGGAACAGAAAGGGCG	80	0	yes
GATCGGCGCTTTCAGACTAA	26	3	yes
GATCCTGAGAAACCTTTGAC	3	4	yes
GATCGCTGTGGCCGAAACTT	159	4	yes
GATCCAAACTAAAGGCAGAG	74	12	yes
GATCGCTCTCATTGCCCTTT	65	7	yes
GATCATTGGGGAACGGCAGC	6	7	yes
GATCGCTACCAAGCAGTTCT	72	10	yes
GATCGCGGACGGGCTGTGCC	62	12	yes
GATCGCCTTCTCCACCAATT	197	18	yes
GATCCTCAGGGCCTGAGCCT	4	7	yes
GATCGCCTCCTCCCTCTCTT	132	26	yes
GATCATGTGCCTTCCACTTC	3	3	yes
GATCTGGTGCTGCGCGGATG	50	36	yes
GATCCCTTCTCAGCCTCCAT	14	4	yes
GATCCCTTCCAGGTCAGCTC	142	17	yes
GATCGCCCTGTCCAACAAGC	64	22	yes
GATCGCCCTCTACATGGCCT	180	121	yes
GATCATGTCTTCCCCTCTTT	92	9	yes
GATCGCCATCGGCAGGACTG	246	18	yes
GATCATCTTTCTGAGGGCTG	612	35	yes
GATCATCTGGGAGGGGATGC	29	9	yes
GATCCCTACTTGGGCTTGTC	4	5	yes
GATCGCATGAAGAAACCATG	166	6	yes
GATCGCAGTAGCCAGCGCAG	229	3	yes
GATCGCAGAGTCCGCCAACT	9	9	yes
GATCATCGAGCCCACCAGTC	17	20	yes
GATCGACGAGAACTGGTATG	76	10	yes
GATCTGTCTGCCTGACCCTG	17	16	yes
GATCCTGAGAGAGTCCCTGA	18	1	yes
GATCACGGACGTGCAGCTCG	229	117	yes
GATCCTTTTCCACTCCCAGG	27	8	yes
GATCCTTTGCTCCTAGTGGA	62	19	yes
GATCCTTTCTCTTGTTTTTG	2	3	yes
GATCCTTTCCATGCAAACTG	21	6	yes
GATCCTTTCATTTTCCAAGT	4	7	yes
GATCCTTGTTGTGCCTCTTC	17	5	yes
GATCCTTGTGGCTGTGAAAA	81	38	yes
GATCCTTGTCCACCCCTCCC	91	62	yes
GATCCTTGTAAGAGCCAACT	1	1	yes
GATCCTTGGGGTAAGCAGAA	83	14	yes
GATCCTTGAGGTCACGTTGC	121	13	yes
GATCCTTCTCTGCTAGTTTA	10	4	yes
GATCTGCTTCGGAATTGGTG	24	4	yes
GATCGACCATACAGTAGAAC	3	4	yes
GATCCTTCTACCCACATACT	18	28	yes
GATCCTTCCTGCGGGCGGTG	46	7	yes
GATCCTTCCAGGAAGAGGAA	15	16	yes
GATCCTTCAGTCCTCTTAGT	54	2	yes
GATCCTTACCCTGTCCCTGT	201	14	yes
GATCCTTACCAGTGAGGCTG	6	5	yes
GATCAGTGTGTCTGTCTATG	48	1	yes
GATCCTGTTCCGAGCAAGCT	7	6	yes
GATCCTGTTAGTGAGCAGGG	15	4	yes
GATCAGTGCCTGGCGCCAGA	164	12	yes
GATCTGCAAAAACGGTCCAA	132	7	yes
GATCCTGTGTGGGAGGCTTC	82	12	yes
GATCCTGTGTGCGTTGATGA	6	4	yes
GATCCTGTGGGACCATCTAG	144	21	yes
GATCAGTCAGCCGCTGCCCG	50	46	yes
GATCCTGTCTCAAGCACACC	84	9	yes
GATCCTGTCCCAGGGGCTAG	232	14	yes
GATCAGGTCTCTCCAACTCA	16	4	yes
GATCCTGTCACTGGGGAGGC	205	20	yes
GATCCTGTAGCTGCCAGACA	27	25	yes
GATCCTGTAAAGGCAGGGCA	7	11	yes
GATCCAGGGCATCACTCGGG	1	1	yes
GATCCTGGTTGGGGGCAAGG	33	20	yes
GATCCTGGTGGTTCACCTCA	94	24	yes
GATCCTGGTGAATGAACCAT	5	5	yes
GATCCTGGTCCCCAGCACCT	216	8	yes
GATCCTGGTAGCTCACCAAG	84	3	yes
GATCCTGGTAGACACAGCTT	25	13	yes
GATCCTGGTAATGCACTTTG	1422	955	yes
GATCCTGGGTGGGCTGGGAG	7	5	yes
GATCCTGGGTGCCTCTGATG	15	7	yes
GATCCTGGGTCCCTCGTAAG	87	24	yes
GATCCTGGGTACTAAGGTCA	792	179	yes
GATCCTGGGGACCCAGAATG	203	10	yes
GATCCTGGGAGCGAGGAAAC	5	4	yes
GATCCTGGGAAGTTGGATTA	65	16	yes
GATCGCTGCAGAGCAGAGCA	4	4	yes
GATCCCCAGACAGTAGAAGG	2	1	yes
GATCCTGGCTGCCTACCAGC	1	1	yes
GATCCTGGCTGCCCACTTGG	111	27	yes
GATCCTGGCGCTGGCTGTCC	24	1	yes
GATCCTGGCGCGGGTAGCCA	116	81	yes
GATCCTGGCAGTGGACCGCC	94	12	yes
GATCTGTGTGGCCAAGAGTA	1	1	yes
GATCCTGGCAACAGCTGTTT	3	1	yes
GATCAGCTGATGTGGGTGCT	31	8	yes
GATCCTGGAGTTTTCTACAG	8	6	yes
GATCCTGGAGGAACCTTCGC	207	53	yes
GATCAGCTCTACCCAGAGAT	1	1	yes
GATCCTGGAGAAGCATGTTC	8	6	yes
GATCCTGGACGAGGCCACCA	84	11	yes
GATCCTGGAATTGGCTGGTA	9	1	yes
GATCCAGAAGACGAAAGAAG	2	2	yes
GATCCTGCTGTAGCTGCGCC	4	3	yes
GATCCTGCTGACACGGTGCG	144	28	yes
GATCCTGCTCCTGTGCTGGC	267	172	yes
GATCCTGCTCCAGGAGATTG	142	18	yes
GATCCTGCTAAGCACTGAGG	265	39	yes
GATCCTGCGGGCTGAGGGCC	6	6	yes
GATCCTGCCTGTGACCACAG	3	3	yes
GATCCTGCCCTGGGGTGAGG	77	11	yes
GATCCTGCAGCGGTTCCTAC	44	3	yes
GATCGCCAAGTTCAAAGCTG	131	17	yes
GATCCATTCGCAACTTGGCT	23	0	yes
GATCCCAACAATGCAGCCAT	188	126	yes
GATCACCATTTCCGACTCTG	95	68	yes
GATCTCTCCCCAGGGAAGGA	90	71	yes
GATCAGCTCAGACTGTGAAC	5	4	yes
GATCTTCCTTCTGCAGGAAG	11	13	yes
GATCAGAAGTTCAGGGTTAT	21	1	yes
GATCAGAAGTTCAGGGTCAA	8	8	yes
GATCAGAAGTTCAAGGCCAG	25	18	yes
GATCTCTACCACCCAGGTAT	3	3	yes
GATCAGAAGTGCCTCCTTGT	20	18	yes
GATCAGAAGTAGCCAAGTAG	10	10	yes
GATCAGAAGGAGATACTCTG	126	3	yes
GATCAGAAGGAAGAGAAACA	58	54	yes
GATCAGAAGCTGTGTGCGTT	24	19	yes
GATCAGAAGCTGGAGGGTGT	7	11	yes
GATCAGAACTGGGTGCCAGC	8	4	yes
GATCAGAACTGGACAGCTCC	476	72	yes
GATCAGAACCTGAACAAAAT	3	3	yes
GATCAGAACCCAGCCGAGTG	20	18	yes
GATCAGAACTAGCTAGTGCC	8	8	yes
GATCCCAATTCTCTGGCTGG	3	2	yes
GATCTTGCTGCGATTCCGCC	2	2	yes
GATCAGAACATTTGTTCCAA	1	1	yes
GATCAGAACATCTCTGGCTA	10	10	yes
GATCAGAACAACAGACAGTG	109	24	yes
GATCAGAAAGGAAGGGATGG	79	1	yes
GATCAGAAACTGTCCTCTGA	23	22	yes
GATCAGAAACATGCCCAAGT	28	26	yes
GATCAGAAACAACTGTGTCT	29	27	yes
GATCACTTTTTTCTGACTCT	2	3	yes
GATCACTTTGAGGAAGCCAT	530	43	yes
GATCACTTTCTAGGTTCCTA	59	6	yes
GATCCCAAGCACTTTTCAGA	1	1	yes
GATCAGGCTCTGGAAGGCGA	8	8	yes
GATCACTTGTTTGTGGTGAG	1119	2	yes
GATCACTTGTTATGTACATT	8	8	yes
GATCACTTGTCAGTGTTCAG	346	23	yes
GATCACTTGGCTTTTCTGGG	43	40	yes
GATCACTTGGCGGTGACTTT	160	1	yes
GATCACTTGATTTCTTGTGC	54	11	yes
GATCACTTCTGAAGAGCTTC	4	5	yes
GATCACTTCTGAACCTGCTC	4	6	yes
GATCACTTCTCTGGTCTCCA	56	16	yes
GATCACTTCGGCCTGTACAC	372	65	yes
GATCACTTCGCCCTTTTTTG	747	31	yes
GATCACTTCCGTGCCTCCCT	44	33	yes
GATCACTTCCCAGGGCCTGT	30	0	yes
GATCACTTAGTGGGGGGTTT	91	13	yes
GATCACTTACTGCCTAATGC	9	8	yes
GATCTAACACCCTCTTTTGC	53	11	yes
GATCACTGTGTTGGACACTC	991	80	yes
GATCACTGTGTACACATTGG	30	11	yes
GATCACTGTCTCAGGCCTTT	31	6	yes
GATCACTGTCCCCCTGGGAA	116	3	yes
GATCGACCACATCCTGGATG	143	51	yes
GATCACTGTACTCTTCTTTT	145	20	yes
GATCACTGTAAGTACTGTGA	7	6	yes
GATCACTGGTGTTTCCCATT	50	3	yes
GATCACTGGTGTGTGCCAGT	70	15	yes
GATCACTGGTCTGTGACCTA	25	9	yes
GATCACTGGGTGTGTTTCAG	232	48	yes
GATCACTGGGAACAAACGGC	697	52	yes
GATCACTGGCTGCCGCTGGA	13	16	yes
GATCACTGGAAACGATTGCT	83	3	yes
GATCACTGCTCTAGAGGACA	9	6	yes
GATCACTGCTCAAGCCTGGG	55	12	yes
GATCTTACACAGAGACCTTG	90	11	yes
GATCACTGCGTTAATCTTGG	114	15	yes
GATCACTGCGAAGTTTCGTT	52	7	yes
GATCACTGCCTTTCCCCCTC	163	31	yes
GATCACTGCCGAGAAAATCA	4	4	yes
GATCACTGCAGGGGGTGCCA	143	28	yes
GATCACTGCAGGCGCAGCGG	365	9	yes
GATCACTGCAACCTTGTGCT	128	17	yes
GATCACTGATTCAGAGCTCA	50	3	yes
GATCACTGATGGCCAGAATG	149	16	yes
GATCACTGAGGAGACATTTT	3	3	yes
GATCACTGACCTTGGAGCTT	117	29	yes
GATCACTGACCTCTGGAGTC	80	9	yes
GATCACTGAAATTCAAAGAA	1	1	yes
GATCACTCTGTGTGTGGTAG	89	5	yes
GATCACTCTGGCCGCTCTTC	6796	277	yes
GATCACTCTGGCCAAGTAAG	110	0	yes
GATCACTCTGGAGTTCAGCG	19928	1493	yes
GATCACTCTGCTGGAGTTTT	2	2	yes
GATCACTCTGAATGGTTGAA	84	3	yes
GATCACTCTCTGCATCGCTG	2	2	yes
GATCACTCTCATACGATACG	25	0	yes
GATCACTCTAGTCCCCACCC	44	30	yes
GATCACTCTACCCTCGAAGA	7	6	yes
GATCACTCGGAAATTCAGGC	8	12	yes
GATCACTCCTTTTGAGGAAA	683	37	yes
GATCACTCCGTGCACCTGCT	31	6	yes
GATCACTCCCTGCCTGAGCC	219	32	yes
GATCACTCCAAGTTGACATT	401	31	yes
GATCACTCAGTGAACAATCC	5	3	yes
GATCACTCAGCAGCCAGGAC	137	14	yes
GATCACTATGTCCAGGCTTC	90	2	yes
GATCACTAGTGACTGTTGGG	62	14	yes
GATCACTAGGTCATTTTGTT	28	2	yes
GATCACTAGCTTCGAGGAGG	231	22	yes
GATCACTACCGCTACTGAGT	1	1	yes
GATCACTACCCATCCTTAGC	25	1	yes
GATCACTACCATGAAAACGC	4	4	yes
GATCACTACAAACCAAAGCA	4	3	yes
GATCACTAACATTCCCCGTA	14	2	yes
GATCACTAAAGTTCCATCTG	1	1	yes
GATCACGGTTTTCTCTGTAA	322	26	yes
GATCACGGTTCAGGTTTTGC	18	5	yes
GATCACGGTTCAGATTCGTT	9	4	yes
GATCACGGTGAACCCCCAGT	302	8	yes
GATCACGGTCCCGTGACCGC	62	14	yes
GATCACGGTATTTGACCGTG	91	12	yes
GATCACGGCTTCTCAGCCGA	28	8	yes
GATCACGGCAGTGGATTGGG	246	29	yes
GATCACGCGTCCAGATGTGC	31	8	yes
GATCACGACCGATACAGTGA	21	9	yes
GATCACCTTTGTCTGATAGC	21	15	yes
GATCACCTTGCTGGCATCAG	128	15	yes
GATCACCTTGCCTGTCTATT	25	19	yes
GATCACCTTGAGCCTCTTCT	51	2	yes
GATCACCTTCCTGTCTCATC	31	9	yes
GATCACCTGTTTCGCTGTGG	1580	208	yes
GATCACCTGTGCCAAAGACA	17	11	yes
GATCACCTGTAAATGGCCAC	192	67	yes
GATCACCTGGGCCAGTCCAG	8	10	yes
GATCACCTGGGATTTCTCAG	8	10	yes
GATCACCTGGGACTCTAAGC	76	16	yes
GATCACCTGCTCTTTTCCTC	85	15	yes
GATCACCTCTTAGGGATGGT	57	1	yes
GATCACCTCTTAAGATTTTC	6	2	yes
GATCACCTCTGGGCCTAATG	171	42	yes
GATCACCTCATTCCTCGACT	99	8	yes
GATCACCACTTTTGCTGGAG	4	1	yes
GATCACCTCAACGTGGGTGT	529	68	yes
GATCACCTCAACATGGTCTT	4	4	yes
GATCACCTCAAACTAATTTG	73	5	yes
GATCACCTAGGAGAGCCACT	5	6	yes
GATCCGAGAAAACATGGCCA	1678	350	yes
GATCACCTAAGGGGTCTGGG	274	114	yes
GATCACCGTTTCAAGGCCCA	62	16	yes
GATCACCGTGTTTTCGTGGT	37	5	yes
GATCACCGGGAGGGAGACAG	13	12	yes
GATCACCGCTCACCTTTCCA	149	22	yes
GATCACCGCAATGATGGGTG	1	1	yes
GATCACCGACTCCCTTACTA	25	8	yes
GATCACCGACCGCATCGAGA	1967	86	yes
GATCACCGAACTAGACACAG	82	20	yes
GATCACCCTCAGGTGCAGGT	878	244	yes
GATCACCCCTCTGCCTTTGT	87	12	yes
GATCACCCCCTTCCCTCTGT	179	15	yes
GATCACCCCCAATTGTATGG	2225	441	yes
GATCACCCCCAAGTCATGGC	7	8	yes
GATCACCCCACAGTGAGGCG	133	27	yes
GATCACCCCAAAGCCTTCAA	16	13	yes
GATCACCCATCATTCTGAGG	600	42	yes
GATCCTTCCCCCCATGCACT	5	5	yes
GATCACCCAGAAGTGGCTCT	903	176	yes
GATCACCCACATTGGGTGAG	62	43	yes
GATCACCATTTCCGACTGTG	7491	297	yes
GATCACCATTCCGGTTACTT	780	14	yes
GATCACCATGAGTTTGAGTC	31	23	yes
GATCACCATCTAGTGAGTCG	1297	81	yes
GATCACCATAGTGTATCTGA	11	8	yes
GATCACCAGTGGGAAAGCAG	13	13	yes
GATCACCAGGATTGGTGCAC	25	2	yes
GATCACCAGGAAGAAAGAGT	54	9	yes
GATCACCAGGAACTTCTATG	8	8	yes
GATCACCAGCCTGAAGCTGA	48	8	yes
GATCACCAGCAAACAGCTTT	401	62	yes
GATCACCACCCCTGTTAAGC	78	13	yes
GATCACCACCAGGACGCTGA	367	54	yes
GATCACCAATGTTGTTTTTG	2	1	yes
GATCACCAAGGTTGATGCAC	2964	572	yes
GATCTGGTCTGCTCAAGGCA	8	8	yes
GATCCGGGCTCTAGACAGCG	77	18	yes
GATCACCAACTCCTTCCCCA	9	0	yes
GATCACCAACCTGCTATCAT	56	4	yes
GATCACCAACAGTGCTTGCT	12	11	yes
GATCACCAAAGGGGACTTTG	16	14	yes
GATCACATTTTCGCAGTGGG	1	1	yes
GATCTTCCAGCAAATTTCAC	28	30	yes
GATCACATTTGCTTTGTGTT	31	1	yes
GATCACATTCTGGGCTTCCA	25	7	yes
GATCACATGTAGTGGGGAGG	104	9	yes
GATCACATGAAGTTTGATTT	7	6	yes
GATCACATCTATGAGAAGTT	5	3	yes
GATCACATCGAGGTGTCGGA	4	3	yes
GATCAGGGCTTTGGAGTACA	33	7	yes
GATCACATCCAAAAAGTCAT	21	10	yes
GATCGCTTGTTGGCAATCGG	6	4	yes
GATCCCTGGTGCAAGATACC	1	1	yes
GATCACATCAAAGGATGATG	211	5	yes
GATCACATATTCCAAAAGTT	17	2	yes
GATCACATACGCAGGAGTGG	90	2	yes
GATCACAGTTGCTACTGCCT	5	6	yes
GATCACAGTTCCAGGAACAG	284	19	yes
GATCACAGTGCGTGCCTGGC	121	1	yes
GATCACAGTCTTCCATTTCA	4	4	yes
GATCACAGTCCTTCCTCTGG	896	54	yes
GATCACAGTATTGTCTCAGA	5	4	yes
GATCACAGGTGTGCATACCA	11	9	yes
GATCACAGGTGCTCTTGCTG	84	19	yes
GATCACAGGGATGCGGCGTC	62	14	yes
GATCTGTCCACAGTACCAAG	50	11	yes
GATCACAGGCAGTCCAGGGG	158	33	yes
GATCACAGGACAGCTGAACC	56	45	yes
GATCACAGCTTAGAGAATGT	60	10	yes
GATCACAGCTGAGGTGTGGG	18	5	yes
GATCACAGCTCAGTTCCTAT	18	0	yes
GATCACAGCGTTCGTGCCCA	173	2	yes
GATCACAGCGGAGTTAGCTT	32	4	yes
GATCGACATCAACGGGGATG	42	8	yes
GATCAAAGTGGGTCTGTGGC	57	3	yes
GATCCTCAGAAGGGAAACGT	63	18	yes
GATCTTGTTGTGAGTGTTTG	4	5	yes
GATCCTCACCACTCCTGTGG	22	16	yes
GATCTGGAAGTGTGGGAACG	136	9	yes
GATCCCGTTGAAACTGCTGC	65	14	yes
GATCCACGTTGAGGTGCATG	1	1	yes
GATCGTCGCATGGCTCTCCC	3	4	yes
GATCTGCTGCTGGTCTTTCT	4	3	yes
GATCTCAAAGACGGAATTAG	2	2	yes
GATCCCCTTCTACCTACTCC	908	71	yes
GATCCCTCGGTCAGCACCGT	1	1	yes
GATCTTTCTGGCAAGGATAC	1	1	yes
GATCAAGGATGAGGGCAAAG	29	27	yes
GATCCTCAACCTGCTGCGGG	26	5	yes
GATCCTAACCTAAGATTCCT	27	5	yes
GATCCTGTGTCACAGCTGCC	4	4	yes
GATCCCCACCTCTCTGTAGC	1	1	yes
GATCCATCTGTGTAGTTTCT	166	14	yes
GATCCTGGGCAAGGACCACA	8	3	yes
GATCTCACCATGTAGCCCTA	14	15	yes
GATCTGCCTGTCTTTTCCTG	20	4	yes
GATCGACAGATTGACCAGTT	3	3	yes
GATCCCATGCGGTTCTATCC	24	4	yes
GATCCAGTCTCATCTCAGCT	253	28	yes
GATCCAGTTTTGTTTGGACC	89	10	yes
GATCCCTGAGCCCAGAGTTT	8	5	yes
GATCCAGTGTTGGAATTCTT	1	1	yes
GATCAAAAGGTCAAGGTCGT	23	2	yes
GATCGGAAGTTTGGAGTCAC	9	9	yes
GATCCTGCAACCCATTTCCA	222	9	yes
GATCCTGATGCAAGGCTGGC	17	2	yes
GATCCTGAGTGAGTGTGAGG	91	22	yes
GATCCTGAGGCCTGTGAGAA	15	14	yes
GATCCTGAGGAGGGGTTTGA	25	11	yes
GATCCTGAGGACAGGAGAGG	35	7	yes
GATCCTGAGAGTGTCACTGT	71	4	yes
GATCCTGAGAAAATCAGGGC	26	6	yes
GATCCTGACTTCTAGCTGTG	27	4	yes
GATCCTGACCGAGCGTGGCT	24	5	yes
GATCGTTTCCCTTGCATGCC	218	85	yes
GATCTTTCCACCAAGCCATA	38	8	yes
GATCCAGGCTCGGGAGTGCC	16	16	yes
GATCCTGACCATCACTATAC	81	7	yes
GATCCTGACCAGGGGGAGTC	76	17	yes
GATCCTGAATTGCTGGAGAG	27	21	yes
GATCCTGAAGTCTGCAGACC	266	29	yes
GATCCCGGGGCTGTAACTGT	238	41	yes
GATCCTGAAGATGTGGACAC	58	14	yes
GATCCTGAACCCACCCCCGT	125	6	yes
GATCCTGAACACTCCTGGGG	14	13	yes
GATCACACCTCAGAGGTGAA	3	3	yes
GATCCTGAAACGACAGTGGT	90	10	yes
GATCCTCTTGTCTGCTTCGC	768	56	yes
GATCCAGGACCTGGTAGCAA	963	110	yes
GATCCTCTTCTGGAGTGTCT	13	3	yes
GATCCAGGAAGTTGGTGAAC	149	25	yes
GATCCTCTTCTCCGCGTGCC	263	36	yes
GATCCTCTTCCACGAGACAC	8975	618	yes
GATCCTCTGGCACGCCTGGC	85	24	yes
GATCCTCTGCAGTATCCAGG	60	6	yes
GATCCTCTGCAGAGGAGTAT	9	7	yes
GATCCTCTGACATCAGAAGC	8	12	yes
GATCCTCTGAAAAACCAAGA	10	7	yes
GATCCTCTCCAAGGAGGAGC	78	37	yes
GATCCTCTACTACTGCAGAC	11	7	yes
GATCCTCGTTCCTTGTCCTA	9	6	yes
GATCACTGGGGAGAAGTTAT	53	11	yes
GATCCTCGGGGTGCCAGCCA	26	8	yes
GATCACTGCGGACATGCTGG	35	2	yes
GATCACTGAGGATGGCTGAC	111	3	yes
GATCCTCCTGGCTAACTTCT	5	5	yes
GATCCCAAACATTTGTCGGA	15	4	yes
GATCCTTCCTAGAGTCACTC	9	5	yes
GATCCAGCAGCGCAGGCAGG	489	90	yes
GATCACGTTCTGCTTGGAAG	57	19	yes
GATCCTCCTCCCCCTACCTT	5	4	yes
GATCCTCCTCCAAGTCTGAC	48	6	yes
GATCCTCCCGTATGCCAACC	203	24	yes
GATCCTCCCCTGGCCTCAGT	105	14	yes
GATCCTCCCCTGCCCTACAC	105	23	yes
GATCCTCCCCGCTCGCTCAC	119	26	yes
GATCCTCCCCCTCTGTCTTT	95	22	yes
GATCCTCCCAGACCCTCTGA	89	15	yes
GATCACCGACCAGTCTGGGG	3	4	yes
GATCCTCCAGTCTGGTAGTG	3	4	yes
GATCACCCGACGCAAGTGGG	6	5	yes
GATCCTCCAGCAGCCTTTTG	12	10	yes
GATCTTCTCAGCCGGAGTTT	8	6	yes
GATCCTCCACTCTTCTGGAA	229	3	yes
GATCACCATTTCTGACTGTG	10	10	yes
GATCCTCATCATCGCGGGTA	213	20	yes
GATCCTCATCAGTGTGGCCA	113	20	yes
GATCCTCAGGAGTCAGTATT	99	7	yes
GATCCTCAGCCTCCCAGAGC	337	58	yes
GATCCTCACTGTGAAAGACA	3	3	yes
GATCCTCACTGACAGATGGG	69	16	yes
GATCCTCACCCCGCCTGCTG	17	16	yes
GATCACAGTTCCTTATTGTG	13	16	yes
GATCCTCACACCCTGTTCCC	5	8	yes
GATCCTCAAGTCGGTGGTGG	2	1	yes
GATCACAGGCAAGGAGGATG	8	2	yes
GATCCTGCCCTTCACCTCGG	2	2	yes
GATCATGATTTGGAGAGAGG	11	14	yes
GATCCTATCTCGCCCAGTGA	258	44	yes
GATCCTAGTCCTTGCCCCGT	10	10	yes
GATCACACTTACCAGTCAGC	184	29	yes
GATCCTAGTCCACCTCCTTC	53	9	yes
GATCACACTGTCTTGGAATT	17	5	yes
GATCCTAGTCATTATCTCCT	3	3	yes
GATCCTAGCAGCGGCGGTGG	2	2	yes
GATCCTAGAGCACTTGAGGA	31	10	yes
GATCCTAGAGACAGGCCATC	40	2	yes
GATCCTAGACTCTCCTTGTT	104	12	yes
GATCCTAGAAGTGGTCCTTG	14	1	yes
GATCAGCGGTTTTTATCCTC	2	1	yes
GATCCTACTTTCAGCTGCTC	59	10	yes
GATCCTACTCGAACAGGAAG	66	20	yes
GATCCTACGCAGGGGGGACT	267	60	yes
GATCCTACCTGCTCATCTGG	106	39	yes
GATCTGCTGCAAATTGGACC	4	4	yes
GATCCTACCACTAAGGAAAG	7	6	yes
GATCCTACAGTCTGGAATCC	6	5	yes
GATCAATTTGCCACCGTGGT	25	24	yes
GATCAATTGGAACCGGCTTT	60	12	yes
GATCAATTCCCATTCCACTT	12	11	yes
GATCCTAAGCAAAGGGACTC	78	5	yes
GATCCTAACTTGGAAACTGT	28	14	yes
GATCCTAACACTTCTACAGA	57	4	yes
GATCCTAAATGTGTGGAAGA	34	2	yes
GATCGAACGTGAGCTTGATG	1	1	yes
GATCATGTGTGTAGCCAGAA	141	7	yes
GATCCGTTTCTCTCTGCCTT	55	11	yes
GATCCGTGTGAGGTGTGCTG	174	23	yes
GATCAAGTCTTGTCATAGCT	14	13	yes
GATCCGTGCCCTGTAAAGTG	19	9	yes
GATCCGTCGGTGCCTGCTGG	286	17	yes
GATCCGTCCATGTCTGCCAC	13	7	yes
GATCCGGTCCCAGCCCCCGA	236	11	yes
GATCCGGGCTGCACATCAGC	65	5	yes
GATCCGGGACAGGACGGTCT	16	1	yes
GATCCGGCTTCCCAAGAGTA	14	11	yes
GATCAACCTGGAGTTGTATG	31	29	yes
GATCGTCCTCTGTGAGCTCA	12	1	yes
GATCACTGCCATGTGGCCTG	2	3	yes
GATCCGCTGGGAGCTCACAC	90	16	yes
GATCCGCTATCTGCACCTGA	1	1	yes
GATCCGCGGGGCTCAGTGTG	59	26	yes
GATCCGCGGGCGTAAACGCT	9	10	yes
GATCCGCGAGTACACGGCAG	25	24	yes
GATCCGCCTGTCTCTGTCTC	6	5	yes
GATCCGCCTCTTCCTGGTCA	142	12	yes
GATCCGCCTCTCACCAGCCA	17	6	yes
GATCCGCCGTTCTCTGGAAC	22	3	yes
GATCCGCCAGGACCGAGAAC	5	5	yes
GATCCGCAGTGTCTTGGATG	85	2	yes
GATCCGCAGGGAAGTGAGGA	4	5	yes
GATCCGCAGGCGCAAGGCCC	1538	539	yes
GATCCGCAGCCGCCTAACTG	126	19	yes
GATCTGCGGCTGCAGGACCA	1	1	yes
GATCCCCGCGCAGAAGTAGG	92	16	yes
GATCTTCCAGAGCCTCAGTG	95	7	yes
GATCGTGTGCATATGGTAGG	39	26	yes
GATCCCTCGTCAGATTCCTG	11	1	yes
GATCTGGGCTTCCTGGGTGA	2	3	yes
GATCTGGGCTGTCACTACGA	86	11	yes
GATCTGGGCAACGCAGACGC	1	1	yes
GATCTGGCACTCGGAGCCCA	55	4	yes
GATCTTCTCCAATAAATGGG	28	30	yes
GATCGAAAAGCAAATGTTGA	6	5	yes
GATCTGGACAGCAAACTCGT	60	65	yes
GATCTGAGCAGTATTTGTTA	2	2	yes
GATCTGGCACACCATTGAAA	2	2	yes
GATCCTTCTGTCTCAGCCTT	1	1	yes
GATCAGACAGAGGTCAGAGG	65	5	yes
GATCTCTCCATTCCTGGTTC	18	1	yes
GATCTCTCAGGCTTCTCTCA	5	5	yes
GATCTCCTTTGACCCTGAGA	43	30	yes
GATCTGCCTGGAAATCCTAA	32	2	yes
GATCTACAATCATGCTTGAC	4	7	yes
GATCTGCCCATCTCTGCTGC	14	3	yes
GATCGCTGCTTGTGGGGACC	106	6	yes
GATCGAGAGCGTGGATGACT	18	28	yes
GATCGACCGCATGGTCAGCC	178	17	yes
GATCGACATGTTCCTCCACA	46	4	yes
GATCCTAGTGGGTCTACCAC	8	8	yes
GATCCTTCTTGCTCATAAGC	2	2	yes
GATCCTGTCCCACAAAGGAA	3	3	yes
GATCTGATTGATAGTGGCTG	43	12	yes
GATCCTGGCTGCACATGGGC	8	6	yes
GATCCTCCCCACGTAACCCA	38	6	yes
GATCCTGATGCTGCCAAAGC	401	24	yes
GATCCCGAAGTCTGTGACGC	171	22	yes
GATCCCGAACTGTTCAAACA	5	5	yes
GATCCTGGAGAAGCTGCTGA	4	5	yes
GATCCCATCCACCATTCTGC	18	14	yes
GATCCCAGTGTGTCGTTGAT	4	2	yes
GATCCCAGCCATCTCAGCCC	45	10	yes
GATCCCAACGAACCCACATA	105	28	yes
GATCCATTTTTCCCTCTCTG	10	7	yes
GATCGAGCCATGAATCATCT	1	1	yes
GATCCAGGTGTCAGAGCGAG	14	3	yes
GATCCAGTGTGGAGAGAAAT	10	10	yes
GATCCAGCCAGAAGGCACAA	133	18	yes
GATCCAGCAAGCCTGCAGTC	6	5	yes
GATCCAGAGTGGAGAGTGTT	17	16	yes
GATCCAGAGTAGCCATCACC	3	4	yes
GATCCAGACCTTTCACCTGT	3	1	yes
GATCCACTAATGCTGAGCAC	18	5	yes
GATCCACAGCCCGTTTTGTA	29	0	yes
GATCTCTGCATTCTTCACGG	13	10	yes
GATCGGCCGGAGCCCTTCCC	32	30	yes
GATCCACGCCGCTCACGTAA	1	1	yes
GATCCACAAATGCTGTATAC	15	12	yes
GATCCAAGTTCAATTCCCAG	9	9	yes
GATCCAAGCACTGACACTGG	69	13	yes
GATCCAACACCATCTTCTGG	20	18	yes
GATCATGGCTGCTACCAGGA	4	6	yes
GATCCCCACCAGTTTTTTGA	1	1	yes
GATCCCCGGTTCTGCAGCCC	20	9	yes
GATCATATCCACCCTCCCAC	45	11	yes
GATCATAGGCAAACGTGGCA	934	114	yes
GATCATGGTGGAGGGCGGTG	46	7	yes
GATCAGCTGCTCACGCTGAT	22	20	yes
GATCCAAAGCTCTATTGTAC	14	13	yes
GATCTCATTTCAGAAGAACG	20	3	yes
GATCTATGGCAGAAGTCCAG	2	2	yes
GATCGAATTGGAGAAGGAGC	1	1	yes
GATCCAGGGTCTGGGTATAT	85	23	yes
GATCCAGAAGCTCCAATTTC	15	14	yes
GATCCACTCCAAGTCGCACA	3	0	yes
GATCTGTTACTCTGAGCGGC	5	2	yes
GATCTTTAAGGGTCAGAATC	32	9	yes
GATCTGCCATTTAATTCTGT	2	0	yes
GATCACTACAACCATGTTAG	22	2	yes
GATCCACTCCCTGTACCGCC	197	40	yes
GATCTAAGTGCATGTTGTGT	3	1	yes
GATCGGATTCCCATTCTTGG	1	1	yes
GATCCCAAGTACTGCCTGAA	1650	156	yes
GATCGAAAACATCACAAATT	1	1	yes
GATCCCAACTACAAGCAGCA	4	4	yes
GATCAGCACTTTCATCGACA	5	5	yes
GATCCTTGAGTCGAGGCCTC	2	0	yes
GATCCCTGCTTCTTACCTCC	1	1	yes
GATCAAGAAAGAGATGGGAG	206	17	yes
GATCCATGGCACCAAACCAC	3	4	yes
GATCCAGTGGGAAGCGCGGA	32	11	yes
GATCCATTGCTCATAGGCTC	4	4	yes
GATCAACAACAGGGCATCGG	121	60	yes
GATCCACGTGTAAGTCTGTC	2	1	yes
GATCCACACGTGTGTGAACA	48	8	yes
GATCCCTCCAATCCGGAAGT	6	4	yes
GATCCCGGTTCACTTCCTCT	23	4	yes
GATCCCTGCTGGAAGAAGTC	43	9	yes
GATCCGCAATCCACGTGGGC	16	4	yes
GATCCGCAAATACGGGCTGA	74	7	yes
GATCCGAGGCACCAGCTACC	208	48	yes
GATCCGAGCCCCAGCGGGAA	133	11	yes
GATCCGAGCAATTGGCAAGA	47	12	yes
GATCCGAGATATACGCAGGA	53	25	yes
GATCAATTGTGAACCTGTGG	44	41	yes
GATCCGAGAGACCAGCCAGA	381	47	yes
GATCCGAGACCTGGCAGAGC	95	150	yes
GATCCGAGAATTCCAGGACT	10	10	yes
GATCCGACTGTGCCCGGATG	75	18	yes
GATCCGACGCACCAGCATCG	7	7	yes
GATCCCAGCAAATAAACCAG	28	2	yes
GATCAGTACCTGGGAAGTAC	17	5	yes
GATCAAGCATTTGCGCCTGA	9	9	yes
GATCCGAAGGGCGGCCGCTG	12	12	yes
GATCAACCACCCAGACCACA	80	49	yes
GATCCGAAGAGTCATTCGTT	11	17	yes
GATCCGAAGAAACTGGCTGC	53	20	yes
GATCCGAACCACTGCCAGAG	22	20	yes
GATCCCTTCTGGTGCACACT	57	9	yes
GATCCCTTCTGGGACTCCCC	85	27	yes
GATCCCTTCTGATTCTTTCA	2	1	yes
GATCCCTTCTAAGTGCCAGT	232	11	yes
GATCCCTTCCCTTCCTTGTG	146	3	yes
GATCCCTTCCCTGATGTTGG	168	23	yes
GATCTTTGGTGGATTGTGTC	37	14	yes
GATCCCTGTGGACAACAAGG	130	11	yes
GATCCCTGTGACACCAGCAT	20	3	yes
GATCCCTGGTTGCTCCCTCT	123	3	yes
GATCCCTGGTGCTGCAGTGG	192	2	yes
GATCCCTGGGCCCCCGGGTC	50	54	yes
GATCCACATGTCACGGAGGT	2	3	yes
GATCCCTGCTTCCAGCTTCG	162	19	yes
GATCCCTGCTGGGTACTTGA	801	80	yes
GATCCCTGCTCTGGCCCACT	82	99	yes
GATCCCTGATGCAAGCTGGC	23	25	yes
GATCCCTGAGCTCCGAGCAG	9	9	yes
GATCCCTGAGAAAATAAGCT	5	6	yes
GATCCCTGAATGCCAACCTG	2	2	yes
GATCCCTCTTGGGCCGAGTA	56	38	yes
GATCCCTCTCTTGCTGTAGA	4	3	yes
GATCCCTCTCCCTGCCTCAA	24	2	yes
GATCCCTCTCCACAGGGTCT	46	16	yes
GATCCCTCTCACAGGCTTCG	54	5	yes
GATCCCTCAACTACAAATGT	8	12	yes
GATCCCTCAACACTGAGTCC	10	8	yes
GATCCCTACTCCAAGGTGAA	23	19	yes
GATCCCTACACTAAGCTGAC	24	19	yes
GATCCCTAACCCTGGGCTGG	180	19	yes
GATCCCGTGTATGTTATGAC	1	1	yes
GATCCAGCTCAGATAGACTG	25	24	yes
GATCATTGCTCAGGGAGATT	97	16	yes
GATCCCGGTGTATCATGGCA	173	4	yes
GATCCCGGCAAGAAGAGCAC	57	12	yes
GATCCCGCTATAGTTTCATC	3	4	yes
GATCCCGCAGTGGCAAGGTC	112	2	yes
GATCCCGAGCAGACACTGCA	64	1	yes
GATCCCGACACGGACTCTGA	26	7	yes
GATCCCGAATTTTCCTAAGG	93	16	yes
GATCCCGAAACCCACCAAAG	51	37	yes
GATCCCCTTGCTTATATCTC	5	5	yes
GATCCCCTTGATTGCCCTGA	142	13	yes
GATCCCCTTACAGCTGGCAT	84	7	yes
GATCCCCTGGGCCAAGTCAG	8	6	yes
GATCCCCTCCTTAGTCTTAG	51	22	yes
GATCCCCTCCCCTGGTGAAC	316	55	yes
GATCCACTTGTGTTGGGAGC	6	10	yes
GATCACAGTCTGCTGCCCCT	13	1	yes
GATCCCCTCCCATAGGTAGC	328	44	yes
GATCCCCTCAGGTTGAGGGA	111	24	yes
GATCCCCTATGGAGACAGGG	24	23	yes
GATCCCCTACAGTTTCTTCA	16	15	yes
GATCCCCGTTTTCTCTGCAG	82	4	yes
GATCCCCGGGGGAGGGAGGG	1	1	yes
GATCCCCGGCAAAACCACAT	2	3	yes
GATCCCCCTTTTCAGCCCTG	101	28	yes
GATCCCCCTTACAAACACCA	66	26	yes
GATCCCCCTCTGGGAGAGCC	54	1	yes
GATCCCCCCTCTGGAAGGCG	76	26	yes
GATCCCCCCTCACTGACTGA	80	2	yes
GATCCCCCCGGAGGACTACG	36	17	yes
GATCCCCCCATTGGAGATGT	5	4	yes
GATCCCCCAGTTGTCACCCT	57	10	yes
GATCCCCATTGCTCCCCAGT	41	31	yes
GATCCCCATTACCTGAAGAA	8	10	yes
GATCCCCATCTCCATCAACA	365	36	yes
GATCCCCAGGGCCTCAATGA	113	6	yes
GATCCCCAGCTTCTAGGAAA	1	1	yes
GATCCCCAGCCACAGAATGG	259	10	yes
GATCCCCAGAGGCTACCACC	16	3	yes
GATCCCCAGAAAGGTGGTCG	71	8	yes
GATCACCAGCTGGCTTTAAC	2	2	yes
GATCACTTCCAACAAGCTGG	1	1	yes
GATCATCCGCATTGTACAGG	37	0	yes
GATCATCACGCAGACCTGAC	11	11	yes
GATCCCCACCACACCCTGAG	200	107	yes
GATCCCCAATGGACCACAGT	8	7	yes
GATCCCATGTACCCAGGAAT	15	12	yes
GATCCCATCCCCTTGCCACA	6	7	yes
GATCCCATCCAGCCCTCCAG	195	21	yes
GATCCCATCATGGGTTTCCA	88	4	yes
GATCCCATCATGCCCTGAGC	386	84	yes
GATCCCATAGCAAGAGAGGG	171	10	yes
GATCTCAAAGTAACACTGTG	33	6	yes
GATCATAGACTCCAGGGCTG	1	1	yes
GATCATACATGGGCAAAGAG	6	7	yes
GATCAAGTTGTGGTAAACTG	30	5	yes
GATCCCAGGGCTGACCATCA	17	20	yes
GATCAGTCGAAGGGACCCCC	8	8	yes
GATCCCAGGAGAGTCTGCCC	98	17	yes
GATCCCAGGACTTACTGGGG	46	11	yes
GATCCCAGCCACTTTGAGTA	23	6	yes
GATCCCAGCATGGTCAGCGC	143	11	yes
GATCCCAGCAGCAGCATCGT	2	2	yes
GATCCCAGCACCTCTCTACA	7	4	yes
GATCCCAGAGACATCAGGCA	17	2	yes
GATCTATTCGCGCCTCCCGG	14	1	yes
GATCCCAGAAGGTCGATGTA	1	1	yes
GATCAGTCACTCACAGAGGC	103	5	yes
GATCAGGTGCAGCTACCGCT	10	7	yes
GATCCCACGAACTGGCCCGA	10	10	yes
GATCAACGGGCAGACAGTGA	1	1	yes
GATCCCACCTCAAACTCGGT	18	13	yes
GATCCCACCGTATCCACCAG	1	1	yes
GATCCCACCCTCACCCCACC	143	8	yes
GATCCCACCCAGTAGCCTAA	15	2	yes
GATCAACCCTGTGCCACGTG	7	7	yes
GATCCCACCATCCCACTGGA	112	23	yes
GATCCCACAGGTCTTTCATG	65	5	yes
GATCCCACACAGGTGACAGG	19	1	yes
GATCCCAAGGTTTCAACACA	18	4	yes
GATCCCAAGGCCTATGTCTG	1343	68	yes
GATCCCAACCTTGGCCCTGA	40	2	yes
GATCCCAACCCTGAGAACTT	302	14	yes
GATCCCAAAGCCTCTGTTGC	85	20	yes
GATCCCAAAGCACAATCTCC	144	16	yes
GATCCCAAACAGGCGCACGA	45	18	yes
GATCCTGTTCCCAAAAAAAA	3	3	yes
GATCCATTGGTGGAGTATTC	33	1	yes
GATCCATTGCCTGGACTGAG	128	17	yes
GATCCATGTTGGTCATCTTT	7	3	yes
GATCCATGTGGTAGATACTA	27	29	yes
GATCCATGTCCCACAGTAAC	13	3	yes
GATCCATGTAACTGTTCCAG	125	16	yes
GATCCATGGATTAGCTGTAG	188	1	yes
GATCCATGCTGTGCGCTACC	84	10	yes
GATCCATGCGTTCTCTGCCA	72	10	yes
GATCCATGCCTATCGAAAGC	28	3	yes
GATCCATCTGCATTTGCGGT	72	16	yes
GATCCATCTCTTCCGGACAT	23	9	yes
GATCCATCTCCCAGACTTAT	10	10	yes
GATCCATCCTAGGGTCTGTG	36	6	yes
GATCCATCCGTAAGCCCCGG	5	4	yes
GATCCATCCCCAGTGCCCCT	38	7	yes
GATCAAGGTGACCAAAGATG	12	11	yes
GATCCATCCCACTTTGTCTT	2	2	yes
GATCCAGTTTTGACAGTGAC	89	13	yes
GATCCACTGCTGAGCTAGAG	76	12	yes
GATCCAGTTGCCTGTACAGA	5	4	yes
GATCCAGTTCCTCACCTTCA	2	2	yes
GATCCAGTTATTCAGTGGTT	2	3	yes
GATCCAGTGCTTCAATGATG	71	8	yes
GATCCAGTCGAGAAGGACGC	5	8	yes
GATCCAGGTGCTGTGGACTT	228	6	yes
GATCCAGGTGAAGAACGAGG	1042	60	yes
GATCCAGGTCGGTCACCAGG	30	0	yes
GATCCAGGTAGGATTCACTC	12	12	yes
GATCCAGGGTCCTGCATCGG	154	25	yes
GATCCAGGGGCTGCAGCAGT	23	36	yes
GATCTCTACGGCCCTGCCAG	59	17	yes
GATCGCCCGGAATTTCTATG	5	4	yes
GATCCAGGTAGCCGAGTTCT	40	8	yes
GATCCACGAGCCCAAGGGCT	76	56	yes
GATCACTTCACCATCCCTTC	8	4	yes
GATCTTCAAGTGAACAAGTC	30	32	yes
GATCCTGATTCCAGATTGTG	1	1	yes
GATCTCTGTTCCTGGCTGAG	2	2	yes
GATCAGGTCTGATTGTTTTC	4	4	yes
GATCCTGTAGGTCAGATGGT	1	1	yes
GATCTCTGGGTTCAGGTTTG	1	1	yes
GATCAGCAGGGGAATGAGGA	18	4	yes
GATCAGACAGGGTGGTGGTT	15	5	yes
GATCAGACACTCTGAGCTTG	45	11	yes
GATCTCTGACAAGGATTTCC	3	4	yes
GATCCTGGCCACACCGGCAG	30	2	yes
GATCTCGTCAGTCCTGTGTT	19	1	yes
GATCCTGCTTTGCTGCGCCC	7	5	yes
GATCACTCTGAAAGTTACTC	32	19	yes
GATCACCTTTACCAGTGTGA	21	3	yes
GATCACCGTGCTCCATGTCT	27	7	yes
GATCACCCAAGTCCTGCATT	1	1	yes
GATCACCAGCAACCAGATGC	25	7	yes
GATCACCACGTCCAGACGGC	4	4	yes
GATCACAGAATGGACAGGAA	59	13	yes
GATCACAAAAGGCCTTGCAA	21	19	yes
GATCCTCTCTCTAGGGCAGC	62	4	yes
GATCCTCCTTTGAAAAAGTC	13	14	yes
GATCAAGGAAGGAAGGAAGG	20	18	yes
GATCCTAAGAGCTTTTACCC	12	11	yes
GATCAACCAGGTTTGGCTTT	17	5	yes
GATCCTTTCCTGTGGCTACT	281	38	yes
GATCCCGGTCCAGACCGGAT	21	2	yes
GATCTCCCCTGAGCAGAGGG	263	95	yes
GATCTTTGGTTTCGTGGCCA	403	144	yes
GATCTTTGACAACCCTGTGG	90	41	yes
GATCCTGAAGTGCGTGGTGG	27	1	yes
GATCTTGTTTTGAACTCAGA	33	7	yes
GATCTCCAGGTGTGGCAGTC	9	10	yes
GATCCTCAGTCAAGGTACAG	12	6	yes
GATCTCCACACAGAAATGTA	1	1	yes
GATCTTGGATGAGCCCGTGG	45	49	yes
GATCTTGGAGTACCCAGGTG	9	10	yes
GATCTTCTGGAAGCTCCAAA	4	4	yes
GATCTTCTGAAACACAAGCG	25	27	yes
GATCTTCCCCGAGGGTCGGC	140	23	yes
GATCTTCAGTATGCTGCTCC	20	14	yes
GATCTTCAGATGCAATGGTT	9	10	yes
GATCTTCACCTAAGTAAAGG	4	6	yes
GATCCATCTTGTGTCCCTCT	148	3	yes
GATCTGTTTGGCCAGGCAGC	43	4	yes
GATCTGTGACAAGAACCTGG	95	0	yes
GATCTGTCTGCCCCTGCCCT	8	9	yes
GATCTGTATGTGATGAGAAG	27	29	yes
GATCTTAAGAAGGCACAGGA	20	21	yes
GATCTGTAGAAATGACCTGT	37	40	yes
GATCCCCACGGCTGGTCTGA	31	21	yes
GATCTGGTGCCCTGCTGCTT	91	16	yes
GATCTGGGGTAGATTCTGAT	135	92	yes
GATCTGGGCCTCTTTCCACG	18	4	yes
GATCTGGGATTGGCTCAAGA	312	165	yes
GATCTGGATGTTGGTCATGG	27	3	yes
GATCTGGAGGAAGCCTGAGG	170	50	yes
GATCTGGACCCGAGCGGTCA	13	21	yes
GATCCATCTTGCGCTGCCAT	33	3	yes
GATCCAGTTCTAAGCAGATT	304	33	yes