#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCATAGTGGACGTTGTTA	161	20	yes
GATCAAGCACATCTGTGCTG	10	3	yes
GATCAGTGTGTGCCAAGGAG	83	8	yes
GATCAAGAGAAAGAAGTGGG	47	10	yes
GATCAGTAGAGCTTGGACCC	78	7	yes
GATCAGGGCAATGGTCACTG	2391	19	yes
GATCAAGACGCAGGTCGAGG	4	3	yes
GATCAGGCTCTTTGTTTGTG	9	10	yes
GATCAGGCGTGAGCTTCAGA	2	2	yes
GATCTGGCCAACGGCAACAT	174	14	yes
GATCTGGCAGTCATAGCTTG	309	18	yes
GATCTGGCAAAAACTACGGG	54	12	yes
GATCTGGATTTGGTTGAGAT	2	2	yes
GATCTGGAGAAGAATGGTCG	11	1	yes
GATCTGGACTTTGCTCAACC	19	1	yes
GATCTGGACTGGTGTTTCTT	12	13	yes
GATCTGGACTCACCTGGGAG	93	2	yes
GATCTGGACGATTCTGAGCC	131	118	yes
GATCCTCCTGTTCTCTGGTA	116	5	yes
GATCCTCCTCACCTAAATGG	46	3	yes
GATCCTGTGTTTGAATGACA	23	6	yes
GATCAGGCCCACTCCAGGAG	21	20	yes
GATCAGCCTACGCTCACATT	68	24	yes
GATCACCAAGTGGTACCTGG	30	6	yes
GATCAGACTGTTGCTTTCGC	132	5	yes
GATCAGCACCAAGTGACTTG	30	2	yes
GATCAAGAACACTGTCTCTC	5	1	yes
GATCAGAGTACTCAAGAGAG	52	2	yes
GATCTGCTTTTTGAAATGAA	38	5	yes
GATCTGCTTTGTGCTTGGCT	48	3	yes
GATCTGCTTTCCCTTTGTAA	109	14	yes
GATCTGCTTGTGTTGTGTTG	85	4	yes
GATCTGCTTGGCTGCCATTA	50	9	yes
GATCTGCTTGCCCCAAACAA	175	25	yes
GATCTCGGTCATCCAGTTGA	13	14	yes
GATCTCGGACGCTCAGTGGG	266	8	yes
GATCTCGCTGGTTCGCACCT	59	14	yes
GATCTCGCTGCATTTACATA	10	2	yes
GATCTCGATTCTACAGTGGT	41	39	yes
GATCAGAACCTTGCCGAAAC	2	2	yes
GATCACTGTTTGTGCCTCTG	462	85	yes
GATCACTGTGTCCCAGGCTG	35	1	yes
GATCACTGACATCTATACCC	13	5	yes
GATCAGAATGGCGGAGGCGG	35	37	yes
GATCACAAGTGGAAAGCAAT	21	1	yes
GATCACTCTTCCCGCTGCTG	34	7	yes
GATCACTCTGGTCGTGTGGG	80	2	yes
GATCAACCGCACACAGGCGG	1	1	yes
GATCACGCTCAGCCCTTGGT	61	7	yes
GATCACCTGTGGAGTTGTCA	1	1	yes
GATCACCTGACTCCTAACCG	66	29	yes
GATCTCCTCTCCAGGGAGCT	52	47	yes
GATCTCCGCAGGAAACTCTT	17	16	yes
GATCTCCCTTCCCCGGGGAA	9	8	yes
GATCTCCCTGTGCCGGTGCC	60	4	yes
GATCACATGGGTCGAGGGTT	89	12	yes
GATCACAGAGTGGGAATCTC	121	15	yes
GATCTTGAAGAAGATGAGGC	91	4	yes
GATCAACACTCCCCACGATG	1	1	yes
GATCACACTGTCTGAGGCGT	36	4	yes
GATCACACTCTGGCCCCCAA	36	9	yes
GATCACACTCACCCCATCCT	50	52	yes
GATCACACGCAGAATGAAGT	19	1	yes
GATCACACCAGAGTCCAGGT	3	3	yes
GATCAATGTGGGCAGAGGGT	10	11	yes
GATCAACAAGAAACTCAACA	3	3	yes
GATCAACTTGGAGGGCTCTT	35	7	yes
GATCTCCAGGACTTGTGTGG	3	3	yes
GATCCCTTCAAGTTCTGTAG	1	1	yes
GATCAACTCTCTCAAGCATG	13	0	yes
GATCAACGTCTGAAAACAAT	4	4	yes
GATCAAATATGTGCCCTATG	3	3	yes
GATCAACAACTACAGGGTGA	5	5	yes
GATCTCAGGGCAGAAATGAT	228	10	yes
GATCTCAGAAAAGTTGCTCT	4	4	yes
GATCTCAGAGAAGCCCTCCC	5	5	yes
GATCAAACCCAGGGCTTTGT	79	6	yes
GATCACTTTATTTGCTAGGG	369	1	yes
GATCAAAGGAAATGGAGCCA	66	1	yes
GATCAAAAACCTGCGGATGG	41	4	yes
GATCAAAGCACTGGCGGGCT	15	4	yes
GATCTTTTTGGCAAGGAAAC	6	6	yes
GATCAAAGAGCACACTGGGG	97	6	yes
GATCAAAGACTGCGACACCA	41	39	yes
GATCTTTTTCTCCATCTCTT	3	3	yes
GATCTTTTGGAACTGGAGTT	1	1	yes
GATCTCACAAAAGTGCTGCT	14	13	yes
GATCAAACGTGGCTGAGCGC	378	40	yes
GATCAAACGTGGCTGAGCGA	50	15	yes
GATCATCTTGTGAAAACCCA	1023	48	yes
GATCAAACCTGAGGGCACAT	28	4	yes
GATCTTTTCCACCTTCAGAG	99	23	yes
GATCAAACCCGTGGAAGAGG	20	8	yes
GATCAAACAGGCTGTCAAGA	68	11	yes
GATCTTTTACTTCGTGGCTG	35	0	yes
GATCAAACACCTACTTCCAT	1	1	yes
GATCTTTGTGGTGTGGGCCA	304	46	yes
GATCTTTGTGAGTTGGAGAC	6	6	yes
GATCAAAACCCATCAACACC	41	2	yes
GATCAAAACCAGAGATTCCA	18	1	yes
GATCTTTGTCCAGTTCTGCA	13	11	yes
GATCTTTGTATGGCGGCTGT	614	60	yes
GATCTTTCTGGCAAGGAAAC	3844	159	yes
GATCGCCTTTCTTACAACCA	2	2	yes
GATCATCCAGAACACAGCCT	98	3	yes
GATCTGCGCTTCCAGAGTGC	3066	133	yes
GATCTCGAGAGGCTTTGTGT	69	25	yes
GATCCTGAGCTTTGACAAGA	9	8	yes
GATCCTGAGCCAGATGTCAT	15	4	yes
GATCCTGAGAGCCTCATCCT	18	21	yes
GATCCTGACTTTGCCAGCTG	21	8	yes
GATCCTGACTCTGACACTAC	197	13	yes
GATCCTGACCTGGGCTTCCT	248	5	yes
GATCCTGACCACATGAACAA	680	10	yes
GATCCTGACATAAACCCTTG	13	4	yes
GATCCTGACAGAGCCTTGGT	612	32	yes
GATCCTGAATTCAAATCCCA	9	8	yes
GATCCTGAATGACGTTCAGG	349	41	yes
GATCCTGAAGTGGCCTCAGC	44	9	yes
GATCCTGAAGGTCATCCGCA	4	3	yes
GATCTGCCTGCCTCCACCTC	38	5	yes
GATCCACGCGAAAAGCCGGG	44	3	yes
GATCCGATTTCTGTGTCTGA	145	14	yes
GATCCTGAAAGCCAAGTTAG	298	46	yes
GATCCTCTTTGCCAACCCCA	13	11	yes
GATCCTCTTTGCACAGAAGA	68	7	yes
GATCCTCTTGCTGAAGAAAA	5	4	yes
GATCCTCTTGCGGGACAGTC	89	4	yes
GATCCTCTTGATTCCTTCTG	7	6	yes
GATCCTCTTGATGCAGAGAG	38	3	yes
GATCCTCTTCTTCAGCACAC	536	24	yes
GATCCTCTTCTGCTGTTCTG	2	2	yes
GATCCTCTTCCTGCTCCAGC	49	6	yes
GATCCTCTTCCCATCCATCC	24	6	yes
GATCCTCTTCATCTTGGGCA	316	26	yes
GATCCTCTTCAGCCCTGTGA	6	5	yes
GATCCTCTGTTGGGGCCTCG	89	8	yes
GATCCTCTGTGTCCTTATTT	6	5	yes
GATCCTCTGTGGACTCATCT	13	12	yes
GATCCTCTGTGCCTCACTCC	97	15	yes
GATCCTCTGGAATGACATTG	6	2	yes
GATCCTCTGCTTTAAGTCCT	3	3	yes
GATCCTCTGAGGCAGTATTG	279	35	yes
GATCCACCCCTTAAGAACCA	53	13	yes
GATCCACCACTAAAAGTAGC	1	1	yes
GATCAAGAAATGTCCTCTGT	21	8	yes
GATCCACATGGTTGCCTGCT	4	3	yes
GATCCTCTCTTGTGCTACCT	36	1	yes
GATCCTCTCTGAACCTCCTG	53	5	yes
GATCCTCTCTCGGTGTGGTT	28	4	yes
GATCCTCTCATTCAGTCTTC	39	9	yes
GATCCTCTCAGCTGGATGCT	37	2	yes
GATCCTCTCAGAGGATTTCA	2	0	yes
GATCCCAAATGGCCCATGCA	27	5	yes
GATCCTCTAGGGGTTATGGG	128	8	yes
GATCCTCGTCACCACAGTTG	2	2	yes
GATCCTCGGGCAAGCCAAGA	907	28	yes
GATCCTCGGGAGACCACTGG	299	17	yes
GATCCTCGGAGGCTACCGAG	45	17	yes
GATCCTCGCCTGTTGGAGGA	51	3	yes
GATCCTCGCAGCTTCTATGA	293	17	yes
GATCCTCGACAGGAAGCCAC	11	10	yes
GATCCTCCTTTTCTTGGCGG	7	0	yes
GATCCTCCTTGTCAAGTACA	1221	305	yes
GATCCTCCTGTGTCTTCCTC	5	4	yes
GATCCTCCTGTGAAGTGCCA	4	3	yes
GATCCTCCTGCGTGCTGACA	52	6	yes
GATCCGGTCCATCGTGCGAG	6	3	yes
GATCCTCCTGCCCCTCCAAT	69	14	yes
GATCCTCCTGCCCCGACAAG	25	1	yes
GATCCTCCTGAGTGCTGGGA	246	22	yes
GATCCTCCTCAGACTTGTCC	38	7	yes
GATCCTCCGTGAGTATGCCT	160	2	yes
GATCCTCCCCTTTACGGACA	85	17	yes
GATCCTCCCCCTCTCCCACC	66	7	yes
GATCCTCCCCAGGGATGGGG	215	21	yes
GATCCTCCCAAGTGAATGAC	263	9	yes
GATCCTCCAGTCAGTCTATT	213	1	yes
GATCCTCCAGGACAAGGGGT	176	3	yes
GATCCTCCAGCAGAGTGGAC	12	1	yes
GATCCTCCAGCACCAGGCAT	16	5	yes
GATCCTCATGTTCAGTTTTT	39	3	yes
GATCCTCATCTTCATTCCTT	2	0	yes
GATCCTCAGTTACTCGCTGC	78	6	yes
GATCCTCAGTGCTACTTGCG	33	2	yes
GATCCTCAGGGTCTGCCCTT	51	3	yes
GATCCTCAGGAGTTGCAATG	487	22	yes
GATCCTCAGGAAACAGTCTC	35	31	yes
GATCCTCAGCTGGCTGGAGC	94	11	yes
GATCCTCAGCCACCCACAAC	2	2	yes
GATCCTCAGATTAGATGTTT	49	7	yes
GATCCGAGCAATAGGCAAAA	18	0	yes
GATCCTCAGAGACGTGCTCG	58	1	yes
GATCCTCACCATCCACGTTT	107	3	yes
GATCCTCACCAGCCGCGGGC	590	44	yes
GATCCAGTGCCTGTGTAGAA	118	4	yes
GATCCCTGCTCTGCAATGAG	1	1	yes
GATCCAATCAATCTCCCCGA	8	8	yes
GATCCTCAACAAGATGCTAT	86	3	yes
GATCCTCAAACAGACATTGT	18	3	yes
GATCCTATTCTTAGGTCTAA	13	6	yes
GATCCTATTCTCCAAAGACT	29	3	yes
GATCCTATTCCAGCCAAATG	389	13	yes
GATCCTATTAGCCAAACTTT	52	2	yes
GATCCTATGTGTTGGCCATT	13	2	yes
GATCCTATGTGGCTCTAAAA	31	3	yes
GATCCTATCTCCCGGTTGGG	187	1	yes
GATCCCCAGAGTCCTATGTT	31	1	yes
GATCCTATCATTGCTGGTGG	23	1	yes
GATCCTACTGTGGATGACAC	257	12	yes
GATCCTACTGATGAAGTGCC	148	24	yes
GATCCCTGAGCTATTGCTAG	38	5	yes
GATCCAGGTTCCTCCAGAAA	10	2	yes
GATCCCTCTGCTGCTGCTTC	13	3	yes
GATCCCTCTCCCAGGAACAA	56	17	yes
GATCCAAGCTGTCAAGAAGG	821	22	yes
GATCCAAGCTAATCTGAGGA	233	2	yes
GATCCCTCCCAGAAGAATCT	23	5	yes
GATCCAAGCAGCCTTCAGGG	4	0	yes
GATCCTACGGAGCAAGTCTA	140	4	yes
GATCCTACCTTCTGCTTTCG	340	6	yes
GATCCTACCTGAGTGGCAGC	840	45	yes
GATCCTACCATCCCTTTGAT	9	2	yes
GATCCTACCACAGAGCCTTA	71	22	yes
GATCCTACATCCATTCGGCT	79	1	yes
GATCCTACAGTGGCTGGCAA	171	29	yes
GATCCTACAGTCACTTCACA	205	4	yes
GATCCTACACTCCTGGCAGT	22	7	yes
GATCCTACACATGGAGGCTG	99	8	yes
GATCCTACACAGCTAATCCA	5	2	yes
GATCCAGTGTCAACTAAGAA	4	2	yes
GATCCTACACACCTACCAGA	232	24	yes
GATCCTACACACAGTGGTGA	18	9	yes
GATCCTACAAGCCTGTCCGT	44	7	yes
GATCCTAATGATTTCAGCCC	27	30	yes
GATCCTAAGCAGATTCTGGG	93	8	yes
GATCCTAACTGTGGAACCTC	48	7	yes
GATCCTAACTCTGACCTTTC	5	5	yes
GATCCTAACCTAAGATGCCT	39	3	yes
GATCCTAACCCAGTGGACTC	36	10	yes
GATCCCGTGTCCTGCAGACG	39	6	yes
GATCCTAAATTTGACCCAGG	105	5	yes
GATCCTAAAGTTCTTTCAGG	13	4	yes
GATCCTAAAGGCCGGTCACA	314	10	yes
GATCCTAAACTCTGTTGCCA	205	17	yes
GATCCTAAAACTGAGGAAAG	3	1	yes
GATCCGTTTGGCCTCTCAAT	59	11	yes
GATCCTCCTCACTACAAATG	4	0	yes
GATCCGTTGGAAGGTTTACC	36	0	yes
GATCCGTTGCCAGTTACCTG	66	19	yes
GATCCGTTCCTTATTGCCTG	1	1	yes
GATCCGTTCCTAGGGTACCT	122	14	yes
GATCCGTGTGTGTGTGGGAG	494	19	yes
GATCCGTGTGAAACTGGATG	6024	166	yes
GATCCGTGTATGTCTAAACA	25	3	yes
GATCCGTGGCTGCAGCAGAA	51	1	yes
GATCCAAAGGAGCTACTTAG	98	9	yes
GATCCAAAGGAACGTGCAAA	57	8	yes
GATCCCGGAAGGGGAGAAAG	125	2	yes
GATCCAAACCACAGGGATTG	4	2	yes
GATCATCCTGCACCTCCCTC	4	4	yes
GATCCGTGCTGAGCGTCGGC	61	3	yes
GATCCGTGCTGAATTGGTTT	6	3	yes
GATCCGTGCATCTCATTGGC	156	1	yes
GATCCGTGCAGGAGTAATAC	16	1	yes
GATCCGTCTGTGGGGGCCTC	22	7	yes
GATCCGTCGCCTGGAGGTGG	123	6	yes
GATCCGTCCGAGATGGCAGA	16	1	yes
GATCCGTCAGGCTTGCTCGT	116	1	yes
GATCCGTATCAGGTTCATGT	44	4	yes
GATCCGTAGTCTGAGTGATG	111	9	yes
GATCCGTACCCTGGTGCTGA	125	4	yes
GATCCGTAAGAAAGAGAAGG	18	5	yes
GATCCGGTTCTGGGACAGCA	3	3	yes
GATCCGGTCCCAAGACCGCT	369	23	yes
GATCCGGTCCAAGGCTCTTG	301	10	yes
GATCCGGGTGTCCAGTGACA	350	36	yes
GATCCGGGTGATGCGAATCG	15	2	yes
GATCCGGGGGTTCAATTTAT	251	20	yes
GATCCGGGCAAAGCCTGCTC	97	13	yes
GATCCGGGAGGTGTGCGGCT	2698	74	yes
GATCCGGCTGTGCCAGGTGT	10	11	yes
GATCCAAAATGTTCCATGGA	4	0	yes
GATCCCCTGGGAGGTACGGA	28	0	yes
GATCCAAAAAGCAGTTCAAC	2	2	yes
GATCAGTGTGTGCCAAGGAA	2	2	yes
GATCACAGTGCTGACAGAAG	1	1	yes
GATCCGGCAGAAGGATGAGG	133	1	yes
GATCCGGACTCACCTGGGAG	65	10	yes
GATCCGGAAGAAGATGATGG	258	232	yes
GATCCGCTTGGCAGCCATTC	404	24	yes
GATCCGCTTCGTGGAATGGG	61	8	yes
GATCCGCTTACAGAGACTTT	14	10	yes
GATCCGCTGTCAGGAGCTGA	13	2	yes
GATCCGCTGCTGGAAGAACC	38	3	yes
GATCCGCTGCAACCCGGTGC	21	19	yes
GATCCGCTCTGTGGTCGCCT	181	1	yes
GATCCGCTCTGAGGTTCTGT	31	7	yes
GATCCGCTCCTGGCGACTCC	129	3	yes
GATCCGCTCAGAGCCCAGCA	56	6	yes
GATCCGCTCACGCCCAGCAG	15	4	yes
GATCCGCCTTCTACTCGGAA	43	3	yes
GATCCGCCGCTAAGACCTGG	25	3	yes
GATCCGCCCGCTCACACAGG	95	2	yes
GATCCGCCCACACCCACGTG	174	36	yes
GATCCGCCAAGTTATTCAGG	64	1	yes
GATCCGCATGATGGGAGGAG	7	2	yes
GATCCGCATCCGCAAGCCCT	22	0	yes
GATCCGCAGGTCAGATGACA	87	0	yes
GATCCGCAAGGTGCTGGACG	600	2	yes
GATCATTTCGGGCCAGTAGG	223	32	yes
GATCCAGACAGCCATCAAGG	440	38	yes
GATCCCCGAAGTCTCTCTCC	15	14	yes
GATCCCCAGGCTGTTGGAGG	2	2	yes
GATCCGCAACTGTCCGGAAG	3	1	yes
GATCCGATTTCTGATTTTGC	21	19	yes
GATCCGATGGGCCAGCCTTT	609	32	yes
GATCCGATGAGGAAGATGAC	176	9	yes
GATCCGAGTGAAAGCCGGAG	114	20	yes
GATCCGAGGCTAGAGGGAGC	42	1	yes
GATCCGAGGCAGCCAATACA	5	5	yes
GATCCGAGGCAGATTTTCTT	99	27	yes
GATCCGAGCGACTGTCACCA	134	11	yes
GATCCGAGCAGCCACATTCC	81	6	yes
GATCCGACAGGAGGGTGTAA	307	20	yes
GATCCGAATTGCAGAGCTGT	116	11	yes
GATCCGAATAATCCAGGAGG	5624	190	yes
GATCACAGAAGAAGTCATCA	16	3	yes
GATCTGCTTCCTGAAGAGTG	13	11	yes
GATCTGCTTCCCATTGTGGT	99	2	yes
GATCTGCTTCCCAACTGTTA	68	9	yes
GATCTGCTTCCATCCATCTC	52	12	yes
GATCCTAGCTCAGAGAGGCT	299	10	yes
GATCTGCTGTTCCTCACGAA	59	16	yes
GATCTGCTGTCTACTACCTA	58	1	yes
GATCTGCTGGTCATTAAGGG	196	7	yes
GATCTGCTGGAAGATAATCT	39	6	yes
GATCTGCTGCAGGGTTCTGT	391	26	yes
GATCTGCTGCAGCTAAAGTA	59	6	yes
GATCTGCTGATGTTACGTCG	65	2	yes
GATCTGCTCTGATGGTATGT	25	23	yes
GATCCAAGAGCAGCTCCCCA	16	1	yes
GATCTGCTCTAACCAGGCGT	2	2	yes
GATCTGCTCCTTCTGTCCCA	519	3	yes
GATCTGCTCCTTAACGTTTT	19	17	yes
GATCTGCTCCCAAGTTATCT	163	17	yes
GATCTGCTCCAACTACAGGA	42	5	yes
GATCTGCTCACTCTATTACT	2	2	yes
GATCTGCTCAACAACTCCTT	9	8	yes
GATCTGCTCAAAATCAAGAA	11	10	yes
GATCTGCTATGTACTCCAGG	361	3	yes
GATCTGCTAGAGCTGTAATA	152	38	yes
GATCTGCTACTGGAGATGTT	35	4	yes
GATCTGCGTATGGCGGCCAT	2829	203	yes
GATCTGCGGTGACTTGATGT	3440	427	yes
GATCTGCGCCTGCCTTGTCT	102	8	yes
GATCTGCGCCTGAGCCAAAG	289	30	yes
GATCTGCCTTGGATTTCCTC	25	1	yes
GATCTGCCTGTTACCTCTTC	8	7	yes
GATCCTGTGGAAAAATGAAA	13	6	yes
GATCTGCCGCAGTAAGCGAG	2	2	yes
GATCTGCCCTTTCTGGGTGA	42	1	yes
GATCTGCCCGAAGCCATGAG	42	7	yes
GATCTGCCCCATGGTGTTTT	49	3	yes
GATCTGCCATTCCCATCTGT	96	1	yes
GATCTGCCAGTTTTGGTGCC	63	6	yes
GATCTGCCAGTCCGAGGTTC	86	33	yes
GATCTGCCAGGACAAGCTGG	14	14	yes
GATCTGCCACTTGTTTTAAT	10	11	yes
GATCTGCCACTGCTTCTCTA	47	9	yes
GATCTGCCACAGCAAGAGTG	120	32	yes
GATCTGCCACACAGTAGACT	75	13	yes
GATCTGATGTTCTGTGTTTT	13	7	yes
GATCGGTCTGAGATGACTCA	77	6	yes
GATCAGTTCATCCACATAGA	51	12	yes
GATCTGATGTATGCCAAGCG	407	9	yes
GATCTGATGGGTTTCTGGCT	25	28	yes
GATCTGATGCCCTCTTGTGT	11	11	yes
GATCTGATAGTCAAGTGTAT	2	2	yes
GATCTCAAAACCAAAACCAC	16	15	yes
GATCTATCGGCCTCTGCCTC	17	16	yes
GATCTATCCTAGCCGGGAGG	448	8	yes
GATCTGAGTGGGTGGGGGGT	45	5	yes
GATCTGAGGCCTTGTTTTTT	313	85	yes
GATCTGAGCTGCCCTCTGCT	40	12	yes
GATCTGAGCCTCCACCTGTG	112	24	yes
GATCTACTGTGAAAAGCATG	29	26	yes
GATCTTTGGGTTTGAGGATA	17	19	yes
GATCTACTCCCGGGCCCAGC	107	22	yes
GATCTTTGCCAAAATGTGTG	54	6	yes
GATCTTTCTGCCTTTACCTT	26	0	yes
GATCTTTCGGAGGAGATGTC	89	6	yes
GATCTATACAGTCGGGAAAC	467	22	yes
GATCCTGACTTTGTTGGGGT	43	15	yes
GATCTGAGCATAGCGTCAGA	23	1	yes
GATCTGAGCAGGTGAAAAGT	25	1	yes
GATCTGACTGTTCCTGCAGG	13	14	yes
GATCTGACTCTCTCTTCTGT	28	2	yes
GATCTGACCCTCCAGACTTT	26	4	yes
GATCTACCGTGCAGGGACTG	52	6	yes
GATCTACCACCCTAACATCG	13	12	yes
GATCCTGGCACCTGATATCC	10	1	yes
GATCTACACATGGGGCAACC	306	15	yes
GATCACTGACTGCCCCAAAC	30	0	yes
GATCTAGGTTCAGAGTTCAG	9	10	yes
GATCTGAATTTCTTCCTCTT	27	3	yes
GATCTGAATGTCCGAGAGAG	404	17	yes
GATCTGAAGTTCTGTGTTCA	7	2	yes
GATCTGAAGTCTGAATGGCA	18	5	yes
GATCTGAAGTATCTGTACAG	58	5	yes
GATCTGAAGCTGCTGATGAA	278	48	yes
GATCTGAACTCCAGAGAACA	94	30	yes
GATCTGAACACCCAGCGAGG	31	28	yes
GATCTCTTTTGCCAAGAAGT	67	4	yes
GATCTCTTTGTGTTCAAGAC	11	1	yes
GATCTACGCACGCATCAGCA	108	11	yes
GATCTTGTGGGAGTGACCAT	54	2	yes
GATCTACCGTGCACACCCAG	4	4	yes
GATCTACCCTGACTCAGGTT	2	2	yes
GATCACTACAGTGAAGTATT	4	3	yes
GATCTTGTATTCTCTGGCTT	22	12	yes
GATCTTGTACAAACCGGTTT	20	18	yes
GATCTTGTAAATTCCCCACA	130	61	yes
GATCTTGGTGGAGTGGGTCT	5	5	yes
GATCTCTTTGAGTTTGAGGG	47	5	yes
GATCTCTTCAGAAGGGCACT	7	6	yes
GATCTCTTCACTGTTTTTCT	13	0	yes
GATCTTGGGGGAGAGAGGGA	46	21	yes
GATCTTGGCTTGTTCCGAGT	8	7	yes
GATCTTGGCTCTGTGGAATG	74	2	yes
GATCTAATGGTCCTAACAAT	73	19	yes
GATCTTGCTTTGTGACTTTT	56	10	yes
GATCTTTGGCAGTGGAGGAA	2	2	yes
GATCTCTGTGTGTGTGTGTG	60	7	yes
GATCTCTGTGGGCCTTTGGG	70	5	yes
GATCTCTGTGCTGGCGCCTG	12	3	yes
GATCTCTGTGCTCTTACTTT	21	4	yes
GATCTCTGTGCGCCTTCCTG	13	12	yes
GATCTCTGTGAGTTTGAGGG	211	87	yes
GATCTCTGTGAGCTTGAAGC	5	4	yes
GATCTCTGTGAGCCTAGGAG	4	4	yes
GATCTTGCTTCAGCCAACGC	13	15	yes
GATCTTGCGTGTTCTGTCCG	9	10	yes
GATCTTGCCCCTGCCAGTGG	217	92	yes
GATCACCTTTTTTGACGAGT	81	6	yes
GATCACTCCAATTCCAGGGT	11	4	yes
GATCACGTCTATGACCGGCT	36	9	yes
GATCGTCTGCTGTGAAACGT	31	7	yes
GATCGTCCCCAAAATTGCCT	29	7	yes
GATCGTACGGGGCTGGAAAC	27	1	yes
GATCGGTGGGACCCGGGCGA	144	7	yes
GATCGTGGGCTTCAGCACCC	69	7	yes
GATCTTGAAGTCTTTCTTGA	29	7	yes
GATCGGTCTGAGATGACTCC	359	1	yes
GATCGGCTTTGAGAGAGGGT	69	12	yes
GATCGGCGTGGCAGCTGTGG	10	6	yes
GATCATTTCTCTTCTCTCAC	1	1	yes
GATCTTCTCTCTTTCCTTTC	1	1	yes
GATCTTCTCTCCAGAGACAG	66	59	yes
GATCTTCTCCCTGGGTTACT	35	2	yes
GATCTTCGTGGAGTTCACCT	40	36	yes
GATCGGCAAGCTGGAAGGCT	145	16	yes
GATCAGTTGACAGTGGCAAT	454	7	yes
GATCTTCGAAGCCAAGTGTA	8	9	yes
GATCGCTGGACAGGTGGCAA	19	18	yes
GATCTTCCTGCCTTGGTATC	32	2	yes
GATCTTCCTACTTCCTCCTC	2	2	yes
GATCACCAGCCTTTTGCAAA	37	2	yes
GATCGGCGGGAAATGGCGGA	38	1	yes
GATCGGCGCCGTGAGATTCG	17	4	yes
GATCAGGTTCAGCGTCCTCT	24	2	yes
GATCGCTCATTGGAACAGCT	2546	102	yes
GATCGGCAGCCAGAGTAGCT	22	20	yes
GATCGCCGAGCCAGCGCCGG	21	19	yes
GATCGCCCTTGCTGGTCTGC	22	21	yes
GATCCTGGTGATGGTGGTAT	5	0	yes
GATCTTCAGGGGCAAAGCAT	146	3	yes
GATCTGAAGCAATGTGACTG	11	10	yes
GATCTTCAGCCTCTTGGGGA	163	2	yes
GATCTTCACCTCTTCTTCCG	1917	41	yes
GATCGCCTGCTAGTGCGGGA	15	7	yes
GATCTTCACCGGAAGGTGCA	13	12	yes
GATCTTCACCATTGAGTATT	34	7	yes
GATCGCCTCTCAGTGCTGGT	20	1	yes
GATCAAAACATGGATGAGAA	1	1	yes
GATCTCTTTTCAGAAGTGTC	55	11	yes
GATCTGCCTGACTTCCCTGA	228	8	yes
GATCAAGGCCATTTCTGAGG	20	13	yes
GATCACGGTGAACCCCCAGG	7	6	yes
GATCATTCACTGCACATGCG	11	10	yes
GATCTCTGTGCTGTAAACTA	16	15	yes
GATCCTGAAGTGGCCTCAGG	3	3	yes
GATCCCTTTTCCATTCTGGA	95	0	yes
GATCCCTTTGGGGTGTGGAA	372	26	yes
GATCTACAGGAGTGGTGATA	14	13	yes
GATCCCTTTCTCTGGCCCAG	984	54	yes
GATCCCTTTCCACCTAAAAC	54	0	yes
GATCCCTTTACCCAATCGTC	4	3	yes
GATCCCTTGTGAGCCCTAGT	86	9	yes
GATCCCTTGTAGCCAGAGTT	180	24	yes
GATCCCTTGGGCAAGTATCA	9	8	yes
GATCCCTTGCTTGCCTCTTG	14	7	yes
GATCCCTTGCTTCAACCTCC	67	9	yes
GATCCCTTGCTACATCTCCT	226	25	yes
GATCCCTTGCCTCCTGAGTT	60	5	yes
GATCCCTTGCACACAGCCCA	269	0	yes
GATCCCTTCTGCTCTACCTC	46	6	yes
GATCCCTTCCTTTGAAGTGA	14	16	yes
GATCCCTTCCTGCCCTCTTT	270	7	yes
GATCCCTTCCCCAGCGGTTC	43	2	yes
GATCCCTTCCAGCTGAGCCC	119	10	yes
GATCCCTTCCAAATCTGCTC	3	3	yes
GATCCCTGTTCCCCTGAGAA	138	9	yes
GATCCCTGTGGTCACTTAGC	81	3	yes
GATCCCTGTGAGTTCAAGGC	98	3	yes
GATCCCTGTCTGATTTCTGA	5	0	yes
GATCCCTGTCTAGTCCCTGT	100	3	yes
GATCTTGCTGCTGTAGGAAG	37	6	yes
GATCTTGCCCCTTGAAGTAA	9	10	yes
GATCATGGGTTGGGAGCTCA	127	1	yes
GATCATGGGCAAAAAGCCCG	184	21	yes
GATCCCTGTACACTATGTCT	61	4	yes
GATCCCTGGTTGCATCTTCG	3	3	yes
GATCCCTGGTGGCTGCCCTT	458	41	yes
GATCCCTGGGTGCCAGTTTT	6	6	yes
GATCCCTGGGGGCTGTGATG	82	2	yes
GATCCCTGGGGCTGCCTGTC	1043	5	yes
GATCCCTGGGGCATGTTGTA	107	11	yes
GATCCCTGGGAGGATATGAG	54	2	yes
GATCCCTGGGAACGAAGCTG	2	2	yes
GATCCCTGGCTCAGTGAACA	15	4	yes
GATCCCTGGCGTCCCTATCA	164	7	yes
GATCCCTGGCCCCTGTGCCA	127	25	yes
GATCCCTGGCCAGAAGTACA	32	3	yes
GATCCCTGGCACTGCTGCCT	45	2	yes
GATCCCTGGCACCCAGCATC	57	14	yes
GATCCCTGGAGTGACCAGAG	989	10	yes
GATCCCTGGAGTCTCTGAAG	29	5	yes
GATCCCTGGAGGCTGGAGAG	2	2	yes
GATCCCTGGACTGGAACAAA	7	4	yes
GATCCCTGGAAGCTGTGATG	1	1	yes
GATCCCTGGAAGCAGGGACA	39	4	yes
GATCCCTGGAACAGAGTTAT	5	5	yes
GATCCCTGCTTTTGTGGCCT	239	10	yes
GATCCCTGCTTCCTGCCCAG	75	6	yes
GATCCCTGCTGTTGGCAATA	108	6	yes
GATCCCTGCTCTTAGGTGCT	16	1	yes
GATCCCTGCTCTGGACCCTC	192	14	yes
GATCCCTGCTCCCCTCTGGG	204	3	yes
GATCCCTGCTCCAGGTCCTC	232	39	yes
GATCCCTGCTAATGGAAGAA	84	6	yes
GATCCCTGCTAAAACCATGT	16	15	yes
GATCCCTGCCTGTGGGGGGT	12	7	yes
GATCCCTGCCTGTCCTGAAA	221	23	yes
GATCCCTGCCGAGGTGCTCA	250	5	yes
GATCCCAGGGACTCTGTTTT	99	19	yes
GATCATGGCTTTGAGGCCAG	25	7	yes
GATCATGGCGGTCAGCAGAA	15	2	yes
GATCATGGCCGACACCAGTG	69	2	yes
GATCATGGCAGTGGGAGACC	5	4	yes
GATCATGGCAGGGATACGCA	62	3	yes
GATCATGGCAGGCCTTTAAC	23	21	yes
GATCCCAGCACCGACGCCAG	30	8	yes
GATCCCTGCCCTTTGGCCTG	58	14	yes
GATCCCTGCCACCTCATTGG	71	20	yes
GATCCCTGCATTTCCTCAAG	40	1	yes
GATCCCTGCATAGGACTGTT	5	4	yes
GATCCCTGCAGTACCATCTG	252	3	yes
GATCCCTGCAGGTCGCTCAG	141	23	yes
GATCCCTGCAGCGCTGTTTG	276	5	yes
GATCCCTGCAGAGGCTTCCA	34	1	yes
GATCCCTGCAGAAGGGGGGT	78	4	yes
GATCCCTGCACAAGGTGTTT	101	18	yes
GATCCCTGCAACAGCAAGGG	9	8	yes
GATCCCTGAGTTTACCAGCG	30	8	yes
GATCCCTGAGTTCAAGGCCA	214	45	yes
GATCCCTGAGGTCTCCTGCC	71	7	yes
GATCCCTGACATAGCAGGAC	4	3	yes
GATCCCTGAATCCCCTACTC	18	7	yes
GATCCCTGAATAGAAATTGG	3	3	yes
GATCCCTCTTCTGGTGTGTC	5	1	yes
GATCCCTCTTACCTGCAACG	606	35	yes
GATCCCTCTGGTGACTCCAC	211	1	yes
GATCCCTCTGGGTCATGTCT	151	12	yes
GATCCCTCTCTTTTCCTTCT	3	1	yes
GATCCCTCTCTTCAATGATG	27	3	yes
GATCCCTCTCTCTGGGGAAT	48	0	yes
GATCAGAGCTCCTCCAAGGC	3	3	yes
GATCCCTCTAAGCCCCCTCC	63	0	yes
GATCTTCTTGATGCCAACAG	13	12	yes
GATCCCACTTCTGCGTCTTA	20	2	yes
GATCCCACTGACCTTGAACC	3	1	yes
GATCCCACCTGTAACTGAGG	13	0	yes
GATCCCTCGGTGACCACATT	79	10	yes
GATCCCTCCTTGTGAGCAGC	217	9	yes
GATCCCTCCTGTCACTGCAG	18	3	yes
GATCCCTCCTGGGCATTGCT	68	5	yes
GATCCCTCCTCAGGCATCTG	1071	1	yes
GATCCCTCCCTTGGGCCTCC	19	5	yes
GATCCCTCCCTCCGAGGCCA	99	7	yes
GATCCCTCCCCTCCCTGGCT	13	2	yes
GATCCCTCCCAGAAACCTGC	4071	125	yes
GATCCCTCCAGCCTCTACTG	9	2	yes
GATCCCTCCAGACACCAAGG	224	1	yes
GATCCCTCCACAAGATTCTG	2	2	yes
GATCCCTCAGGGTGTGTGCC	121	8	yes
GATCCCTCAGGAACAGAGGG	216	25	yes
GATCCCTCACCTCCTTCATC	227	12	yes
GATCCCTATGCTGACCCCAA	280	7	yes
GATCCCTATGAAGTGTCTTA	71	10	yes
GATCCCTAGGGAGAAGGTGG	127	12	yes
GATCCCTAGCATTCTGTACT	134	13	yes
GATCCCTAGAGCCAGCACAT	61	18	yes
GATCCCTACTCGTTTCAACA	4	3	yes
GATCCCTACTATTGATTCTG	14	1	yes
GATCCCTACTACGTGCTGGA	992	6	yes
GATCCCTACCTACAACCCTA	394	30	yes
GATCCCTACCCCACATGCTG	109	54	yes
GATCCCTACCCATGGGAATG	183	5	yes
GATCTTCGGTGCCACCGGCA	15	14	yes
GATCATGACATTGTAGCCAG	63	4	yes
GATCTCACAGGACAGATGGA	41	8	yes
GATCCCTACCCATGGACCCT	137	16	yes
GATCCCTACCACCTGCCCGA	7	6	yes
GATCCCTAATGAGAGCAGAG	33	8	yes
GATCCCTAAACTACCTCTTG	181	3	yes
GATCCCGTTTGTGAAGCCTG	2	0	yes
GATCCCGTGTGACACATTTT	20	1	yes
GATCCCGTGGACTGTTTGCT	82	4	yes
GATCCCGTCCAAGGAGCATC	273	2	yes
GATCCCGCGAGGCCCGGAAG	6102	141	yes
GATCCCGCCTGCCCAGCTGA	218	11	yes
GATCCCGCCTCTGGAAGAAA	13	2	yes
GATCCCGCCGTTCCACCCTC	15	7	yes
GATCCCGCCCACCCAAAGCT	98	3	yes
GATCCCGCCAAAAGAATTAC	238	6	yes
GATCAAGCTGGAGGTGCCAG	2	2	yes
GATCCCGCACATCCACAAGT	81	3	yes
GATCCCGAGATTGCCAGCCT	469	3	yes
GATCCACAAACTTCCTGACA	48	6	yes
GATCTGACAGGGTTGTGGTT	3	3	yes
GATCTTCCAAATCCTGGTCA	171	26	yes
GATCCCGACACCAAGGAGAT	5371	85	yes
GATCCCGAAAACCAGAACTT	4	4	yes
GATCCCCTTTTTGAACAGGT	299	23	yes
GATCCCCTTTCTTTACCTTC	14	13	yes
GATCCCCTTTCCTGTGAATG	192	19	yes
GATCCCCTTTACCTTCTGGG	272	11	yes
GATCCCCTTGGTTGCTGGAT	222	20	yes
GATCCCCTTCTCAGGGTCTA	166	24	yes
GATCCCCTTCCTACCTCTAG	61	14	yes
GATCCCCTTAGCTGATGAAT	6	1	yes
GATCCCCTGTTGACTTACAA	22	3	yes
GATCCCCTGTATATGTTGAA	2	2	yes
GATCCCCTGGGTTGAGAGAT	4	3	yes
GATCCCCTGGGGCAAGCTGC	250	174	yes
GATCCCCTGGGAGGAGACAG	618	48	yes
GATCCCCTGGCAAGAAGGAA	35	10	yes
GATCCCCTGGATACATGGTC	24	22	yes
GATCCCCTGCTACACTGATG	10	3	yes
GATCCCCTGCTAATGAAAAT	34	2	yes
GATCCCCTGCCTCCACCTCC	22	20	yes
GATCCCCTGCCTCAGCTCCT	46	42	yes
GATCCCCTGCCCCCCAACCA	146	25	yes
GATCCCCTGCAACAGACATT	159	18	yes
GATCCCCTGAGATGGAATTA	2	2	yes
GATCCCCTCTTCCCAAATAA	28	6	yes
GATCCCCTCTGGGCCTCCGA	101	1	yes
GATCCCCTCTCCTGCCCACA	56	50	yes
GATCCCCTCGGACCCCCTTG	711	31	yes
GATCCCCTCCTCCAGGCAGT	27	3	yes
GATCCCCTCCCTTGCTTTCT	48	11	yes
GATCCCCTCCCACAGAATAG	3460	137	yes
GATCCCCTCACATGTGCTAT	48	7	yes
GATCCCCTATGGGGAGGAGG	170	9	yes
GATCCCCTATGCAAGCTGTG	120	22	yes
GATCCCCGTTGTACCTGGTG	33	11	yes
GATCCCCGTGTGTTTGCAGG	133	24	yes
GATCCCCGTGCCCCTGCCTA	831	41	yes
GATCATCCACTTGTTAGCCC	5	4	yes
GATCTTCACTGCAGATGTGG	133	5	yes
GATCCATCTGCCTTCTCCAG	3	3	yes
GATCAAACTGAATGAAACAC	31	7	yes
GATCCCCGTCTGTGTCTGTG	33	2	yes
GATCCCCGGTGCTCTTCGTG	66	3	yes
GATCCCCGGGAAAGTGTAGT	34	0	yes
GATCCCCGCAGAATCAGGAA	20	1	yes
GATCCCCGCAAAGTGAGCGA	12	1	yes
GATCCCCCTTTGCTGCCTCC	58	6	yes
GATCCCCCTGATGGAGAGAA	118	17	yes
GATCCCCCTCCCTGCTCTCA	2	2	yes
GATCCCCCTCCCCCCAGTGG	1151	518	yes
GATCCCCCCCTTTTTTTGTC	43	2	yes
GATCCCCCCCAGCACACTCT	86	13	yes
GATCCCCCCACCCCACCACC	404	24	yes
GATCCCCCCAACTGTGTGCC	97	8	yes
GATCCCCCAGGTCTCAGAGG	233	16	yes
GATCCCCCAGGGAAAGACTT	9	7	yes
GATCCCCCACCTCCTCGGCC	4	4	yes
GATCCCCCACATCCTGGGGC	33	1	yes
GATCCCCATTTGCAGTAAGA	131	3	yes
GATCATCACCTGACCCACTT	19	4	yes
GATCCCCATGTTGAGCTCTG	243	8	yes
GATCCCCATCTGCAGTACAA	1	1	yes
GATCCCCATCTGACTCAGTA	35	6	yes
GATCCCCAGTGAAGGGTCTG	14	3	yes
GATCCCCAGTCTTTAGTCCC	457	11	yes
GATCCCCAGTCTGTAACTCC	3	3	yes
GATCCCCAGGTCCCCTTCAA	53	3	yes
GATCCCCAGGGGCTCCCGGT	61	2	yes
GATCCCCAGGAGATGAGGTC	220	17	yes
GATCCCCAGCTGGTAGAAAT	16	3	yes
GATCCCCAGCTCCTTTCAAA	54	2	yes
GATCCCCAGCCTTGGATAGT	44	3	yes
GATCCCCAGCATTAGGCCAT	15	2	yes
GATCCCCAGCAGTAACACTT	57	7	yes
GATCCCCAGCACAGGAAGGC	136	1	yes
GATCCCCAGAGTCCCCTGTG	103	7	yes
GATCCCCAGAGCCTTGGGGA	39	3	yes
GATCCCCAGAATCCCCAATA	14	13	yes
GATCCCCACTGTGCCTTTTT	61	6	yes
GATCCCCACCAGCCACCCCC	224	2	yes
GATCCCCACAGCTGCGTATG	202	11	yes
GATCCCCAAGTCTGTGACAC	45	6	yes
GATCCCCAAGAACAACTTGC	18	2	yes
GATCCCCAACCCCCCAAAAA	40	5	yes
GATCCAAACATTCCAAGAAA	3	3	yes
GATCCCCAACAATGTGAAGA	1072	33	yes
GATCCCCAAAGCCTGGAGCC	432	43	yes
GATCCAGTGTGGGGCAGCGC	31	7	yes
GATCATACCCACGTTGCCCA	9	10	yes
GATCCCCAAAAGGGTTAAAA	5	3	yes
GATCCCATTTTTGACAGCAA	2	2	yes
GATCCCATTGGAGCTCTGTT	88	3	yes
GATCCCATGTTCAAGCTGGT	82	0	yes
GATCCCATGTGTCTTTTTGC	4	3	yes
GATCCCATGTGTCTCCCCCA	265	3	yes
GATCCCATGTGCCACCATCA	169	0	yes
GATCCCATGTCCTGCTTTCT	83	2	yes
GATCCCATGCTTTGAAAAAT	49	3	yes
GATCCCATGCTAGCCTCTTG	205	14	yes
GATCCCATGCCTGGAATTTG	248	3	yes
GATCCCATGCAGAGCGGCCT	382	0	yes
GATCCCATGATGGAAATATT	33	2	yes
GATCCCATGAATACAAACAG	26	8	yes
GATCCCATGAAATCCCCAAA	90	3	yes
GATCCCATCTCCTGGAAGGA	240	0	yes
GATCCCATCCTGGGCGTTAC	6	2	yes
GATCCCATATCCCTGTGAAA	9	9	yes
GATCCCATACCTGACATGAC	85	6	yes
GATCCCATACAATGCCGCCC	190	6	yes
GATCCCATAAAATTCGAGGG	39	4	yes
GATCCCAGTTTGCTTCATGA	10	9	yes
GATCCAGTCACACCCCACCC	93	84	yes
GATCCAAACTTCTACAGCAA	49	17	yes
GATCAGTGGGTGCCCGTGAT	14	2	yes
GATCAAGGCCACGGGGAGGA	105	13	yes
GATCCCAGTGGTATTCCGCC	20	2	yes
GATCCCAGTGGATGAAGTGT	125	13	yes
GATCCCAGTGCTGTGGAAGT	3	3	yes
GATCCCAGTGCTGGTCAGTT	196	18	yes
GATCCCAGTGAGATGCTGGT	29	5	yes
GATCCCAGTGAAGGGTTTCT	88	9	yes
GATCCCAGTCCTCCTGGGCA	9	0	yes
GATCCCAGGTGTCCCCATTT	20	9	yes
GATCCCAGGTGGAGCAACCC	139	34	yes
GATCCCAGGTCCCTCTGGGA	64	20	yes
GATCCCAGGGTTTTCTTGGT	36	7	yes
GATCCCAGGGGTCCTAGGGG	52	4	yes
GATCCCAGGGGCTCTTCTGC	41	6	yes
GATCCCAGGGAAAGTGCTAT	97	2	yes
GATCCCAGGCTCCACCAGCG	28	25	yes
GATCCCAGGCTAGCAAGCAA	139	6	yes
GATCCCAGGCATGATTTCAG	6	1	yes
GATCCCAGGCAAGGGATGGT	92	9	yes
GATCACTGGAAGAGCAGTCA	7	2	yes
GATCCCAGGAGTCAAGCTCT	2332	1	yes
GATCCCAGGAGAGAGGCTTC	35	10	yes
GATCCCAGGAAGGACCATCA	46	12	yes
GATCCCAGGAAAGTTCTAAT	103	11	yes
GATCCCAGCTATGATGTAGC	107	16	yes
GATCCTCTCCCCTCCGTCAG	4	2	yes
GATCCTCTTTGACTTCACGT	22	4	yes
GATCCTACTATGAGCAAAAA	78	11	yes
GATCACTGTCAAAATACAGG	6	5	yes
GATCAAGTTGCTGAGCCTGA	32	10	yes
GATCAAGGCTGTTTCTGAGT	27	13	yes
GATCCTAAAAAGCGGAGAGG	8	9	yes
GATCTCTGTCTTTCCCTGGT	69	12	yes
GATCTCTGTCACATCCGATG	98	8	yes
GATCTCTGTAAACAGTTTGG	62	32	yes
GATCTCTGGTTGCTTTCAAG	102	6	yes
GATCAAGAGGTGAGGAGAGG	44	3	yes
GATCTCTGGGCAGTCATGGT	62	3	yes
GATCTCTGGCCTGTGGAGTA	232	2	yes
GATCTCTGGCCAGGCAAGTT	109	9	yes
GATCTCTGGATGGAAATGTA	24	2	yes
GATCTCTGGAAGGTGAGCCT	43	0	yes
GATCTCTGGAAAATTGCCAT	8	7	yes
GATCTCTGGAAAAAACAACA	5	4	yes
GATCTCTGCTGTGGGAAAGG	584	28	yes
GATCTCTGCTGTCGGTTTCT	11	2	yes
GATCTCTGCCCAAACCAGGC	59	14	yes
GATCTCTGCCACCCACCCAC	102	14	yes
GATCTCTGCAGCTGGAGTCT	4	3	yes
GATCCGAGTGTCCCCTCTGC	3	1	yes
GATCCCTGGGGGTGGGGAGG	23	3	yes
GATCACAGTCTAGGTCTAGG	50	4	yes
GATCCTACTACTGGAGCTTA	9	9	yes
GATCTCTGCAAAATAGACTT	79	7	yes
GATCTCTGAGCGTGTGGGTC	1	1	yes
GATCTCTCTTGTTGGAAGGA	120	11	yes
GATCTCTCTTCCCAGAGGAA	4944	184	yes
GATCTCTCTTACATACTGTT	14	2	yes
GATCTCTCTGGAACTATCTA	21	3	yes
GATCTCTCTGCTCATACCCT	31	8	yes
GATCTCTCTCATTCAACTTT	8	2	yes
GATCTCTCTCATCGAGAGCA	16	15	yes
GATCTCTCCCGTTCTCAGCA	5	5	yes
GATCTCTCCATATCAAGCGA	748	22	yes
GATCTCTCATTCCCAAGTAA	8	0	yes
GATCTCTCAGGCCAGGATTT	26	0	yes
GATCTCTCACTGGACCAGCG	49	6	yes
GATCTCTCACAGACCTGGTC	3	3	yes
GATCTCTATCCTAACGTCCA	31	5	yes
GATCTCTACTTTGGAGTCCT	59	8	yes
GATCTCTACTGGCAGGCCAT	133	14	yes
GATCTCTACTCCCAGGAGAT	187	31	yes
GATCTCTACCACCCAGGTAG	85	7	yes
GATCTCTACCAATATTCTCA	26	0	yes
GATCTCTAAACTGTGACACA	99	4	yes
GATCTCGTTCATTGGCAAAA	58	15	yes
GATCTCGGTCTGTGCCGGGG	117	4	yes
GATCTCGGCCTCACAAATCC	18	3	yes
GATCTCCTTTGTGAATGGTG	13	3	yes
GATCTCCTTTCCGGAAGCAA	119	8	yes
GATCTCCTTGGCATGAGGGG	44	23	yes
GATCTCCTTGGAGTCTCAAG	1692	18	yes
GATCTCCTGTGAACACCACA	16	15	yes
GATCTCCTGTCTATGTGGGC	198	68	yes
GATCTCCTGGTCAGGAAGAA	34	30	yes
GATCTCCTGGAAGCTAGCAG	126	22	yes
GATCTCCTCTTCGGGGTTCT	6	1	yes
GATCTCCTCGCTGGAAAAAG	39	0	yes
GATCTCCTCCTTGCTTTCCT	31	1	yes
GATCTCCTCCTTATTCCCCA	83	3	yes
GATCTCCTCAGAGAAGTCTG	7	6	yes
GATCTCCTCAACCAGTGTGT	1	1	yes
GATCTCCTATTTTGGTGTCA	136	13	yes
GATCTCCGTCCCTCAGCTCC	156	19	yes
GATCTCCGCCTGGCACCCAG	51	5	yes
GATCGCAGAGAGGCGAGAGC	85	3	yes
GATCTTACTTAGCATGCACA	7	7	yes
GATCTCCGCACTGTGTGTAC	200	28	yes
GATCTCCCTTTGTACTGTCT	23	1	yes
GATCTCCCTTTCCTGTAGAG	28	8	yes
GATCTCCCTGCCCCTGAGCC	46	5	yes
GATCTCCCTGAGTTCGAGGC	207	25	yes
GATCTCCCTCTTGGAGGCCA	12	1	yes
GATCTCCCTCTGAACACCTG	62	1	yes
GATCTCCCCTTTGTAGGACT	4	0	yes
GATCTCCCCTGGACCAAAGG	39	9	yes
GATCTCCCCCACCCCAGCAG	15	6	yes
GATCTCCATTCTGGAGCTGA	28	2	yes
GATCCTTTCCTCCGAATAAA	1	1	yes
GATCCTTTCAACTCAAAAGC	216	13	yes
GATCTTAGTAATGGATGGTG	58	13	yes
GATCGCATACATCATGACTG	7	1	yes
GATCGCAGCACTGAAAACAA	33	10	yes
GATCTCCATCGTGCAGGGAT	78	10	yes
GATCTCCAGTCCAAGGCTTC	58	7	yes
GATCTCCAGCTTCTCTGCCT	65	5	yes
GATCTCCAGCACAGCAGAGG	11	0	yes
GATCTCCAGACCGTTCCACT	23	21	yes
GATCTCCACTTTCTACAACA	36	1	yes
GATCTCCACTCTCCCTCTGG	38	5	yes
GATCTCCACGGGTGCTTAGT	51	9	yes
GATCTCCACATCTCCAAGGA	14	5	yes
GATCTCCACAGGCCAGCCTT	32	1	yes
GATCTCCACACAACAGGTGA	88	7	yes
GATCTCCAATGTTGTGCTAA	60	1	yes
GATCTCATTTTAACATCCAC	5	5	yes
GATCTCATTTCTAGTTTCCA	12	1	yes
GATCACAGCCAGTTCAAAGC	101	5	yes
GATCACAGCAGTAAATGTGA	155	12	yes
GATCACAGCAGCTGAGCTGT	53	22	yes
GATCACAGATTTAAGGGGAG	113	2	yes
GATCACAGATTGCTTCTCTG	47	6	yes
GATCACAGAGAACACAGAGG	11	0	yes
GATCACAGACTTCGGCCTTG	3	3	yes
GATCACAGACACCTGCACTG	22	21	yes
GATCACAGAAGTGAGCGGAT	143	15	yes
GATCCTTCTGCAGACACCGA	168	6	yes
GATCCTTCTCAGAAGAGTCT	18	4	yes
GATCACACTTCCCACAACCC	157	8	yes
GATCACAGGGAGCCTGTGTT	27	7	yes
GATCACAGCAGAGATGGCCA	81	5	yes
GATCTCATTGTTCTTGGAGA	11	8	yes
GATCTCATTCCCGAGAGAGG	31	5	yes
GATCTCATGTCTCTGGAGGA	48	4	yes
GATCTCATCCAGTCTGCTGT	1	1	yes
GATCTCAGTTTTCATCAAGT	1	1	yes
GATCTCAGTTTGAGTGGATG	11	3	yes
GATCTCAGTTTCGCTGATGT	29	5	yes
GATCTCAGTTCTGTGTTTAC	89	23	yes
GATCTCAGTTCACGGGGTGG	53	9	yes
GATCTCAGTTCAACAGCTCC	88	12	yes
GATCTCAGTGTGGAGAGCAT	6	2	yes
GATCTCAGTGGGGGTGGGAG	119	4	yes
GATCACACGGCAAAACAGTA	50	6	yes
GATCACACCTGTCCCTACAC	743	84	yes
GATCACACCTGCAGTTTGGG	274	15	yes
GATCACACCGTTTCTTCCTA	26	14	yes
GATCACACCGAGATTCTTTT	50	12	yes
GATCACACCGAGACCAGTGG	6	5	yes
GATCACACCATTGAGTTCCG	28	2	yes
GATCACACCAGTCCTGTGAG	9	2	yes
GATCACACATTTGCAAGGGA	46	7	yes
GATCACACACTCAGTCCTTG	261	13	yes
GATCACACACGGCAACCGAC	75	8	yes
GATCACACAAGTGTGGGTTT	124	18	yes
GATCACAATCAGGAACTCAC	9	6	yes
GATCACAATACAACTTTATG	8	7	yes
GATCACAAGTTTGAGACCAG	37	6	yes
GATCACAAGTTGTTTCCTGT	14	5	yes
GATCACAAGTGCAGCATTCT	5	4	yes
GATCACAAGGTTTACATCTG	11	10	yes
GATCACAAGGGGGTAATCAA	16	4	yes
GATCACAAGAGTTACTAGTT	4	3	yes
GATCCTTGGAAGTGGTTCAG	22	3	yes
GATCTGTTGCTGGTTTTCTG	4	4	yes
GATCTGCGCGTGCTGTGTGG	8	1	yes
GATCTGTTCATGGAAAAAAA	11	11	yes
GATCTGTTACTTTGGCGAGG	98	22	yes
GATCTGTGTGTCATCAGATG	2	2	yes
GATCCTTCTCTGCCCTTCCC	74	4	yes
GATCTGTGTGGCTCCTCTGC	61	22	yes
GATCCTTCCTTTCCCTTGGC	48	14	yes
GATCCTTCCTTCTTCTCTTC	104	4	yes
GATCTCAGTAACTGTCGAGC	123	0	yes
GATCTCAGGGTTCCCATGGT	47	7	yes
GATCCCCTACAGCTGAAGTT	8	7	yes
GATCTCAGGATTTGTTGGGG	60	1	yes
GATCTCAGCTTGCATAGCAT	4	0	yes
GATCTCAGCTCCACTGTGAA	43	12	yes
GATCTCAGCTAAACTTTCAA	26	4	yes
GATCTCAGCCCCTACTCCCA	6	1	yes
GATCTCAGCACTGTGGCTGT	207	9	yes
GATCTCACTGCCTCCCTCTC	96	26	yes
GATCTCACTCAGCAACAAGT	74	1	yes
GATCTCACGGGCCGACCGAG	127	9	yes
GATCACAAGAGGCCCGTTTG	30	2	yes
GATCACAAGAGAGTTGCAAC	105	13	yes
GATCACAAGAAGTTAGTTTG	29	5	yes
GATCGGGGGGATGACCAGCT	77	9	yes
GATCACAACTTTAATCCCAG	3	3	yes
GATCACAACTGTAGGGAATA	97	10	yes
GATCACAACTGATTCCTGCT	3	3	yes
GATCACAACGGCTTGCGTGT	67	6	yes
GATCACAACCCTGATGGCAG	249	27	yes
GATCACAACCCCCAAGTCAG	117	2	yes
GATCACAACCCAGATGAAAT	60	3	yes
GATCACAAATACAGATTCTG	27	24	yes
GATCACAAAGTTTGAGAATG	593	3	yes
GATCACAAAGGTGGAATGTT	21	6	yes
GATCACAAACATCACAGAAG	1	1	yes
GATCACAAAAGGCTGTTTTG	35	8	yes
GATCCTGTGCCTGGCCTTTG	31	1	yes
GATCAATGGGCAGCAGCAAT	35	5	yes
GATCAATGGCTTTGATGCAG	32	6	yes
GATCTGTGTATACCCCACTC	54	14	yes
GATCCCCATTGGCTTCTGTA	10	1	yes
GATCTGTGGACGACGAGAAC	5	5	yes
GATCTGTGGACCCCCTGACA	95	33	yes
GATCTGTGCTACACCACATG	4	4	yes
GATCTGTGCCATCCCATACA	236	31	yes
GATCCCCCAAGGCCCCAGGC	23	3	yes
GATCCCCATGGACTAAGGCT	9	10	yes
GATCTCAACTGACTCCTCTT	351	10	yes
GATCTCAACAAGATGACCTT	17	5	yes
GATCTCAAACTCAGAGGTTT	4	0	yes
GATCTATTTTCCTAACCGTT	29	3	yes
GATCAATGCAATGACGTGGG	97	6	yes
GATCAATGATGAGGACAAAC	272	156	yes
GATCCTGGGTACTGCACAGT	4491	97	yes
GATCCTGGGGGTGGACTGCA	30	0	yes
GATCAATCACATGGACACTA	53	1	yes
GATCCTGGTGTATTCATCTC	4	0	yes
GATCTGTCTCGGGAGCAGCT	35	7	yes
GATCAATATCACCCAAACCT	10	11	yes
GATCAATAGGGAAACACAGG	374	16	yes
GATCAATACTCCTTTGGAAA	20	4	yes
GATCCAGTTCTAAAATTTGT	32	12	yes
GATCAATAAAGTGGGTTTTT	38	1	yes
GATCCTGCGGGTGGGAGGAA	29	3	yes
GATCCTGCCTTGAATTCCTG	148	3	yes
GATCAAGTTTGTGGTGTGTT	2	2	yes
GATCAAGTTTGGTGTTTCCT	1	1	yes
GATCAAGTTTCAGGAAGGCT	76	25	yes
GATCAAGTTTCACATCCTTC	42	9	yes
GATCCTGGAGGGCTTCGGGC	55	1	yes
GATCCTGCAGCAGGAGTGCA	42	5	yes
GATCTGTCCTGATGAAGGCT	218	27	yes
GATCTGTCCTCAGTTATTCA	624	18	yes
GATCCTGGACTCTGGCTGGC	2	2	yes
GATCCTGGACAGCAACCTTC	3	1	yes
GATCCTGCAAACTTCCCTGG	6	6	yes
GATCTGTCCATCTTGGAGTT	94	1	yes
GATCCTGCCAGCCAGACCAA	6	3	yes
GATCCTGCAGACACTCAGAG	44	5	yes
GATCAAGTTGCCAGCATTTG	3	3	yes
GATCAAGTTGAAAGAGTGTG	137	12	yes
GATCAAGTGTCGGATGGAAT	34	0	yes
GATCAAGTGGATTCGGCGGT	17	2	yes
GATCAAGTGCTTTGCCAAGT	17	2	yes
GATCAAGTCTTGTCAGTTTG	3	3	yes
GATCCTGATACCACAGTAGT	2	0	yes
GATCCTGAGTGGCTTGCTAG	1	1	yes
GATCAAGTCGTGCTTCTGGC	4741	141	yes
GATCAAGTCCTTTGTGAAAG	1077	48	yes
GATCCTGAGGGCTGCATACC	51	20	yes
GATCCTGAGGAAGGCCAGGC	23	7	yes
GATCCTGAGAGCATCTTCGA	74	19	yes
GATCAAGGTGTTGCCTGGTG	12	3	yes
GATCTGTACCTGCGGCTCCA	8	9	yes
GATCTGGTTTTAAGTGCCTC	102	39	yes
GATCCTGAATGGGCAAGAGT	227	23	yes
GATCTGGTTCCTGAGCCCAT	44	11	yes
GATCCTGAAGCTCTGGCTGA	61	20	yes
GATCTGGTGCTGATAGGAAG	27	5	yes
GATCCTGACTCCTTGAAGCC	48	4	yes
GATCTGGTCACTGGTCAGAG	43	4	yes
GATCTGGGTTTGTCAACAGG	21	24	yes
GATCTCTGTGAAAGTAGTAC	3	3	yes
GATCAAGGCTTTCCTCGGGC	54	8	yes
GATCAAGGCTCCCGGTTTTG	389	36	yes
GATCAAGGCCTTTCTGTCCT	318	7	yes
GATCCTGAAAGACCGGGAAA	92	9	yes
GATCAAGGCAAAAGGAGGAT	5	5	yes
GATCAAGGAGGCTGTTGCTG	18	17	yes
GATCAAGGAGAGAAGCAGGA	46	8	yes
GATCCTCTGGCAGATGTTTG	114	32	yes
GATCTGTGCCATCTTGCTTT	3	3	yes
GATCAAGCTTAGCAGTCAAG	227	23	yes
GATCAAGCGGGCTTTCCTTA	1188	32	yes
GATCAAGCCTGTTAGCCCTG	9	10	yes
GATCCTGAACTCCCCAGAGA	20	3	yes
GATCCTCGACAGGAAGCCAG	5	5	yes
GATCTGGGGTGAGCTGGGGG	9	10	yes
GATCCCTTTGGTGCCCCTGA	34	1	yes
GATCTGGGCAGTTGTTTTGC	99	37	yes
GATCTGGGCACCGAGGCTGG	25	3	yes
GATCGGCGATGTGATGTGCA	35	8	yes
GATCAAGCCCTTCTTCCATT	2114	57	yes
GATCAAGCCCATGTGAACCA	9	3	yes
GATCAAGCCATCCATCAACT	308	45	yes
GATCAAGCATCATGATGCTC	24	0	yes
GATCAAGCAGTTTCTGGAGT	10	6	yes
GATCAAGCAGTAGAGTTTTT	35	1	yes
GATCAAGCAGCGAGAGGCTG	67	27	yes
GATCAAGCAGCAGCACGGGG	6	5	yes
GATCAAGCAGAACCTGGAGA	258	7	yes
GATCCTCCTCACTTAGCACC	20	7	yes
GATCAAGACTCTCCTGGAGA	28	0	yes
GATCAAGACGCCTGTCATTT	33	7	yes
GATCAAGACCCTCCAGAGGT	82	4	yes
GATCCTCCCAAAAGCCATCT	102	7	yes
GATCCTCCAGCTCCATCAGC	49	16	yes
GATCAAGAACTTCCATTACT	32	1	yes
GATCCTCAGGACGAGTCACA	15	8	yes
GATCCTCACTGGCAGCAGCT	69	9	yes
GATCCTCACCCTTTTCAGAA	1	1	yes
GATCCTCACCCACCTGCTGG	59	6	yes
GATCTGGCTTTTGTTTTCCA	8	9	yes
GATCTGGCTTTACTTCTCTG	92	9	yes
GATCTGGCTGGTCCAGTACA	20	23	yes
GATCTGGCTGCAGCTGGGAA	41	39	yes
GATCTGGCGTTTGCGCTGGA	199	7	yes
GATCTGGCCTGAGCCTGTCC	7	8	yes
GATCTGGCCCTTTTGTCCTT	3	3	yes
GATCAACTTGCTGGGACCTA	348	96	yes
GATCAACTGTGCAGACAACA	5517	140	yes
GATCAACTGGGCAAAGAGAG	2	2	yes
GATCAACTCTTTGTTTTGGC	4	3	yes
GATCAACTCTTGGCTTTGAC	78	11	yes
GATCAACGGAGGACTATCAT	28	2	yes
GATCTGGCATAAACCCTACT	2	2	yes
GATCCTCCTGAGACAGGTCA	21	6	yes
GATCTGGCAGATGTGAGGTT	3	3	yes
GATCTGGCACTACTGCCGAG	6	6	yes
GATCTGGAGGTGGAAGTGGT	4	4	yes
GATCTCCTTTGCCCATGTTT	13	2	yes
GATCAACCTGAGAGGGAGAT	14	1	yes
GATCAACCTGAACTTGGGAC	47	8	yes
GATCAACCTCGTCGACTGGG	14	5	yes
GATCAACCTCCTGGGCTTCA	13	2	yes
GATCAACCTCAGCAAGATGA	7	7	yes
GATCAACCGACAGCTGGAGG	168	30	yes
GATCAACCATTCCTGTGTCA	20	3	yes
GATCAACCACTGCAAATTCG	86	18	yes
GATCAACCACTGACCTGCCT	107	19	yes
GATCAACATGTTCGTGATGT	4	3	yes
GATCAACATGAACTGAGATT	32	0	yes
GATCAACATCCTCCACCAAG	21	19	yes
GATCAACAGCTGCCCTGCCT	42	9	yes
GATCAACAGCGTTGCCTTCC	151	0	yes
GATCAACACTTACGTTAGGA	32	1	yes
GATCCCCAGAAACTGAGTGT	32	13	yes
GATCTTGTGCCATCTTTGGT	33	2	yes
GATCCAGGACAGCTAGGGCT	8	6	yes
GATCGGCTCTTCCCACCTAC	1	1	yes
GATCCAGGAGGCTCTGCACG	210	7	yes
GATCCACCTCGAGTGACCTT	3	1	yes
GATCACAATGTAAAGGTTTG	42	5	yes
GATCCCAGCATTTCTCAATT	39	15	yes
GATCCCAGCATCGGCAAGCG	286	35	yes
GATCCCAGCAGTTCCAACAC	57	1	yes
GATCCCAGCAGCTGTTACCT	89	15	yes
GATCCCAGCACTGCAAAAGA	65	5	yes
GATCCCAGCACACACCGTGA	69	8	yes
GATCCCAGATGATACCCACT	77	3	yes
GATCCCAGAGGAAAGGGTTT	75	10	yes
GATCCCAGAGACAATCTCAT	1040	13	yes
GATCCCAGACGCCTCAAATG	42	14	yes
GATCCCAGAAGCCGCACAGG	11	2	yes
GATCCCAGAAGCACACTGGC	2	2	yes
GATCCCAGAACCATTGCCTG	9	1	yes
GATCCCACTTCACCTGTTAT	61	3	yes
GATCCCACTGTTGATAAGGA	13	2	yes
GATCCCACTGCTCATTTGAC	55	12	yes
GATCCCACGGTAGAACCTGA	26	4	yes
GATCCCACGAGCCAGAGAAC	507	19	yes
GATCCTGCATCACTTGTTTT	2	2	yes
GATCCAGGAAATGCTGGAGA	7	3	yes
GATCCAGGAAAAAGTGTTTC	44	6	yes
GATCTGTCTGTAGCGGTCAA	5	5	yes
GATCTGTCCAGGGGACATTA	47	2	yes
GATCCAAGTCAGGGAGAAAG	52	2	yes
GATCCCACCTGTCACCCCAT	1	1	yes
GATCCCACCTCACGTGTGAT	107	77	yes
GATCCCACCGCAGCTACCAG	280	34	yes
GATCCCACCCCAGTAGGAAG	31	5	yes
GATCCCACCATTCTCCTTGG	50	2	yes
GATCCCACCATCCTACCTAC	27	9	yes
GATCCCACCAACCTACACTA	1	1	yes
GATCCCACATTTCCCTTGCC	54	15	yes
GATCCCACAGTGTGACTGAT	110	2	yes
GATCCCACAGGCCGGTGGAG	365	5	yes
GATCCCACAGCCAGGCTCAC	172	3	yes
GATCCCACACTTAAGACTTC	15	15	yes
GATCCAGCAGCCGAGACTGA	44	4	yes
GATCCAGCACTGAGACACAC	4	0	yes
GATCCCACACAGCAGACAGA	67	13	yes
GATCCCAATTGGTGGAAAGG	79	17	yes
GATCCCAATTCTGTCCCAAT	40	5	yes
GATCCCAATTACAACCCACT	125	2	yes
GATCCCAATGGTCACACACC	81	3	yes
GATCCCAATGCTGCCCCATC	172	24	yes
GATCCCAATGAGCCCACCTA	53	3	yes
GATCCCAATAAACCCATGAG	30	34	yes
GATCCCAAGTTCAAAGCCAG	87	6	yes
GATCCCAAGTGCTGGGAAAG	27	9	yes
GATCCCAAGTCCAACACCCA	55	8	yes
GATCCCAAGGTTGCTCAAGA	3	3	yes
GATCCCAAGCCAAGAAACAC	5	4	yes
GATCCCAAGAGGAAGGGTAT	38	12	yes
GATCCCAAGAGAAAGGAGTG	1	1	yes
GATCCCAAGAAACTACTTGA	234	1	yes
GATCCCAACTGTCAGTGCCA	132	8	yes
GATCCCAACTGTAACAGCAA	2	2	yes
GATCCCAACATTGTTGGCAA	22	0	yes
GATCCCAACACCCATATCCA	47	5	yes
GATCCCAACACAGCGATATG	341	13	yes
GATCCCAAATTGGGTTGTCA	16	1	yes
GATCCCAAATCTGTGGTGTG	29	3	yes
GATCTCATCCAAGCAAATGG	48	11	yes
GATCAGGGCTCCAGTGGTCC	36	4	yes
GATCAGGGCCTGGACTCTGG	9	8	yes
GATCCAGAGCTCCTAGCACT	59	2	yes
GATCCCAAACTGTATCCTTG	53	10	yes
GATCCCAAACTGCTTTCTCA	4	0	yes
GATCCCAAACTGAGGCAGCA	58	12	yes
GATCCCAAACTACTTAATAG	176	7	yes
GATCCACGTGCCTTTGTCTC	54	6	yes
GATCCCAAACAGCTAATATG	49	5	yes
GATCCCAAACAACTAAGAAT	421	11	yes
GATCCCAAAATGCTGCGGAG	11	12	yes
GATCCCAAAATAGGTGTTGA	7	8	yes
GATCCCAAAAGGGACATTGT	11	0	yes
GATCCCAAAAACCGTGCAGC	2	0	yes
GATCCCAAAAAATCTGTGCC	434	6	yes
GATCCATTTGCTTACACTGT	16	9	yes
GATCCATTTCTTCTGCATGA	196	4	yes
GATCCATTGTTCCTCTGTTT	8	4	yes
GATCCATTGTGTGGTTTAAC	45	2	yes
GATCCATTGGTTTCTCAGTC	80	5	yes
GATCCATTGAGACGTATGAA	27	11	yes
GATCCATCTTTTTCTTTGGA	54	6	yes
GATCCATCTTCAGCTGACTG	52	14	yes
GATCCATCTCTTTCCTTCTG	3	1	yes
GATCCATCTCCTCTGGCTCT	364	27	yes
GATCCATCTCCAGCACATGC	17	16	yes
GATCTGGTCCCCTGTTCTCC	66	6	yes
GATCTGGGTGGCCAGTACTT	16	15	yes
GATCCAGAATGTCAGCTGGA	49	5	yes
GATCCAGAAGGGTCTCTCTC	11	1	yes
GATCAGGCCCTAAAGCATTG	98	9	yes
GATCCATCGACTGTGATAGG	5	5	yes
GATCCATCCTTACTTGGTTT	56	6	yes
GATCCATCCCCGGCAAAGAG	50	10	yes
GATCCATCCCAGAGGGACTG	592	14	yes
GATCCATCCAGCATTTATGT	1	1	yes
GATCCATCCAGCAAAGAGGA	27	5	yes
GATCCATCCAATGGCTTACC	272	5	yes
GATCCATCAGGGCTGAGCCT	85	2	yes
GATCCATCACAGGACTATGT	28	10	yes
GATCCATAGCACAAAGCCAC	79	6	yes
GATCAGGAGCAGGCAACACC	84	15	yes
GATCCATACCCACCACTGTG	6	5	yes
GATCCATACCATAGCCAAAA	25	24	yes
GATCCATACAGCATTTTGCG	88	11	yes
GATCCATACAATTTGTGCCA	389	33	yes
GATCCATAAGTTTGCCCAGT	111	17	yes
GATCCAGTTTTGGGAAAGGA	77	11	yes
GATCCAGTTTCTGACTCGGG	107	14	yes
GATCCAGTTGTTTGAAGATT	5	3	yes
GATCCAGTTGTCAAGACAAA	4	0	yes
GATCCAGTTGGAGAGATTTG	44	3	yes
GATCCAGTTGCTCTAAGTTT	7	0	yes
GATCCAGTTCTGCTCAACTA	24	2	yes
GATCCAGTTCTACGAGCGGC	36	7	yes
GATCCAGTTCTAAAACTTGT	395	15	yes
GATCCTTGACCAGAAGTCTC	115	0	yes
GATCCAGTTACCAGAAGATG	109	1	yes
GATCCAGTGTGTTGCTGGCA	68	9	yes
GATCCAGTGGCAGCCTCAGC	57	51	yes
GATCCAGTGCTGGGGAGATG	39	0	yes
GATCCAGTGCCTCATTGTTG	74	13	yes
GATCCAGTGAGAGCCAGACA	4	2	yes
GATCCAGTCTGTCCTAGATG	194	28	yes
GATCCAGTCCTGGAGGACAG	518	8	yes
GATCCAGTCCATTCAGCAGT	97	19	yes
GATCCAGTCAGGACATATGA	5	4	yes
GATCCAGTCAGCCCCTGGGG	261	28	yes
GATCCAGTACTTGGTTTGTG	54	8	yes
GATCCAGTACTACCAGAATG	16	2	yes
GATCCAGGTTCAGTAAATTA	29	3	yes
GATCCAGGTTCACCACCGGG	89	2	yes
GATCCAGGTTCAATTTCCAG	112	27	yes
GATCCAGGTGTGCTGAGTGG	199	25	yes
GATCCAGGTCCGTGAACCCC	26	23	yes
GATCCAGGGTGTGCAGTGGG	113	12	yes
GATCCAGGGTGCCCCTCCAA	64	3	yes
GATCCAGGGTCCTCTGCCTG	33	2	yes
GATCCAGGGGGGACACCTGC	106	7	yes
GATCCAGGGCTCAGGAGCAC	7	5	yes
GATCCAGGGCGATGTTGGGG	36	3	yes
GATCCAGGGCCTGGTGGAGG	66	5	yes
GATCCAGGGAGCAATAACCA	7	8	yes
GATCAGCGGCCGAATGTCCC	25	23	yes
GATCAGCGCAGGCCCCAGCC	22	13	yes
GATCAGCGCAGACCTGGACG	3	3	yes
GATCTGGCACTGCTTTAGCC	18	18	yes
GATCCACCAGGCTGTGACCA	1	1	yes
GATCCACCAGGATTGAAGGA	91	6	yes
GATCCACCACAGCAGGCAGG	2	2	yes
GATCAGCCTCAGTCTTCAGG	5	5	yes
GATCAGCCGGGGCTTTGAGG	102	17	yes
GATCCAGGCTCGGGAGCTAA	44	1	yes
GATCCAGGCTCACAGTGTGA	138	7	yes
GATCCAGGCTAACCAGACTG	1	1	yes
GATCCAGGCGGCCCTGCCAG	44	4	yes
GATCCAGGCGGCCAAGAACT	86	3	yes
GATCCAGGCGGAGGATGACG	28	6	yes
GATCCAGGCCTCCCTTCTTG	106	14	yes
GATCCAGGCAGCTGTGTACA	28	6	yes
GATCCAGGAGTTCAAAGAGG	379	96	yes
GATCCAGGAGGGGTTTGCTC	1	1	yes
GATCCAGGACTTCTTCATCC	22	2	yes
GATCCAGGACCTGGAAGTAT	42	9	yes
GATCCAGGACCATCCTCTCA	30	8	yes
GATCCAGGAAGTTTTGTTGT	6	3	yes
GATCCAGGAACTACTCCACA	32	5	yes
GATCCAGGAAAGCAGCCTGT	155	25	yes
GATCCAGCTGGGCGAGGATG	217	7	yes
GATCCAGCTCAGGCGGTGTC	7	7	yes
GATCCAGCGCTCTCGGGACT	100	13	yes
GATCCAGCGAGAAAGAAGAA	311	9	yes
GATCCAGCCTTCCTTAGGCC	7	7	yes
GATCCAGCCTGAGCTCAGTG	37	2	yes
GATCCAGCCTGACCTGCACA	271	39	yes
GATCCAGCCCATACAGAAGA	71	5	yes
GATCCAGCCAGTCTTCAAAG	2	2	yes
GATCCAGCAGTTAAAGCAGT	69	6	yes
GATCCAGCAGAGAGGGCAGG	67	14	yes
GATCCAGCACCGTGTGTACC	116	26	yes
GATCCAGCACATACAAGTCT	19	5	yes
GATCCAGCAAACTTGGTTGG	134	4	yes
GATCCAGCAAAACTACTGCT	13	5	yes
GATCCAGATGATGGTTCTTT	69	0	yes
GATCCAGAGTGGCACAGGGT	194	10	yes
GATCCAGAGTGGAACTGTCC	9	8	yes
GATCCAGAGCTTCTGCAAGG	150	19	yes
GATCCAATTCGAGAAGTCAA	2	0	yes
GATCCAATGCTGACCTGGCT	28	2	yes
GATCAGCAACTCCTGCTTCA	37	6	yes
GATCCAGAGCTGGAATAGCA	4	4	yes
GATCCAGAGAGACTTGGTTG	22	4	yes
GATCCAGAGAACTCAGCTGT	41	2	yes
GATCCAGAGAAAGCAAAGGC	21	6	yes
GATCCAGACGCCAAGGCTGC	10	10	yes
GATCCAGACGAATCTTGTCA	7	6	yes
GATCCAGACCTGCCACAGAC	17	4	yes
GATCCAGACCTCTTCATGTT	174	14	yes
GATCCAGACCCGGGAAGGGA	138	1	yes
GATCCAGACAGAATGTCAAG	15	2	yes
GATCCAGAATTGCTTTCCCA	45	8	yes
GATCCAGAAGCAGTGGAATC	12070	202	yes
GATCCAGAAGAACCTACCAC	24	22	yes
GATCCAGAACGACCTGAACC	39	7	yes
GATCCAGAACATTCTAGAAA	76	4	yes
GATCCAGAACAGTACAGCGT	160	16	yes
GATCCAGAACACATTAACCT	66	12	yes
GATCCAGAAAGAACGATTTG	83	6	yes
GATCCACTTGGGCTCTGTCA	161	9	yes
GATCGCCACCTACCGCCGCC	2593	453	yes
GATCCAGAAAGAGCTAGAAG	1	1	yes
GATCGCCACCTACCGCAAGC	679	8	yes
GATCCTGGGTTCTGGGGTCT	2	2	yes
GATCAAGTTTGCCGTCCATG	1	1	yes
GATCCAAACCCTGCCAGTGA	10	0	yes
GATCCCTGATGCTAAAGAGA	6	6	yes
GATCCCAGGGGAGCTGAGGG	24	4	yes
GATCAACAGTCTGATTCACT	87	2	yes
GATCTTGCTGTTGTGGATGT	34	15	yes
GATCAACACTACGGTGCCAG	39	0	yes
GATCAAATTCCCACTGCCCG	305	70	yes
GATCATGAAAAACGGGGAGA	54	24	yes
GATCAGTTGGACTAAGGATG	13	8	yes
GATCCTCACATGGAAAGTAC	4	4	yes
GATCCTCAACGAGGATGGCA	314	4	yes
GATCCTATGTTGCTGGAGCT	243	18	yes
GATCCTAGTGGGTCTACCAG	160	3	yes
GATCCTAGTGCTGCTCTGGC	57	9	yes
GATCCCTTCCAGTGTGGGAA	3	1	yes
GATCCTACTGGGGAAGGCCA	17	19	yes
GATCCTACCGCCTTTAACAA	56	2	yes
GATCCTACAGAAGGCCCACT	30	8	yes
GATCTGGAGCTCCTGGGATG	48	2	yes
GATCTGGAGCCTCCACGATG	231	18	yes
GATCTGGAGAAGCGACGTAT	33	35	yes
GATCTGGACTTGTTTTCTGG	66	11	yes
GATCTGGACTTCTGAATCTG	10	1	yes
GATCCACTTGTGCATGTAGT	8	0	yes
GATCTGGAAGTTTCGTAGGC	145	31	yes
GATCTGGAAGTTGGCAGATG	47	5	yes
GATCTGGAAGCGGGAGGGGG	16	15	yes
GATCAACAAGGAAGAGGTTT	10	2	yes
GATCAACAAATCTCCTAGGC	2407	329	yes
GATCAACAAAACTGTACCTG	31	3	yes
GATCAAATTGGTCTTCACCT	19	6	yes
GATCAAATGTGCCATAGCAC	34	2	yes
GATCCGTGTCCCTGCGTGCA	222	0	yes
GATCCGTGGGCCTGGCCTCC	278	31	yes
GATCTGGAAGAGACTTTGGC	626	211	yes
GATCCGTATTGAGGCCAATG	143	21	yes
GATCTGCTTGCCAGGCCACT	5	4	yes
GATCAAGAATTTGGTGTGGA	3091	16	yes
GATCTGCTTCGCCGGGACGT	103	1	yes
GATCTGCTTCCAGGTCCTCA	132	4	yes
GATCGTAGCTGATGAGGTCA	6	6	yes
GATCTGCTGTCCAGAGCAAG	209	1	yes
GATCTGCTGCTGGTGCTTGC	9	10	yes
GATCCCCTTTCTCTATGTCT	461	34	yes
GATCAAATCACTGGCAGACA	115	8	yes
GATCAAAGTTGTTTCACTGT	55	7	yes
GATCAAAGTGAGGGAAGCGG	23	5	yes
GATCAAAGTCTCCATAGTTG	23	8	yes
GATCAAAGTCATTGCGGTTA	123	14	yes
GATCCGGGCAGCCCAGGAAA	10	7	yes
GATCAAAGTACTTGTTAGGG	1	1	yes
GATCAAAGGGGGCAAAGTCT	37	0	yes
GATCAAAGGCTTCAATCACA	43	2	yes
GATCCGGCCCTACTGTGTGT	96	30	yes
GATCAAAGGAAAGGGGAGGG	657	16	yes
GATCAAAGCTGGCAAGGTTC	20	5	yes
GATCAAAGCTGGCAAGGTAC	63	6	yes
GATCAAAGCCGTTCTTTTCC	24	22	yes
GATCAAAGCCCGGAAAGGCA	4995	17	yes
GATCAAAGCCAAGTATCCTG	78	6	yes
GATCCGCTGTACTCTCCTCC	32	2	yes
GATCCGCGCTGAGGAGCAGC	27	9	yes
GATCCGCGAATGCTCGGAGG	564	60	yes
GATCTGCTGAAGGGCAATGG	9	8	yes
GATCTGCTCTTCAATGTTGT	120	5	yes
GATCTGCTCCCTGTATGTGC	43	4	yes
GATCCGCAGTGGCATGTTCT	268	11	yes
GATCCGCAGCGCCTCTTCTT	69	4	yes
GATCCCTGTCTAAGCTAGAT	29	12	yes
GATCCCTGAGAACAGGGACT	2	2	yes
GATCTGCGGGTTGTGAAGAG	51	5	yes
GATCCTAACTTACTCCATTT	3	3	yes
GATCCGTTGCTGACCTTGCG	26	2	yes
GATCCCAGCCCACAGGATGT	5	5	yes
GATCAAAGAGTTCAGCAAGA	23	1	yes
GATCAAACTTGGCAGTGGTG	1	1	yes
GATCAAACTGAGTCTGAAGG	432	8	yes
GATCAAACAGTAAAGGTGTG	134	16	yes
GATCAAACAGCAGCCAAGTG	5	5	yes
GATCCGAGAAAGAGAGAGGC	16	16	yes
GATCCGACTTGCCCAGAAAG	28	6	yes
GATCCGACTGCAAAATTCAT	47	6	yes
GATCAAAATGTTTGTTGCTT	19	4	yes
GATCCCTTTCACACACCTGC	5	1	yes
GATCAAAATGTGGTGCCAGA	53	15	yes
GATCCCAACCCCAATACTCA	10	3	yes
GATCTGCCTGGCTCTGCCTT	131	2	yes
GATCCCTGTGCCTAGCTGCT	41	42	yes
GATCTGCCTGAAACCAGGGG	16	18	yes
GATCTGCCTCCCCCAGCATG	92	22	yes
GATCTGCCTCCCCCAACATG	154	30	yes
GATCTGCCTCCCAAGTGCTG	76	37	yes
GATCTGCCTCAGTCCACAAG	80	6	yes
GATCCGTACAGCGGCAAAAC	5	4	yes
GATCCCCGGTGCTCTTCGTT	1	1	yes
GATCTGCCCTTTCTTCAGCA	342	3	yes
GATCTGCCCCTGACCCTCCA	9	8	yes
GATCTGCCCATAAGACTTCC	11	3	yes
GATCAAAATGCTTGGAGAAA	11	2	yes
GATCAAAATGCCTGAGCTGT	42	3	yes
GATCAAAATGAGGCAGAGGA	83	9	yes
GATCCCTGGTCCTTAGGTGG	92	14	yes
GATCAAAACCTTCTCTGAGG	57	4	yes
GATCAAAACATCAGAAACCA	13	11	yes
GATCAAAACACGATGTCCAA	1	1	yes
GATCAAAAACAAAAGCGAAA	28	4	yes
GATCCGGGGCCTCTGGAAAG	16	1	yes
GATCTGCCCACCATATTCCT	181	17	yes
GATCCGGGCGTCGGCAGAGC	66	3	yes
GATCTGCCAGGAACATGAGA	2	2	yes
GATCTGCCAGCCGTACATCC	28	0	yes
GATCCCTGATTGCCTCCATG	474	12	yes
GATCCCTGATGCAAAAGAGA	405	2	yes
GATCCCTCTGCAAACCAAAC	514	23	yes
GATCCCTCTCCCAGCTCTTC	15	15	yes
GATCTGCAGGAGGATGCCTG	243	5	yes
GATCAAGACTGTGGATGGCA	18	5	yes
GATCCCTCAGTGTAGCATAG	20	6	yes
GATCCCTCAGCTTTCTCCAA	57	5	yes
GATCCCGTCAACTTCAAGCT	494	4	yes
GATCTGATTTTCCCCCTGTT	2	0	yes
GATCCCGGGGGCTCCAGGAA	6	0	yes
GATCCCGGGGCAGTCCAGCC	10	2	yes
GATCCGAGTTGGGGAGCCTG	2	0	yes
GATCAAATTCCCACTGCCCC	2441	218	yes
GATCTGATTCCCGCAGGTTC	289	43	yes
GATCTGATGCTTCTTCTGTG	27	11	yes
GATCCCGGGCAATGCTTTCA	92	45	yes
GATCCCGCCCAGAGTGGAAG	13	2	yes
GATCCCCTTGGGATTAAAGG	29	16	yes
GATCTGAGTTTTTTGTGCAG	3	3	yes
GATCTGAGTTCCCGAAGCAA	107	29	yes
GATCCTGCTCCTGTCTTTTC	1	1	yes
GATCCCCTGAGAAGCTGTAT	88	7	yes
GATCCCCTCCCCCAGCTAAA	10	10	yes
GATCCCCTAAAACGAGTTGC	54	6	yes
GATCCCCGGCGTCTGTTTGA	6924	153	yes
GATCCCCCAGCCAGGCCAAA	23	3	yes
GATCCCCCAAGTTCAAGCCA	136	4	yes
GATCTGAGCCCCCTGAGGTT	17	19	yes
GATCCCTGGAGCCACCAGCT	68	1	yes
GATCCCTGCTTTCATGGAAG	115	2	yes
GATCCCACCATAGAGGATTC	24	2	yes
GATCTGAGAAACGGGGAAGC	78	16	yes
GATCCCTGAGAAGTTCCAGC	1	1	yes
GATCTGACTCCCTCTTCTGT	1260	30	yes
GATCTGACGCCGAGGAGGTA	89	11	yes
GATCTGACCTGGGTCCTGAC	30	29	yes
GATCTGACCTCAGGTTCCCA	6	6	yes
GATCCCTATGGACACTGACA	118	1	yes
GATCTGACCCGTGTGCTGGC	6	6	yes
GATCCGCGCTGACAAGCACA	47	7	yes
GATCAAGACTCTGGACAAGG	27	3	yes
GATCTATTTTTGCACTGGAA	78	12	yes
GATCCAGCACTGCCTCTGGA	13	3	yes
GATCCCTCCGCGGGGACAAG	3	3	yes
GATCCACAGAATGCTGACTT	22	6	yes
GATCACATGGGTGGGGACCT	8	8	yes
GATCGAGTTCAGAGGCGAAG	23	22	yes
GATCAGAGTGGACGCCGAGG	2	2	yes
GATCCACTTCAGAAGCAGCC	14	7	yes
GATCCACTGTTGTCCAGAGG	18	9	yes
GATCCACTGTGTGTCTGGTA	9	2	yes
GATCCACTGTCTTCCTAGAG	408	16	yes
GATCCACTGGGCCAAGGAGC	10	10	yes
GATCCACTGGCTGGATATAG	14	13	yes
GATCCACTGGAGATACAGGT	3	3	yes
GATCCACTGCTGGAAGTACC	449	34	yes
GATCCACTGAGAAGGTGACC	1	1	yes
GATCCACTCTTTTCATACCC	177	30	yes
GATCCACTCGGGGGCTGTGA	114	5	yes
GATCCACTCCTGCAGAGCAC	46	7	yes
GATCCACTCCAGGCTGCGAG	141	0	yes
GATCCACTCAGACGAACAGT	82	0	yes
GATCCACTACTACCAGGGAC	1	1	yes
GATCCACGTCTCGTCGTCAG	83	15	yes
GATCCACGGGGCACCCGCAC	128	7	yes
GATCCACGGACACCAAGTTA	70	9	yes
GATCCACGACTACTTGGACA	2	2	yes
GATCAAACAGAAGCGCCAGG	14	2	yes
GATCCACCTGTGGTGCTAGT	79	1	yes
GATCCAACTGCCTTTGCCTC	80	21	yes
GATCAGAGCGACAGGACAGC	1	1	yes
GATCAGAGCCGCCTGACTTC	206	1	yes
GATCCCAGCTTCAGGACACC	16	15	yes
GATCCACCTGCTTCTCCCTT	24	2	yes
GATCCACCTGCTTCTACCTC	52	19	yes
GATCCACCTGCCTGTGCCTC	240	13	yes
GATCCACCTACTTTTTCAGC	6	6	yes
GATCCACCCTGAAAGTGTCT	11	10	yes
GATCCACCCACCCTGGGCAT	114	26	yes
GATCCACCAGTGCTTCTGCT	126	4	yes
GATCCACCAGTCCTTGAAGC	141	19	yes
GATCCACCAGGATGTTTGAT	23	3	yes
GATCCACCACATGTGCCAAA	191	15	yes
GATCCACATTTGCTGGTTTG	148	13	yes
GATCCACATTGCTGTCCTAT	23	21	yes
GATCCACATTCTCCATTCTA	2	2	yes
GATCCACATTACCATCAAGC	2	2	yes
GATCCACATGTGCTCGCAAA	104	8	yes
GATCCACATGTACCATCAAC	3	3	yes
GATCCACATGCGTGTAGCAG	545	22	yes
GATCCACATGAGGAGATACT	75	1	yes
GATCCACATCTCCCTCCCCT	9	8	yes
GATCAGACCGTGGCGGTTGG	6	6	yes
GATCTACATGGTGGAAGGAG	1	1	yes
GATCGCCCTTCCCAACAGTT	3	3	yes
GATCCACAGTCCCTATGTGT	13	2	yes
GATCCACAGTCAGCAAATCC	4	2	yes
GATCCACAGGGTACCTCCCT	72	3	yes
GATCCACAGGAGGGTTCCAA	39	8	yes
GATCCACAGATTTTCTTGGG	112	7	yes
GATCCACAGATTCTGCCTGT	30	8	yes
GATCCACAGAAGCACTGCAG	15	2	yes
GATCCACACTTCTGAAGACT	3	3	yes
GATCCACACTGCCACTAAAA	25	7	yes
GATCCACACGGAAGGGGAAA	10	3	yes
GATCCACACCTGAAATGCTA	3	3	yes
GATCCACACCCTAACTCCCA	26	23	yes
GATCCACACACGACTCTCCA	192	17	yes
GATCCACAAGTCTTAGCTGT	19	8	yes
GATCCACAAGGCCCTCATCA	6	4	yes
GATCCACAAGCGACTCATTG	5375	289	yes
GATCCACAACCTGATTCCCG	28	6	yes
GATCCACAAAGGCAGAGCCC	23	21	yes
GATCCACAAAACCAATAAAA	5	5	yes
GATCCAATTGTGGTGTTCTG	8	8	yes
GATCATTGCCAAGCCAGGCT	2	0	yes
GATCATTGACTCCCAGATTT	9	8	yes
GATCCAATGGTTTTGCCTCA	53	35	yes
GATCCAATGGCATCTTCTGG	10	9	yes
GATCCAGAGGCAGGTGCAGA	253	18	yes
GATCCAATGCCATCTTCTGG	6	6	yes
GATCCAATCTTTGTCTTAGG	103	18	yes
GATCCAATCCCTGTGCAGCA	31	4	yes
GATCCAATCAGGGCAAGAAC	16	18	yes
GATCCAAGTTTGGATAATGA	253	16	yes
GATCCAAGTGTTTAACCATA	63	0	yes
GATCCAAGTCCAGGAACCCT	452	19	yes
GATCCAAGTCATGATTTGAA	247	6	yes
GATCCAAGTACTACCATAGG	46	1	yes
GATCCAAGTACACCTAAGGG	99	2	yes
GATCCAAGGTCAAGGCAGAG	189	7	yes
GATCCAAGGCCTCAGGTCAC	166	15	yes
GATCCAAGCTCTGGGAAGCA	18	3	yes
GATCCAAGCTCATCATTTGC	13	4	yes
GATCCTAACAAAGGCCGGGA	36	0	yes
GATCATTACAAAGTTTCCGT	2	2	yes
GATCCAAGCGTGAGCCAGTC	141	5	yes
GATCCAAGCAGGTGCTTCCT	4	3	yes
GATCCAAGCAGGCTTGAATA	7	3	yes
GATCCAAGCAGGCCCCTTAT	157	6	yes
GATCCAAGAGGAGGAGCACA	23	1	yes
GATCCAAGACCAGGGTGGCT	252	28	yes
GATCCAAGAAGTCAGTCGGC	18	1	yes
GATCCAAGAAAGGAAGAAGA	63	0	yes
GATCCAGGCCAGGAACACAA	45	2	yes
GATCCAACGTGTTAGCCTTG	189	11	yes
GATCCAACGTGGTCTTTAAG	32	3	yes
GATCCAACGTAATCTTTAGG	24	0	yes
GATCCAACGAGTAGGAGTGT	45	4	yes
GATCCAACGAAAAACACTTG	7	6	yes
GATCCAACCCCACCTCAAGT	54	15	yes
GATCCAACCAGACCTTCTTT	2	2	yes
GATCCAACAAAGGTTGTGAG	195	12	yes
GATCCAACAAAACACGCAGG	18	9	yes
GATCACTGTCGTGTTTGGTA	119	2	yes
GATCATGGTTCGGTGGCAAT	66	2	yes
GATCACTGGAGCAGGCCTCC	5	5	yes
GATCACGCTATATCTGTTGC	29	5	yes
GATCATGCTTACCCTGGACT	12	3	yes
GATCCAAATATTGTCATAGC	4	3	yes
GATCCAAAGTTGGCCAGCAT	304	3	yes
GATCCAAAGTCACACCTCCA	92	16	yes
GATCCAAAGGCAGCAAGAAG	48	19	yes
GATCCAAAGCTGCTTAAATC	40	5	yes
GATCCAAAGCTCAGGAGACA	5	5	yes
GATCCAAAGCCCCAGTAGAA	10	9	yes
GATCCAAAGCAGTGCTCCCA	170	9	yes
GATCCAAAGAGAGAAAGAGC	79	6	yes
GATCCAAAGACTCAGGTGTT	27	5	yes
GATCCAAAGACACAGTCTGT	592	32	yes
GATCCAAACCCCAGTGTACC	176	9	yes
GATCCAAACAAGAAGACTGA	3	3	yes
GATCCAAACAAAGACACAAG	90	11	yes
GATCCAAAATGTGGCATTTT	267	28	yes
GATCCAAAATGCTACTGTTA	50	13	yes
GATCCAAAAGGTTACTGAAA	94	7	yes
GATCCAAAAGGAGACTTCTA	177	4	yes
GATCCCGCCAAAAGAATTAA	8	8	yes
GATCCTGAGGTTTAGGAAGG	18	16	yes
GATCCAAAAGCCTGCTCGGT	75	7	yes
GATCCAAAAGCAGCGTTTGC	112	14	yes
GATCCAAAAGAGCCTGATGG	126	30	yes
GATCCAAAACAGCAAATAGG	114	3	yes
GATCCAAAAATGGGGATGTT	134	7	yes
GATCCAAAAATACAGCCTGC	6	4	yes
GATCATTTTTCTGTAGCCAT	20	0	yes
GATCATTTTTATTGTGGGGT	8	9	yes
GATCATTTTGTCGAGTGAGT	13	2	yes
GATCATTTTCTGCCGTACCA	6	5	yes
GATCATTTTCCCAACGTTAC	23	1	yes
GATCATTTTACTGGTGACTT	32	3	yes
GATCACTCCTTGCTTTGCCA	20	8	yes
GATCACTCAGGGTGGGCAGT	31	3	yes
GATCATCTCCACATACAGGA	40	1	yes
GATCACTAGCAAGCCAAAAT	29	5	yes
GATCACTAAGTTGAGCAGTT	11	5	yes
GATCACTAAAGGGTTTCCTG	48	18	yes
GATCACGGTCACTTTCAACA	101	6	yes
GATCATTTGTCCAGGAGTGT	14	3	yes
GATCATTTGCGTTTGGAGGT	35	1	yes
GATCATTTGATTCCCCTCCC	1	1	yes
GATCCCAAATGTGAAGACAG	12	1	yes
GATCTGCGCTTCCAGAGTGA	25	24	yes
GATCATTTCTTTCTGGCCTG	169	2	yes
GATCATTTCGGTGACTGAAG	49	5	yes
GATCATTTCAGATGGGCACA	13	7	yes
GATCATTTCACTGGTGGCTG	29	13	yes
GATCACGGCATCGAAAGGAA	34	11	yes
GATCACGCTGAGGGTGTCTG	50	8	yes
GATCACGCCCCACTTTACAT	40	6	yes
GATCCTAACCAGGCTAAGCT	45	4	yes
GATCCTACCTGAGTGGCAGG	261	7	yes
GATCATTGGAGAGGGGTCTG	41	10	yes
GATCATTGCCACGGAAAACA	27	1	yes
GATCATTGCATTTGTTGTCT	1	1	yes
GATCATTGCAGTCTGAGGCT	42	9	yes
GATCATTGAGAGCAAGCGAG	4	4	yes
GATCACCGCCTGCACCGCAG	226	11	yes
GATCATACCCGTCCCTCTCT	31	5	yes
GATCACCCTGGGCCTGGTCA	196	1	yes
GATCACCCTCAGCTGAAGAC	20	2	yes
GATCACCCCCAGGAAGAGTA	39	8	yes
GATCATTCTCCAAAGGCAAC	76	4	yes
GATCATTCAGGACAAAGGAG	46	14	yes
GATCATTCAGACAGTACATT	5	1	yes
GATCATTCACAGAACAGAGT	6	2	yes
GATCATTAGTTCAAGGCCAA	25	3	yes
GATCATTAGGGGTTTGGTCT	357	12	yes
GATCATTAGCATGCCAGGAA	3	3	yes
GATCATTAGAGTTTGTTAGT	2	2	yes
GATCATTACTGTGTGAGTGT	35	4	yes
GATCATTTGAGCCAAGAGGT	13	4	yes
GATCTGGCTGGTGACACAGT	9	10	yes
GATCAGGTCTTCTTGGCTGT	36	13	yes
GATCCTCCTGCCTCAGGTCT	10	11	yes
GATCCTTCTGAATGCCTGCT	144	22	yes
GATCCCCACTTATGTGACTG	24	23	yes
GATCCCCAAGGCAGCTACCA	39	36	yes
GATCCCTTCTCTGACCTTTG	36	9	yes
GATCCAAAGGTCGCCAGACA	1	1	yes
GATCCCGTGAAGGTGATTCA	43	4	yes
GATCCCGGATTTGCTCCTGT	33	7	yes
GATCCCAGTGGATGAGCATG	51	11	yes
GATCTGACCCACCACGGAGA	40	8	yes
GATCTGACACTCTTCTGGAG	76	6	yes
GATCCCAGCACTTGGGAGGG	357	181	yes
GATCCCAGCACCGAGGGGAA	160	7	yes
GATCCCACTGCACATAGGAC	1650	15	yes
GATCCCACGGGGTGCAGTGA	128	9	yes
GATCCCACGAAGAATTCTTC	39	12	yes
GATCCCACCTAGCAGCCACC	849	34	yes
GATCCCACCACCATGTTCAG	21	0	yes
GATCTGAAGGAGTCCAGGGT	7	7	yes
GATCCCCTCCCTCATGTTAA	24	4	yes
GATCAAACAACCCAACAGGA	773	334	yes
GATCCCCGTGTCTGTGGAAA	7	0	yes
GATCCCAAGTTTTTCCTTAA	19	10	yes
GATCTCTTTTCCTGACCCTC	240	29	yes
GATCCCAAAGCCTCGTATGC	48	19	yes
GATCTCTTTGCCGAGTTTGG	41	4	yes
GATCTCTTCGTCGCCATCGT	1773	128	yes
GATCTCTTCGTCGCCATCGC	149	10	yes
GATCTCTTCGTCGCCATCGA	324	17	yes
GATCCATTCGCTGTAACATG	3	3	yes
GATCCATTCCAGAGGGACAT	40	3	yes
GATCCATGTTGACCAAATGC	53	3	yes
GATCCATGTGTTGGTTGAGA	58	11	yes
GATCCATGTGATTGGAAAGT	26	6	yes
GATCCATGTGATGGACTGCA	50	8	yes
GATCACGTACTGTGCCTTGT	11	4	yes
GATCCCCAAGAAGTCTTATT	10	11	yes
GATCCATGGTGGGGCCATTT	116	9	yes
GATCCATGGTAGTCAGATAG	67	4	yes
GATCACCCAGAGTTCCCCCT	2	2	yes
GATCTCTGTCCGAACTGTGA	157	1	yes
GATCCCATCAGGATGCTTAT	17	1	yes
GATCCATGGGCTCCTTTGTG	15	2	yes
GATCCATGGGCCTTAGGGCT	124	1	yes
GATCCATGCTCTGATGAGCG	101	5	yes
GATCCATGAAGTTTTCAGTC	83	3	yes
GATCCATGAAGTTTCCCTAC	14	13	yes
GATCCATCTGCCTAAGTGAG	2	2	yes
GATCCATCTGCATTTGCGGC	9311	146	yes
GATCCATCTGCACATGGCTC	14	5	yes
GATCTCTGCTCCCTACCCTT	74	67	yes
GATCCACCCAGGCCTTCAGA	5	0	yes
GATCTCTGCTCCAATCACAG	39	36	yes
GATCTCTGCTATGAGGCTAC	24	22	yes
GATCCCAGGAAGTCCCACGA	8	4	yes
GATCTCTCTGTGACGCCCAT	66	11	yes
GATCTCTCTCGGCAACTAGG	15	15	yes
GATCTCTCTCGCTGAAGGCG	5	5	yes
GATCTCTCGCCTGGACCCCT	102	32	yes
GATCTCTCCGTCGTCATCGC	357	9	yes
GATCTCTCCCAGATGGTAAA	40	3	yes
GATCTCTCCAGCTGGCTCCC	91	8	yes
GATCTCTCCAAAGCACACGC	130	10	yes
GATCTCTCAGGCCATGGGTC	69	11	yes
GATCTCTCACAACATCCGAC	474	30	yes
GATCTCTATGACTTCCAGGC	31	3	yes
GATCCAGTTTCCTCACAAAT	20	0	yes
GATCTCGGGCAATCTGGGGG	2	2	yes
GATCTCGGGAGATTGGCTGG	197	6	yes
GATCTCGGGAATCAGAGTTC	52	47	yes
GATCCAGTATCTGAAAGACT	5	5	yes
GATCTCGCTTACAAGAAACC	69	4	yes
GATCCCACCTCCCCCCAGTC	146	24	yes
GATCTCGCCTTATGTTGTCC	24	2	yes
GATCTCGCCCTGTCAAGCAT	54	9	yes
GATCTCGCAGCCTTCCCCTC	363	29	yes
GATCTCGCAAGCACAAAGCC	56	0	yes
GATCTCGACCAGTTATACCT	35	7	yes
GATCAAAGCATGCACCTGTA	63	6	yes
GATCTCGAATCAGGTCTTTT	3	3	yes
GATCTCCTTGGAAAGCGACT	24	22	yes
GATCTCCTTCACCTGAACCA	76	11	yes
GATCCAGGGTGGGAAGGAAG	114	1	yes
GATCCAGGAGACTCGAAGAT	151	2	yes
GATCTCCTGTATGACCTGGA	11	10	yes
GATCTGTGTGCTGCTCCTGG	26	2	yes
GATCCAGCTTCCCTCCGAGA	445	19	yes
GATCTATTCCTCAACCCTGT	20	19	yes
GATCCAGCGAGGGAGCTGCC	81	3	yes
GATCTCCGCCCGAGCCTACG	23	3	yes
GATCTCCGAAAGTAGAAGCA	25	1	yes
GATCTCCCTGGTCCTGGCAT	59	7	yes
GATCCAGCCAGGAAACCCCA	8	8	yes
GATCCAGCATGGGTGTCCCG	39	10	yes
GATCCAGCATCACCCAGACA	147	27	yes
GATCCAGCAGACCCAGCACA	73	5	yes
GATCCAGATTACTATGGGGA	2	2	yes
GATCCATTTTGTTCGTGGAC	66	11	yes
GATCTCCCCTGGGGAACTCG	21	3	yes
GATCTCCCCTCTTCCTGGAT	75	14	yes
GATCCAGAGTAAAGACAGCT	15	1	yes
GATCCATGTCAGAAAAGGGA	30	4	yes
GATCTCCCCACCACCCCAGG	135	21	yes
GATCAGCTGGAAAACAGGCT	7	1	yes
GATCCATTAGCTTTGTCTGA	17	1	yes
GATCTCCCAATTTTCAGGTT	8	8	yes
GATCTCCCAACCTGGCGAGG	4	4	yes
GATCTCCATCTTGGACAGCT	33	29	yes
GATCTCCATCCAGGACTAAG	417	50	yes
GATCTCCATCACGAAGACAG	36	9	yes
GATCTCCATAATTCCAACTT	30	0	yes
GATCCATGCTTTGCCCGAGA	21	7	yes
GATCTCCAGGGTGGATTTCT	166	3	yes
GATCCAGTTTTTGGTTTTGT	2	0	yes
GATCTCCACCCTATGCGAGT	57	51	yes
GATCTCCACACAGCACACAG	447	48	yes
GATCTCCAATGCTGGGTCTG	27	24	yes
GATCTCCAAGTCTCTCAGTC	16	2	yes
GATCTCCAACTGTGCTTTCA	49	1	yes
GATCTCCAAAGTCCTGCTAG	77	3	yes
GATCTCCAAAATCAACAACA	15	14	yes
GATCCTGGTGGTTGTGCAAG	13	2	yes
GATCTCGCCAGTGGTGTGTG	6	1	yes
GATCACCCAGGAAGAGAAAT	59	5	yes
GATCACCATCCTGATTATAT	89	8	yes
GATCACCAGGAAACTTGAAA	48	9	yes
GATCACCAGAAGCCATGCTC	47	8	yes
GATCATGTTGATTCTGAAAT	4	3	yes
GATCATGTTCTTTCCGCAGG	130	14	yes
GATCATGTTCCTGGAGGTCA	81	9	yes
GATCATGTTACACTTGCCAG	102	17	yes
GATCATGTGTCAAAAGCAAA	27	24	yes
GATCATGTGGCGTTCTCTCT	68	5	yes
GATCATGTGCTCACCTGCAT	2	2	yes
GATCCATGACTTACGTGTCA	3	3	yes
GATCACCAAGGGCTCCTGGG	12	7	yes
GATCACATTTTGCCTTTGGT	53	1	yes
GATCGTTTTGTTTTGTTTTG	4	4	yes
GATCACATGACCCCTGAAAT	14	13	yes
GATCTCCACCAAGAAGCTGG	29	1	yes
GATCCTCCTGTCTCTACCTC	28	4	yes
GATCATGTGAGCATCGTGGA	632	54	yes
GATCATGTCTTCTCCATGTT	728	41	yes
GATCATGTCTATCTCAGGGG	236	4	yes
GATCATGTCCCACAGGCATT	18	3	yes
GATCATGTCATTGCCTGTTA	3	1	yes
GATCATGTCAGAGGGAGATG	21	2	yes
GATCATGTACAAGCTGATGG	77	11	yes
GATCATGGGTGTTGCTACCA	83	15	yes
GATCATGGGTGTGCCAGGGG	44	5	yes
GATCATGGGGATGGACGGGG	34	23	yes
GATCACATCTACCACATGTA	67	15	yes
GATCACAGTTCATGTAATGC	39	2	yes
GATCATGGCTGCGGCAGTAA	3	3	yes
GATCATGGCCTTTACGATGC	14	13	yes
GATCATGGCCTTCAGATATG	29	5	yes
GATCATGGCCCAGACCTGAG	79	7	yes
GATCATGGCAAAGGATGACC	103	1	yes
GATCATGGACATGAAGGAAG	142	17	yes
GATCATGGAACAGATGACCA	2	2	yes
GATCATGCTTTCTTCTCTAT	24	8	yes
GATCATGCTCCTGCAGCTGA	227	80	yes
GATCATGCTCCTGAGTGGCA	64	23	yes
GATCATGCTCATCTTCACTG	5	4	yes
GATCATTGGGGGAGGGTAGT	49	3	yes
GATCATGCGCCTTTCTAAGC	85	2	yes
GATCACAGCTGTTTGCAAGG	31	0	yes
GATCACAGCTGTGATGGGAG	162	1	yes
GATCAGTCTCTGCAAGCTTA	4	0	yes
GATCACAGCCCTAGCACCTA	11	4	yes
GATCACAGCATTTCGGGGAA	2	2	yes
GATCACAGCAGCCAAGGGAC	72	50	yes
GATCATGCCCAAAACAACCA	39	9	yes
GATCATGCAGTAGTTCACAG	6	5	yes
GATCATGCAGGAATTTGAAA	42	38	yes
GATCATGCAGAAGAACGGTG	105	13	yes
GATCATGATTTCCGAGCTAC	1	1	yes
GATCATGATTCTCCCTCAGC	3	3	yes
GATCATGAGTGACCACAGTT	44	40	yes
GATCATGAGGGAGTTCCGGT	399	63	yes
GATCATGACTCAGTATCAAC	16	15	yes
GATCATGACGCTGGTAGATG	1	1	yes
GATCATGACCCTTAGACTCA	42	7	yes
GATCATGACATTCCTCAGAT	3	3	yes
GATCAGCTGAGCGTCAGGGT	2	2	yes
GATCACAGACCATGGTCTCA	10	3	yes
GATCAGCTGAAACTGAAGGC	117	2	yes
GATCACACCCTCATCAGAGT	10	11	yes
GATCCATGAAGCTGACACCA	18	3	yes
GATCATGAACATCATCCAGG	69	10	yes
GATCATCTTGTTGCGTTTCT	42	4	yes
GATCATCTTGGTGTGAGGCT	7	2	yes
GATCATCTGCTACCAATGTG	4	0	yes
GATCATCTCTTCAGAGGTGG	23	5	yes
GATCATCTCTCACCACAGGC	2713	182	yes
GATCATCTCACAGGACAGGG	158	24	yes
GATCTCTTCTTGACCAGTGA	5	1	yes
GATCACACCACTCTCAACCA	6	5	yes
GATCAGCCTGGCTCCAGGGA	92	14	yes
GATCATCTACGACAGAAAGT	17	16	yes
GATCATCGTGTCGGGATGAT	83	11	yes
GATCATCGTGCTTTCAGACT	7	8	yes
GATCATCGGCATGGCATACG	263	1	yes
GATCATCCTTGTGTTGTGAA	91	8	yes
GATCATCCTGTCAGAGTTCT	25	3	yes
GATCATCCAGGGCTGCCCCT	5	5	yes
GATCATCCACCTGCTCACTG	1679	32	yes
GATCATCCACAAACTTCCAG	6	5	yes
GATCATCATTCGTGTGCAGA	20	3	yes
GATCCTCCCCACTTACCCAC	7	1	yes
GATCAGCAATCGGGTCCTGT	34	6	yes
GATCAGGTCATCGCCTCCTT	415	51	yes
GATCAGGGTTAAGGAGGAGC	34	4	yes
GATCAGGGAAGCAGACATTG	116	3	yes
GATCAGGCACAGGGACAGCC	83	5	yes
GATCAGCTTCTTGGTTTCCT	26	6	yes
GATCAGCTGTGGGCTCTGGG	101	0	yes
GATCAGCTGCTTCTAATGAT	28	2	yes
GATCATCAGTTAGAGTTCTG	13	0	yes
GATCATCAGCTGAGGCAAGG	6	5	yes
GATCATCAAGTGTCCTGGCG	8	7	yes
GATCCTCTTTGCCAACCCCC	42	6	yes
GATCAGCAAGAATCCCTAAA	1	1	yes
GATCACAAACATAGCCAATG	8	7	yes
GATCAATGCCTGGACGGCTC	167	10	yes
GATCAGAGGCCACATAGCTT	4	3	yes
GATCAGCGTGCGCCTAGCGG	3	3	yes
GATCAGCGGTGGGAATGACG	228	14	yes
GATCAGCGCTGAGCTCCAGA	19	0	yes
GATCAGCGCCGCTGGCTTCT	19	1	yes
GATCAGCGACCTTCCAGCAG	51	9	yes
GATCAGCCTTCAATAGCCAT	64	11	yes
GATCAGCCTCTTTCCCATCA	53	21	yes
GATCAGCCCTGGCAAGGAAG	31	1	yes
GATCAGCCATCCTGGATGGA	51	1	yes
GATCAGCCAAGCCAGACTTG	91	8	yes
GATCATAGCAAAGATGGACG	38	1	yes
GATCATAGATTGGGCTACAT	18	16	yes
GATCATACGCCCAGGGAGAG	6	5	yes
GATCATACCCTCTCTGGCTT	5	3	yes
GATCATACCAAGAGGTGAGG	38	7	yes
GATCATAACAGTTCTGTGAA	4	4	yes
GATCTCGCTGCTGTGGAACG	4	3	yes
GATCTGACGCCCTCTTGTGT	6	6	yes
GATCAAGTTGGGAGTGGCAG	39	7	yes
GATCAGCAGCTGCTTTTGCA	38	8	yes
GATCAGCACTTGGTACATGG	50	45	yes
GATCAGCACTGGGGTCAACG	6	2	yes
GATCAGCACTCTCGGTATGC	60	3	yes
GATCAGCACGCTGACTCTTT	45	2	yes
GATCAGCACCACACTGGACT	3	3	yes
GATCAGAGAAACTGGGTAGA	149	4	yes
GATCAGACTAACCCCGGAGT	76	1	yes
GATCAGACGAGGTTCTCTCT	38	3	yes
GATCAGACCCAGGCTCTTGC	14	3	yes
GATCAGACCATGGTACTGGC	78	0	yes
GATCAGTTTTTGGTGTCATT	248	6	yes
GATCAGTTTTGGTCTTGATG	6	0	yes
GATCAGTTTTGACCTCTTAT	11	12	yes
GATCAGTTTGTTTTCACTGT	82	2	yes
GATCAGTTTCTGTGTAGTCT	15	3	yes
GATCAGTTTCTGTGACTGTA	8	0	yes
GATCAGTTGATATCTGGGGG	24	4	yes
GATCAGTTGAAACTTGGAAA	161	10	yes
GATCAGTTCTGAGCCGAGGA	33	12	yes
GATCAAGTGCTGTGACAGTG	5	5	yes
GATCAAGGTGGCGGAGGACG	8	2	yes
GATCAAGGTCGGAAAGAAAT	213	11	yes
GATCAGACAGCAGACGGGAA	323	29	yes
GATCAGACACATTTCGACAG	8	9	yes
GATCAGAATGTCCTTCCAGT	121	10	yes
GATCCTGCTGGAGGTGAACA	1	1	yes
GATCAGAAACCCGAGCTGAA	5	5	yes
GATCACTTTGACTTCATCCT	26	2	yes
GATCTGTGCAAAAGCAGTGA	642	5	yes
GATCACTGTGCGCCCCCTCC	90	16	yes
GATCACTGGCAAGCACGAAG	80	2	yes
GATCACTGCCTGACAGCAGC	41	2	yes
GATCACTCTTCAGAGAGTGA	38	3	yes
GATCACTCTCCTCAACTATT	3	3	yes
GATCACTCGCCGAGGTGTGG	30	3	yes
GATCAGTTCAGTGTGCATCG	17	5	yes
GATCAGTTCAGACAACTGTG	17	4	yes
GATCAGTGTTTCTGCGAAGG	39	13	yes
GATCCCAACATGCTAGATAC	2	2	yes
GATCCCCCTGACTCTGCCTC	23	24	yes
GATCAGTGCTGTACTTCACT	7	5	yes
GATCAGTGCTCTGCTAACGC	405	8	yes
GATCAGTGCCTTTGTTGGCA	106	4	yes
GATCAGTGCATTTCAGAGTT	61	1	yes
GATCAGTGCACACAGCTCTC	14	13	yes
GATCAGTGAGTGTGAGTGTG	47	6	yes
GATCACTCAGTAACTGCTGG	54	4	yes
GATCACTCAGGATTTGTTCC	46	7	yes
GATCACTCAGCCCTTGAGCA	170	43	yes
GATCACTACTCCTTAGACGT	48	6	yes
GATCACGTTGAGTTCTATTT	9	3	yes
GATCACGTTCTGATTGAGCT	28	8	yes
GATCACGTTAGCCACAGGAC	226	33	yes
GATCACGTGTCCAAAGGTGA	22	4	yes
GATCACGTGTATGTGTCGTG	83	3	yes
GATCACGTGGGCTGCGTTTC	790	38	yes
GATCACGTGGCTGTTCTTGT	45	10	yes
GATCACGTGACCACCCTTTC	33	5	yes
GATCACGGTGCCTGGTTACA	9	10	yes
GATCACGGAGCTGGAGTTCG	82	11	yes
GATCACGCTATGGGCAGGAG	3634	61	yes
GATCACGCAGTCTTAGAAAT	52	0	yes
GATCATTCTCTCCACTTCCG	14	3	yes
GATCACGACGACGCCCACGC	471	5	yes
GATCCTCTGAGGCTGATTCA	31	1	yes
GATCACCTGCCAGACTGTTA	39	3	yes
GATCTGTCTGTTTAGTGGAT	20	19	yes
GATCACCTCCCAGATTCTGA	54	8	yes
GATCACCGTTCCCATCCCCG	62	13	yes
GATCACCCCTAACAGAACAG	2	2	yes
GATCACCCCCTAATCTCACA	869	111	yes
GATCACCCATAAGAACCAGA	94	5	yes
GATCACCCACCCATCAGCCA	26	25	yes
GATCTAATGGTCCTAACATT	104	1	yes
GATCACCAGGAACTCCTACC	7	1	yes
GATCACCAGGAAAAAAAAAA	27	24	yes
GATCACCAGATGCTGAGGCT	19178	383	yes
GATCACCACTGGTTTTGTTT	72	3	yes
GATCACCAAGTGGAATGAAA	116	12	yes
GATCACCAAGGAATCCAAGG	114	17	yes
GATCACCAACTCACGTCATG	150	7	yes
GATCACCAACCACCCCAGCA	21	19	yes
GATCACCAAAAACATCCAGG	13	12	yes
GATCACATGAGAGTCAGAGG	122	3	yes
GATCACAGTGGAATCTTCGG	12	1	yes
GATCACAGTGAGATTCTCAT	70	1	yes
GATCACAGGTCTGAGCAAAG	21	3	yes
GATCACAGAGGGGCCAGGAT	19	17	yes
GATCACACTGGAACAGAACC	207	2	yes
GATCACACCTGTGGGGTCAA	104	64	yes
GATCACACCTGTAGACAAGA	143	11	yes
GATCACACAGGGAGGCCTTG	283	3	yes
GATCACACACTACTGAGGGC	58	8	yes
GATCACAATGTTGTCTATCC	69	21	yes
GATCACAATCATGGGCACAG	5	3	yes
GATCACAACTGATGGCGGGT	418	26	yes
GATCACAACCTGTGATTGAA	13	0	yes
GATCACAAACACCGGTGAGA	19	4	yes
GATCAATTCTAACTGGTCAG	69	4	yes
GATCAATGTCGTCATCATCC	119	65	yes
GATCAATCCACAGACGACTG	3	3	yes
GATCAATCACCAGCGCGAAG	42	4	yes
GATCAAGATTTGGCCAATTG	87	14	yes
GATCACTGTGCGGATTGAGC	32	33	yes
GATCCTGACCCCTTGACACT	4	4	yes
GATCAACTTCCTGAGAGTTA	5	5	yes
GATCAACTCATGGAGCTGGC	25	24	yes
GATCAACTCAACAGCCACAC	4	2	yes
GATCGGACGCCACCACATTA	3	3	yes
GATCAACGCCATGACCTACC	159	7	yes
GATCAACCCGTGTGCATTGC	45	0	yes
GATCAACCCCTACCAGCCAG	3	3	yes
GATCAACAATAGATGCTGAG	266	17	yes
GATCAAATTCCCAGGGACAT	10	9	yes
GATCCGAATCTGTGCCCAGC	161	0	yes
GATCCTGAAGGAAGTCCTGA	45	4	yes
GATCCTAGGCATACAGCTGG	47	3	yes
GATCACAGTTCGAGTTCAGG	1	1	yes
GATCAAATCCTGCGTCTTTT	6	0	yes
GATCAAATACTCTGCACATA	17	1	yes
GATCCTCCTGGGCTTGAACT	10	9	yes
GATCGACACATGTGTGGGGA	6	6	yes
GATCCCTTTATGAACCTTGT	73	9	yes
GATCCCTTCCCCTTCCACTA	11	3	yes
GATCCAGAGAGCTTCCTAAA	15	4	yes
GATCCAGAATACTGAGCAAA	1	1	yes
GATCCAGAACACTTGACACT	2	2	yes
GATCCCTCTTGGTTTGTGAC	41	5	yes
GATCTGCCTGGAATACCAGA	38	3	yes
GATCAACACTGAGGAGAAGC	3	3	yes
GATCTGCTGCCTGGGGAGTT	5	0	yes
GATCTCATGGTTGACTCTCT	6	5	yes
GATCTCATGGCCAAAGTAAG	41	12	yes
GATCCCTCCCATGTTGGGAG	4	0	yes
GATCCACCGTACCAGGAAGC	57	3	yes
GATCCACCCCTACAGAAAGA	1	1	yes
GATCTCAGTCCCCGCCTGCA	182	25	yes
GATCAGGCGAAGCAACTGCT	3	3	yes
GATCACAGATGTGATGGGGT	3	3	yes
GATCCACCAAGGTAGAAAAC	90	3	yes
GATCCACACAGGAGAGAAGC	19	17	yes
GATCTCACTGTTTTTTCATT	44	12	yes
GATCTCACTGTGTCGCTCTG	39	11	yes
GATCCAGGACACAGCGTGGT	39	0	yes
GATCTCACTGGACTTGGTGT	119	19	yes
GATCCCGTGTAGCCTTCGTT	106	14	yes
GATCTCACTGCTCACTTTTT	39631	706	yes
GATCTCACTACCTATCAATG	16	15	yes
GATCTCACGGCCTGCGGGGT	33	9	yes
GATCCAGCTCTCTTAGACAG	1	1	yes
GATCTCACGGCCAGACAGAC	141	31	yes
GATCTCACGCCTCTTGGGGA	153	33	yes
GATCAAGCCTAGCCAGGACC	8	4	yes
GATCCAATGCCCTCTTCTAG	23	26	yes
GATCCAAGTCATGATTTGAT	173	25	yes
GATCCAAGGGCCCTGTATGT	11	4	yes
GATCTCACCTACCTATCAGG	3	3	yes
GATCCAAGGAGCTGGGGAGG	73	7	yes
GATCCAAGGACAAGACACCA	38	1	yes
GATCTCACAGTTAGTAGTCA	23	21	yes
GATCTCAAGCTGGCCAGATG	1349	498	yes
GATCTCAAAGTCTGTTCAAA	5	5	yes
GATCTCAAAGGGAAACTGAC	6	6	yes
GATCTCAAAGCCATTGATAG	90	7	yes
GATCCAACTCTGTAAAGGCT	98	14	yes
GATCCAACTCACCCCATCAG	46	17	yes
GATCCAACGCAGCACCGTCT	15	1	yes
GATCCAACCCCCTCTCCTGA	7	8	yes
GATCGAGCAGGCCCGGCTGC	22	2	yes
GATCCAGAGAAGGCTCAGTG	14	3	yes
GATCCAAAGACGCTAGATGT	35	9	yes
GATCTATTCTCCCACTGGAC	43	2	yes
GATCTATGAGCAGAGCTCAC	119	2	yes
GATCTATGAGACAGAACTGG	61	5	yes
GATCCAAAAGGAAGCAAATT	23	21	yes
GATCCAAAAGCCCAACCTTA	5	4	yes
GATCTAGGTTTTGTTTTGTC	10	9	yes
GATCCACTTGCGTTGTGAGC	2	2	yes
GATCTACTTGTGTGTGTGTG	120	14	yes
GATCTACTCCTTCAGAGCCT	39	5	yes
GATCTACTACCAGACAGACA	168	11	yes
GATCTACGGTTCCCACGCAT	45	5	yes
GATCTACCTTGAAATCCCTC	106	6	yes
GATCTACCTGTTCTCCCTGC	40	13	yes
GATCTACCTCCATAGAGATG	23	1	yes
GATCTACCTACCCGTGGTGT	34	8	yes
GATCTACCGAAAATCAAGAA	29	3	yes
GATCTACCAGGTGGACACCC	23	3	yes
GATCTACAGGGCACAGAGGG	30	2	yes
GATCTACAGCGTGCCCTGGA	13	0	yes
GATCCACCAGCGTGTGCATG	17	4	yes
GATCATTCCAAGTTTCACGT	79	14	yes
GATCTACAAAACACAGGGAG	60	10	yes
GATCTAATCCAGAGCAACCG	62	5	yes
GATCTAAGTCTGGAAGAACT	27	26	yes
GATCTAACTCTGTATGTCCT	4	4	yes
GATCTAACCACCAATCCCCC	247	39	yes
GATCCAGAGGAGAAACTAAG	5	5	yes
GATCATTATTTTGGCACCAT	3	3	yes
GATCGTGTTCAAGAACCCCC	316	7	yes
GATCGTGTGTTGTCGGGAGG	7	8	yes
GATCGTGTCCGGCATGAAGT	231	11	yes
GATCCAAGGGGAGAGTCAAG	15	6	yes
GATCGTGGTGAGGAGGCTGG	18	2	yes
GATCCTCGTGTGCAAGGCGA	28	12	yes
GATCCAAGGCGGCGACCCGA	88	10	yes
GATCCAAGGACTGCGGTGCA	4	0	yes
GATCGTGGCACCTCCGGGCT	1	1	yes
GATCCAAGAGGCTGTTTTCG	2	2	yes
GATCGTGAAGCCGCTGAATC	10	10	yes
GATCGTCTCCGTGCTGGTGA	1612	35	yes
GATCCAACAACTCCCTGACC	1	1	yes
GATCATCCCCTGCACACAGT	66	12	yes
GATCCTAGCACTTGGAGTTT	12	10	yes
GATCGTATCACAGACAGGAC	9	8	yes
GATCGTACGGCTGTAACAGG	989	55	yes
GATCCAACCATGACCAGGTG	57	1	yes
GATCGTCATCATCAAATCAC	35	10	yes
GATCAAGCAGCAGCACGGGA	25	24	yes
GATCCCACAAGCCATATTCT	11	4	yes
GATCTGCTGCTGTTCTTTGG	114	19	yes
GATCCAAACTCTGCAAGCAG	6	3	yes
GATCAGTCTTTTCAGTATTT	101	4	yes
GATCAGTCGTAAAGGACTCA	58	11	yes
GATCAGTCCTACAAAGTTCC	102	10	yes
GATCAGTCCCTTCCCCCAAC	42	8	yes
GATCAGTCCAGTTTTGGCTG	1	1	yes
GATCAGTCACCACTGGCACT	154	11	yes
GATCGCTTTAGCTTGCCTAC	6	0	yes
GATCAGTAGGAAGCACAGGT	9	1	yes
GATCAGTACTGCAGTTCCTG	32	0	yes
GATCAGTACTACTGTGGTGT	31	7	yes
GATCAGTAACAGCTCAGACA	21	20	yes
GATCAGGTGTCAGTTTTCTA	24	6	yes
GATCTGCGATGAACTGGGAG	560	42	yes
GATCAGGTCAGAGATGCGGT	36	7	yes
GATCAGGGTGTGTGCCCACG	18	7	yes
GATCAGGGTCCTCCTTCCCT	21	4	yes
GATCAGGGCTGTTACCTATG	10	11	yes
GATCAGGGCGTGGTAGAGAA	72	3	yes
GATCAGGGCCGAGTGATGAG	98	1	yes
GATCAGGGCCAGGGGAGGTC	271	13	yes
GATCAGGGCAGAGATGGAAG	55	3	yes
GATCAGGGCAAGAGGATTGT	89	4	yes
GATCAGGGACTCTTCGGTGT	11	12	yes
GATCAGGGACCACGAACAGA	428	159	yes
GATCAGGGAAGTTCATTGTG	14	16	yes
GATCGAGAGCTTCGAGAGCT	3	3	yes
GATCAGGCTGAGCTGAATGT	277	22	yes
GATCAGGCTACTACAAAGTT	2684	176	yes
GATCCAAACACACACTAGGA	8	1	yes
GATCAGGCGACAGTGAAGAT	71	2	yes
GATCAGGCCTGAACCCGTCC	309	16	yes
GATCAGGCCCACAGCCGAGT	16	1	yes
GATCAGGCCATCAAGTCACA	75	6	yes
GATCAGGCCATACGTAGCCT	8	5	yes
GATCAGGATGGCTGGATTCA	33	32	yes
GATCAGGAGTTCCAGGACAG	14	13	yes
GATCAGGAGGGTCAGCTGTG	4	3	yes
GATCAGGAGGCAGTGTGTGG	13	12	yes
GATCAGGAGGAGAAAGTGAG	34	2	yes
GATCAGGAGCCAGGGAGCTA	69	10	yes
GATCAGGAGCACCTGTGGCT	14	13	yes
GATCAGGACTTGGTGGAAGC	61	1	yes
GATCAGGACTCCTGTGACTC	13	0	yes
GATCAGGAATCCAGGCCAGG	16	16	yes
GATCTTACCTGGAGGCAGCT	5	3	yes
GATCAGGAAGATGGTAGCCT	75	3	yes
GATCAGGAAGATGACTGGCA	5	5	yes
GATCAGGAAGATGAACACTT	2	2	yes
GATCAGGAACTCCAGTTCAT	64	7	yes
GATCAGCGGTGGGAATGACA	2910	147	yes
GATCAGCGCTATTTCCTGAG	301	17	yes
GATCAGCGCCTCCAGTTCCT	4769	241	yes
GATCAGCCTTTTCTGTCTTG	167	37	yes
GATCAGCCTGGGCCACCTTG	36	2	yes
GATCAGCCTGCTCCTGGGGC	18	17	yes
GATCAGCCTCCATCCGCTCA	23	10	yes
GATCAGCCGTTCCTCTGGTG	88	12	yes
GATCAGCCGCTCAAGATTCT	513	51	yes
GATCAGCCCTCCCCTGTGTC	101	8	yes
GATCAGCCCTAATCCTCTGG	242	59	yes
GATCAGCCCGACTGTCTGCT	56	4	yes
GATCAGCCCATCCACTCTTT	2	2	yes
GATCAGCCCAGCCCATGTGA	197	26	yes
GATCAGCCATTTCTTGGGGT	11	2	yes
GATCAGCCATGTGCCACCAA	4	4	yes
GATCAGCCAGTGATACCACA	64	1	yes
GATCAGCCAGTATCTTGAGT	27	3	yes
GATCAGCCAGGACCCTCAGA	136	3	yes
GATCAGCCACTTAGAATTCA	33	2	yes
GATCACTCCACCTACACGGA	26	11	yes
GATCAGCCACAAGATTTCAT	8	0	yes
GATCAGCCAAGGGTTCAGAG	344	47	yes
GATCAGCATTCTTGAGCTGG	39	8	yes
GATCAGCATGGTTGTTCTTC	3	3	yes
GATCAGCATAGTTGTAGATT	82	22	yes
GATCAGCAGTGCCTTGTGTT	13	4	yes
GATCAGCAGTCTTCAGCTCT	7	4	yes
GATCAGCAGCCTACGACCTT	48	1	yes
GATCAGCAGAGTGGTTATGG	8	7	yes
GATCAGCACTCTGCCTCCAA	111	6	yes
GATCAGCACTCAACCATTCT	33	6	yes
GATCAGCACTAAGACTGCTA	40	8	yes
GATCAGCACAGGGTCAACTA	29	5	yes
GATCAGCACAGACACCATTT	25	23	yes
GATCAGCAAGTGACATTGAT	52	0	yes
GATCAGCAAGTCAGGAGTCA	290	15	yes
GATCAGCAAGCAGGAGTGCG	352	87	yes
GATCTTGACAGCATAGACCA	8	7	yes
GATCAGATTTGTCCACAAGG	2	2	yes
GATCAGATTTGGTCTATCGG	15	1	yes
GATCAGATGTTTTGGGAAGT	6	5	yes
GATCAGAGTATGTCTTGTGT	7	1	yes
GATCAGAGGTTAGGACGTGA	19	17	yes
GATCTCCACTCTTCATGACT	44	11	yes
GATCGAGGAAAAAGTGCGGA	5	1	yes
GATCAGAGGCTCCCAACTGG	308	46	yes
GATCAGAGGAGACTTCCTCG	35	31	yes
GATCAGAGCCGAACCTACTT	9	8	yes
GATCAGAGCCAAGAAACGCC	38	3	yes
GATCAGAGAGTGTCAACTTA	4	4	yes
GATCAGAGAACGGAAGAAGC	6	6	yes
GATCAGACTGGTGAGAAAGC	13	13	yes
GATCAGACCTGTGGCTGAGT	52	4	yes
GATCAGACCTGGGCGTGAAA	64	39	yes
GATCAGACCCAAAGAAAAGT	151	13	yes
GATCAGACACTGACTGGTGA	319	26	yes
GATCCAAGGAAGAGCCCATG	7	1	yes
GATCTCTCCCTCATATAACT	47	2	yes
GATCCGTCGCCACTGGGGAG	7589	24	yes
GATCCTGAGGCTTCAGCAAC	1815	4	yes
GATCCCTTCCCCACCTAGCT	25	3	yes
GATCCTACTGACAGCCATTG	3	1	yes
GATCCGCCACGACTGGAGCG	5	5	yes
GATCCCCCTCCCCCCAGTGA	90	47	yes
GATCGGCGCCTCCGGAGTAC	170	22	yes
GATCCTTGAGAGGCAAGACG	54	2	yes
GATCAGGTGGAGTTGAAGGA	80	6	yes
GATCCTGGGTAGCATTTTAG	24	27	yes
GATCACTCATTGTTCAGGTG	11	5	yes
GATCTGACGCCCTCTTCTGT	439	60	yes
GATCGGGAACAGAAAGGGCG	141	11	yes
GATCGGCGCTTTCAGACTAA	46	11	yes
GATCGGCAGTGTGGAGGAGC	217	11	yes
GATCGCTGTGGCCGAAACTT	86	7	yes
GATCCAAAGAGCAGGGATGG	2675	27	yes
GATCCTGTCAACTTCAAGTT	59	9	yes
GATCACAGTCTGCATCCTAG	20	18	yes
GATCTCCTCCACATAGAATA	11	3	yes
GATCGCTGAGCGGTGTGCAT	7	6	yes
GATCGCTCTCATTGCCCTTT	49	6	yes
GATCGCTCACAAGGACTGAG	166	25	yes
GATCGCTACCAAGCAGTTCT	151	25	yes
GATCGCCTCCTCCCTCTCTT	55	15	yes
GATCATGTGCCTTCCACTTC	2	2	yes
GATCGCCCTGTCCAACAAGC	20	4	yes
GATCGCCCTCTACATGGCCT	47	53	yes
GATCGCCATCGGCAGGACTG	137	0	yes
GATCGCCAGGCCTTTTCATT	56	4	yes
GATCATCTTTCTGAGGGCTG	182	4	yes
GATCGCCACCTACCGCACCC	396	47	yes
GATCATCTGCTTCAGCATAT	14	2	yes
GATCGCATTGGAAAGACCAA	38	1	yes
GATCGCATTGCCAAGGAGGT	221	120	yes
GATCGCATGCGCCCCATCTG	113	7	yes
GATCGCATGAAGAAACCATG	179	0	yes
GATCGCAGTAGCCAGCGCAG	13	7	yes
GATCGCAGAGGAGGGTTTTG	2489	199	yes
GATCGCAGAGGAGGGTTTGG	329	201	yes
GATCATCTCCTTCCTCACCA	7	4	yes
GATCATCCCCCTCACGATGG	35	12	yes
GATCGACGAGAACTGGTATG	381	40	yes
GATCCTTTTGCAGTCCAGAA	5	3	yes
GATCCTTTTCCACTCCCAGG	118	6	yes
GATCCTTTGCTCCTAGTGGA	11	1	yes
GATCCTTTCTCTTGTTTTTG	2	0	yes
GATCCTTTCTACTATGATTG	39	3	yes
GATCCTTTCCTTGGACTCAC	65	8	yes
GATCCTTTCCATGCAAACTG	122	5	yes
GATCCTTTCATTTTCCAAGT	48	13	yes
GATCCTTGTGGCTGTGAAAA	19	18	yes
GATCCTTGGCTGCTGGGGAA	19	0	yes
GATCCTTGGAAGGCTACTGT	530	7	yes
GATCCTTGAGGTCACGTTGC	35	6	yes
GATCCTTCTGTATTCCACTC	33	5	yes
GATCATATGGAAAGAGGAAA	58	11	yes
GATCCTTCTCTGCTTCACAA	11	3	yes
GATCCTTCTCTGCTAGTTTA	7	1	yes
GATCGACCATACAGTAGAAC	39	2	yes
GATCCTTCTACCCACATACT	14	16	yes
GATCCTTCCTGCGGGCGGTG	77	7	yes
GATCCTTCCCATGTGTGCCT	18	3	yes
GATCCTTCCAGGAAGAGGAA	46	16	yes
GATCCTTCAGTCCTCTTAGT	57	7	yes
GATCCTTCAGAATCTCTGTT	4	4	yes
GATCAGTTTGCCTTCATTCA	5	5	yes
GATCCTTATCGGCATTTCGT	28	2	yes
GATCCTTACTTGGTGCAGGT	185	2	yes
GATCCTTACCCTGTCCCTGT	64	9	yes
GATCAGTGTGTCTGTCTATG	8	8	yes
GATCCTGTTCCGAGCAAGCT	70	15	yes
GATCAGTGCCTGGCGCCAGA	251	17	yes
GATCCTGTGTGGGAGGCTTC	16	1	yes
GATCCTGTGTGCGTTGATGA	524	0	yes
GATCCTGTGGGACCATCTAG	100	13	yes
GATCCTGTGGAAAGGATGCA	42	7	yes
GATCCTGTCCCAGGGGCTAG	310	12	yes
GATCAGGTCTCTCCAACTCA	50	0	yes
GATCCTGTCCAAAGACATCC	9	1	yes
GATCCTGTAGGCCCTGGGAG	54	4	yes
GATCCTGTAAAGGCAGGGCA	119	25	yes
GATCCAGGGCATCACTCGGG	1	1	yes
GATCCTGGTTTTATGCTTGT	1423	15	yes
GATCCTGGTTGGGGGCAAGG	45	6	yes
GATCCTGGTGTTTCCACATG	8	7	yes
GATCCTGGTGTGTGTGTGGG	92	83	yes
GATCCTGGTGGTTCACCTCA	89	17	yes
GATCCTGGTCCCCAGCACCT	6	5	yes
GATCCTGGTAGCTCACCAAG	235	7	yes
GATCCTGGTAATGCACTTTG	46	52	yes
GATCAGGACTTCTACTGGCA	35	6	yes
GATCCTGGGTCCCTCGTAAG	75	14	yes
GATCCTGGGTACTAAGGTCA	564	11	yes
GATCCTGGGGACCCAGAATG	201	17	yes
GATCCTGGGAGCGAGGAAAC	66	5	yes
GATCCTGGGAAGTTGGATTA	367	21	yes
GATCCTGGGAAGTGACTACA	959	10	yes
GATCCTGGGAACTATGTAGA	15	4	yes
GATCCTGGGAAATAAAAGGG	129	13	yes
GATCCTGGCTGCCTACCAGC	707	59	yes
GATCCACTTTGGCACAGAGG	2	2	yes
GATCCTGGCGCTGGCTGTCC	116	25	yes
GATCCTGGCAGTGGACCGCC	9	2	yes
GATCCTGGCAGCCACCGTGG	8	7	yes
GATCAGCTGGGTTTTCTACA	2	2	yes
GATCCACGCACATTCTCACC	4	3	yes
GATCCTGGAGGAACCTTCGC	10	9	yes
GATCCTGGAGAGTCTTCTCT	2697	56	yes
GATCCTGGAGAACCTTCTCT	660	28	yes
GATCCTGGAGAACACTGGTT	4	3	yes
GATCCTGGACGAGGCCACCA	40	11	yes
GATCCTGGACACCCTTCTCT	4177	135	yes
GATCCTGGAATTGGCTGGTA	72	19	yes
GATCCAGAAGACGAAAGAAG	3	3	yes
GATCCTGGAAGGGTAAGGGC	3	3	yes
GATCCTGCTGCAGGCAGTGG	389	44	yes
GATCCTGCTGACACGGTGCG	39	4	yes
GATCCTGCTCCAGGAGATTG	93	2	yes
GATCCTGCTAAGCACTGAGG	171	24	yes
GATCCTGCCGTGTTTGCGGA	11	5	yes
GATCCTGCCCTGGGGTGAGG	97	14	yes
GATCCTGCCCTCCACACCCA	42	1	yes
GATCCTGCAGCGGTTCCTAC	7	1	yes
GATCGCCAAGTTCAAAGCTG	67	10	yes
GATCCATTCGCAACTTGGCT	143	10	yes
GATCAAGCAGAGAGTGCCGA	1	1	yes
GATCTCTCCCCAGGGAAGGA	12	10	yes
GATCAAGGTGGGAGGGAAGA	30	0	yes
GATCAGAAGTTCAAGGCTAA	54	6	yes
GATCAGAAGTTCAAGGCCAT	61	0	yes
GATCAGAAGTACCAGAAACA	93	4	yes
GATCAGAAGGAGATACTCTG	83	9	yes
GATCAGAAGCTGTGTGCGTT	37	6	yes
GATCAGAAGCTGGAGGGTGT	5	5	yes
GATCAGAAGACTTGCTCTGA	32	10	yes
GATCAGAACTGGGTGCCAGC	39	2	yes
GATCAGAACTGGGTATCAGT	70	17	yes
GATCAGAACTGGCTGCAGAG	32	2	yes
GATCAGAACCCAGCCGAGTG	41	6	yes
GATCAGAACATTTGTTCCAA	303	19	yes
GATCAGAACAGGTGTCCCTT	3	3	yes
GATCAGAACAGACAATAGGT	39	36	yes
GATCAGAACAACAGACAGTG	89	6	yes
GATCAGAAATGAGGTGTAAC	78	7	yes
GATCAGAAAGGAAGGGATGG	31	3	yes
GATCTCAGCTGCCACGAACC	26	23	yes
GATCAGAAACTGTCCTCTGA	67	8	yes
GATCACTTTTTTCTGACTCT	28	0	yes
GATCACTTTTGGTCAATATG	18	21	yes
GATCACTTTGTAGTCATGTA	28	6	yes
GATCACTTTGAGGAAGCCAT	642	60	yes
GATCACTTTCTAGGTTCCTA	196	20	yes
GATCAGGCTCTGGAAGGCGA	2	2	yes
GATCACTTGTTTGTGGTGAG	6	1	yes
GATCACTTGTCAGTGTTCAG	195	0	yes
GATCACTTGGCTTTTCTGGG	1	1	yes
GATCACTTGGCGGTGACTTT	173	10	yes
GATCACTTGCTGAAATGAAT	42	4	yes
GATCACTTCTGAAGAGCTTC	1	1	yes
GATCACTTCTCTGGTCTCCG	56	8	yes
GATCACTTCTCTGGTCTCCA	1510	22	yes
GATCACTTCGGCCTGTACAC	106	6	yes
GATCACTTCGCCCTTTTTTG	140	1	yes
GATCACTTCCTATAGACCCA	24	0	yes
GATCACTTCCGTGCCTCCCT	19	6	yes
GATCACTTCCCAGGGCCTGT	118	11	yes
GATCACTTAGTGGGGGGTTT	23	5	yes
GATCACTTACTGCCTAATGC	19	4	yes
GATCACTGTGTTGGACACTC	104	9	yes
GATCACTGTGTACACATTGG	3	3	yes
GATCACTGTCTCAGGCCTTT	5	4	yes
GATCACTGTCCCCCTGGGAA	65	2	yes
GATCGTTCAAAGCCCTGGAG	15	14	yes
GATCGACCACATCCTGGATG	21	20	yes
GATCACTGTACTCTTCTTTT	19	8	yes
GATCACTGGTGTTTCCCATT	203	4	yes
GATCACTGGTGTGTGCCAGT	17	16	yes
GATCACTGGTGGAGAAAAGA	159	5	yes
GATCACTGGTCTGTGACCTA	12	7	yes
GATCACTGGGTGTGTTTCAG	97	6	yes
GATCACTGGGAACAAACGGC	120	5	yes
GATCACTGGCTGAGTAGATG	198	3	yes
GATCACTGGCACCAAAGAAG	9	1	yes
GATCACTGGAAACGATTGCT	118	1	yes
GATCACTGCTCTGTTCTGTA	6	5	yes
GATCACTGCTCTAGAGGACA	2	2	yes
GATCACTGCTCAAGCCTGGG	5	4	yes
GATCACTGCGTTAATCTTGG	5	4	yes
GATCACTGCGAAGTTTCGTT	191	4	yes
GATCACTGCCTTTCCCCCTC	3	3	yes
GATCACTGCAGGGGGTGCCA	6	6	yes
GATCACTGCAGGCGCAGCGG	377	2	yes
GATCACTGCAACCTTGTGCT	83	5	yes
GATCACTGAGGGCCCGGAAG	3	3	yes
GATCACTGAGGAGACATTTT	20	8	yes
GATCACTGACCTTGGAGCTT	30	3	yes
GATCACTCTGTGTGTGGTAG	70	9	yes
GATCACTCTGGCCGCTCTTC	1707	51	yes
GATCACTCTGGCCAAGTAAG	142	1	yes
GATCACTCTGGAGTTCAGCG	2824	85	yes
GATCACTCTGGAGCATTTTT	2	2	yes
GATCACTCTGAATGGTTGAA	3	3	yes
GATCACTCTACCCTCGAAGA	59	9	yes
GATCACTCCTTTTGAGGAAA	226	48	yes
GATCACTCCTGTTATGTGAC	29	3	yes
GATCACTCCGTGCACCTGCT	29	5	yes
GATCCTATTCTGCTGACCAA	8	5	yes
GATCACTCCCTGCCTGAGCC	376	43	yes
GATCACTCCAAGTTGACATT	203	12	yes
GATCACTCAGCAGCCAGGAC	322	11	yes
GATCACTAGTGACTGTTGGG	3	3	yes
GATCACTAGCTTCGAGGAGG	418	25	yes
GATCACTACTTCAGAATATT	4	3	yes
GATCACTACAAACCAAAGCA	13	4	yes
GATCACTAATGTGGAGCAAG	9	8	yes
GATCACTAAAGTTCCATCTG	25	5	yes
GATCACGGTTTTCTCTGTAA	85	19	yes
GATCACGGTTCAGATTCGTT	16	5	yes
GATCACGGTGAACCCCCAGT	264	16	yes
GATCACGGTCCCGTGACCGC	30	13	yes
GATCACGGCTTCTCAGCCGA	4	3	yes
GATCACGGCAGTGGATTGGG	75	3	yes
GATCACGCGTCCAGATGTGC	21	3	yes
GATCACGAGAGAAGCCAAAA	7	6	yes
GATCACGACCGATACAGTGA	38	3	yes
GATCACGAAGGAGGAGCTGG	40	6	yes
GATCACGAAGATGTTGGGCG	30	4	yes
GATCACCTTTGTCTGATAGC	57	1	yes
GATCACCTTTGCATAGAAAA	2	2	yes
GATCACCTTGCTGGCATCAG	85	9	yes
GATCACCTTGAGCCTCTTCT	39	13	yes
GATCACCTTCCTGTCTCATC	46	8	yes
GATCACCTGTTTCGCTGTGG	1524	54	yes
GATCACCTGGGCCAGTCCAG	24	22	yes
GATCACCTGGGATTTCTCAG	39	4	yes
GATCACCTCTTAGGGATGGT	75	13	yes
GATCACCTCTCATCCATGTG	59	10	yes
GATCACCTCATTCCTCGACT	62	11	yes
GATCACCACTTTTGCTGGAG	2	0	yes
GATCACCTCAACGTGGGTGT	291	24	yes
GATCACCTAGGTGAGCTGGG	5	4	yes
GATCCGAGAAAACATGGCCA	119	6	yes
GATCACCGTTTCAAGGCCCA	11	10	yes
GATCACCGGGGATGAATTCT	25	5	yes
GATCACCGGGAGGGAGACAG	29	7	yes
GATCACCGCTCACCTTTCCA	7	2	yes
GATCACCGACCGCATCGAGA	1491	5	yes
GATCACCGAACTAGACACAG	32	29	yes
GATCACCCTGAATACTCCTA	5	0	yes
GATCACCCTCAGGTGCAGGT	81	8	yes
GATCACCCCTCTGCCTTTGT	6	6	yes
GATCACCCCCTTCCCTCTGT	117	6	yes
GATCACCCCCAATTGTATGG	947	154	yes
GATCACCCCACAGTGAGGCG	189	9	yes
GATCACCCCAAAGCCTTCAA	82	12	yes
GATCACCCATCATTCTGAGG	178	27	yes
GATCACCCAGAAGTGGCTCT	2073	46	yes
GATCACCCACATTGGGTGAG	118	22	yes
GATCACCATTTCCGACTGTG	4963	266	yes
GATCACCATTCCGGTTACTT	3333	122	yes
GATCACCATCTAGTGAGTCG	171	17	yes
GATCTCCATCTTTGGCTCGG	148	1	yes
GATCACCATAGTGTATCTGA	1	1	yes
GATCACCAGTGTTTAGTCCA	8	1	yes
GATCACCAGGGGCTGATGGG	70	11	yes
GATCACCAGGAAGAAAGAGT	24	2	yes
GATCACCAGGAACTTCTATG	34	9	yes
GATCACCAGCCTGAAGCTGA	29	5	yes
GATCACCAGCCCCTGGGGAT	4	4	yes
GATCACCAGCAAACAGCTTT	176	7	yes
GATCACCAGAGGAGATAGGA	15	14	yes
GATCACCACCCCTGTTAAGC	307	23	yes
GATCACCACCAGGACGCTGA	303	17	yes
GATCACCAATGTTGTTTTTG	11	4	yes
GATCACCAAGGTTGATGCAC	4013	247	yes
GATCAAATACAGGTCATCAA	56	8	yes
GATCCGGGCTCTAGACAGCG	20	18	yes
GATCACCAACTCCTTCCCCA	31	28	yes
GATCACCAACAGTGCTTGCT	12	10	yes
GATCACCAAAGGTACAGTTA	65	24	yes
GATCACATTTTTTTTCTCTG	11	3	yes
GATCACATTTTTTCTCTACA	2	2	yes
GATCACATTTGCTTTGTGTT	26	4	yes
GATCACATTCTGGGCTTCCA	4	2	yes
GATCACATTAGCGTTATTTT	4	4	yes
GATCTCGGCTGCTGCTCAGA	10	1	yes
GATCACATGTAGTGGGGAGG	32	2	yes
GATCACATGGCTGGATGTGA	142	10	yes
GATCACATGAGGGCAGTACA	78	6	yes
GATCACATGAAGTTTGATTT	45	7	yes
GATCACATGAACGTCTCCTG	20	20	yes
GATCACATCGAGGTGTCGGA	7	4	yes
GATCACATCCAAAAAGTCAT	9	1	yes
GATCACATCAAAGGATGATG	7	8	yes
GATCACATACGCAGGAGTGG	4	4	yes
GATCACAGTTGCTACTGCCT	33	2	yes
GATCACAGTTCCAGGAACAG	170	14	yes
GATCTGGCTGCGGAGGAGGC	8	2	yes
GATCACAGTGCGTGCCTGGC	45	14	yes
GATCACAGTGAATCATTCCA	33	2	yes
GATCACAGTGAACGGAGATA	75	1	yes
GATCACAGTCTTCCATTTCA	5	0	yes
GATCACAGTCCTTCCTCTGG	224	3	yes
GATCACAGTATTGTCTCAGA	226	9	yes
GATCACAGTACAATAGCTCA	6	1	yes
GATCACAGGTGTGCATACCA	50	2	yes
GATCACAGGCAGTCCAGGGG	139	21	yes
GATCACAGGACTCTTTCCCT	127	1	yes
GATCACAGCCTGGATTTTTC	2	2	yes
GATCACAGCTTAGAGAATGT	13	2	yes
GATCACAGCTCAGTTCCTAT	58	11	yes
GATCACAGCGTTCGTGCCCA	65	8	yes
GATCGACATCAACGGGGATG	15	11	yes
GATCTCTCTTCCTTTCCTGG	32	6	yes
GATCTCAACTGAAGCTCTTT	14	13	yes
GATCTTGTTGTGAGTGTTTG	4	4	yes
GATCTGGAAGTGTGGGAACG	256	14	yes
GATCCCGTTGAAACTGCTGC	42	38	yes
GATCCACGTTGAGGTGCATG	45	17	yes
GATCCAAGCCCGGAAAGGCA	173	9	yes
GATCCCCTTCTACCTACTCC	675	38	yes
GATCACCTGTCCACTGCCTC	11	11	yes
GATCCATCTGTGTAGTTTCT	173	2	yes
GATCCTGCCAAGAGGAGCAA	159	69	yes
GATCGTTTGTGGCCACCAAT	5	1	yes
GATCCAGTTTTGTTTGGACC	36	4	yes
GATCCCTGAGCCCAGAGTTT	27	3	yes
GATCCCCAGCAGGAGAGAGA	6	0	yes
GATCCAGTGTTGGAATTCTT	6	4	yes
GATCCTGCAACCCATTTCCA	163	2	yes
GATCCTGATTGCCTGCCCCG	96	3	yes
GATCCTGATGCAAGGCTGGC	26	2	yes
GATCCTGAGTGAGTGTGAGG	147	4	yes
GATCCTGAGGCTACGGGGAC	12	1	yes
GATCCTGAGGCCTGTGAGAA	53	18	yes
GATCCTGAGGAGGGGTTTGA	22	7	yes
GATCCTGAGGACATCGACCT	18	2	yes
GATCCTGAGGACAGGAGAGG	984	54	yes
GATCCTGAGCCACAGAGCTG	123	6	yes
GATCCTGAGCAGGTTGGGGA	6	6	yes
GATCCTGAGATGGCTCTGAG	4	2	yes
GATCCTGAGAACTGCTGTCA	49	14	yes
GATCCTGAGAAAATCAGGGC	13	0	yes
GATCCTGACTTCTAGCTGTG	306	3	yes
GATCGAGGGAGCTAGGATTG	20	19	yes
GATCCTGACCGAGCGTGGCT	39	2	yes
GATCGTTTCCCTTGCATGCC	39	8	yes
GATCCAGGCTCGGGAGTGCC	4	2	yes
GATCCTGACCAGGGGGAGTC	35	3	yes
GATCCTGACAATGACAGCAG	501	26	yes
GATCCTGAATTGCTGGAGAG	75	5	yes
GATCCTGAAGTCTGCAGACC	118	7	yes
GATCCCGGGGCTGTAACTGT	75	0	yes
GATCCTGAAGCCCCTCGCTT	5	5	yes
GATCCTGAACCCACCCCCGT	44	40	yes
GATCCTGAACACTCCTGGGG	5	5	yes
GATCCTGAAACGACAGTGGT	158	14	yes
GATCCTGAAAACGCCACCCC	6	6	yes
GATCCTCTTGTCTGCTTCGC	109	3	yes
GATCCAGGACCTGGTAGCAA	250	11	yes
GATCCTCTTCTGGAGTGTCT	43	2	yes
GATCCAGGAAGTTGGTGAAC	199	22	yes
GATCCTCTTCTCCGCGTGCC	82	0	yes
GATCCTCTTCCACGAGACAC	1703	28	yes
GATCCTCTGCAAAGTTGTGA	795	12	yes
GATCCTCTGAAAAACCAAGA	47	2	yes
GATCCTCTCCAAGGAGGAGC	57	18	yes
GATCCTCTCAGAGTCCTGCA	92	6	yes
GATCACTGTGTCTCCTGACA	10	10	yes
GATCACTGTGGCCCCACCAA	31	11	yes
GATCCTCGTTCCTTGTCCTA	66	3	yes
GATCACTGGGGAGAAGTTAT	51	8	yes
GATCCTCGGGGTGCCAGCCA	227	8	yes
GATCACTGCGGACATGCTGG	4	4	yes
GATCACTGAGGATGGCTGAC	91	6	yes
GATCCTTCCTAGAGTCACTC	98	9	yes
GATCCAGCAGCGCAGGCAGG	46	3	yes
GATCACGTTCTGCTTGGAAG	34	8	yes
GATCCTCCTGCCCGTGGGGG	25	1	yes
GATCACGTGACCACAGCCCC	22	2	yes
GATCCTCCTCCAAGTCTGAC	200	14	yes
GATCCTCCTACCCTCATCTC	5	5	yes
GATCACGACGTTGGCTTTCC	5	4	yes
GATCCTCCCTGTCCTCTCTC	27	7	yes
GATCCTCCCTCAGGACTACG	76	6	yes
GATCCTCCCCTGGCCTCAGT	62	24	yes
GATCCTCCCCGCTCGCTCAC	110	19	yes
GATCCTCCCCCTCTGTCTTT	35	1	yes
GATCCTCCCAGTCTACAGAT	21	3	yes
GATCCTCCCAGACCCTCTGA	55	11	yes
GATCCTCCAGTCCCAATGAG	33	11	yes
GATCACCCGACGCAAGTGGG	8	9	yes
GATCCTCCACTCTTCTGGAA	14	1	yes
GATCCTCCACTCATTGAGAA	67	9	yes
GATCCTCATCATCGCGGGTA	40	5	yes
GATCCTCATCAGTGTGGCCA	73	6	yes
GATCCTCAGGAGTCAGTATT	2	2	yes
GATCACCAGACAGACAAGCT	43	29	yes
GATCCTCAGCCTCCCAGAGC	207	3	yes
GATCCTCAGAATTGAGGAAG	44	1	yes
GATCCTCACTTTTCAGTGCG	4	2	yes
GATCCTCACTGTGAAAGACA	37	2	yes
GATCCTCACTGAGAAGGAAC	105	15	yes
GATCCTCACTGACAGATGGG	53	3	yes
GATCACAGTTCCTTATTGTG	14	16	yes
GATCCTCAAAAAAGCCACCG	43	39	yes
GATCCTATTCGTGGTTTGGA	422	19	yes
GATCATGATTTGGAGAGAGG	21	24	yes
GATCCTATCTCGCCCAGTGA	115	12	yes
GATCCTAGTCCTTGCCCCGT	75	8	yes
GATCACACTTACCAGTCAGC	407	29	yes
GATCACACTGTCTTGGAATT	83	9	yes
GATCCTAGCAGCGGCGGTGG	29	5	yes
GATCCTAGAGAGTTCTCTTT	316	37	yes
GATCCTAGAGACAGGCCATC	11	5	yes
GATCCTAGACTCTCCTTGTT	175	6	yes
GATCCTAGAACCGCCAGGGT	14	4	yes
GATCCTACTTTCAGCTGCTC	60	6	yes
GATCCTACGCAGGGGGGACT	203	12	yes
GATCCTACCAGCTACCACAG	6	6	yes
GATCCTACAGTCTGGAATCC	55	18	yes
GATCCTACAGCCTTCTCTGT	100	1	yes
GATCCTACAGACACAGTAGC	10	5	yes
GATCAATTGGAACCGGCTTT	18	18	yes
GATCAATTCCCATTCCACTT	18	5	yes
GATCCTAAGGCCTCACGTAG	28	27	yes
GATCCTAAGGAAGACAAGGC	7	8	yes
GATCCTAAGCAAATGCCTTC	7	3	yes
GATCCTAAGCAAAGGGACTC	22	20	yes
GATCCTAACTTGGAAACTGT	20	3	yes
GATCCTAACCACCCAGCCAT	49	6	yes
GATCCTAACAAACTGAAGCT	10	1	yes
GATCCTAAATGTGTGGAAGA	7	6	yes
GATCTGCTCCCAACGGACAG	2	2	yes
GATCAATGAAGAACCGGACG	141	2	yes
GATCCTAAAGACTTCCAACT	58	2	yes
GATCCTAAAGACTCCCCAGG	51	8	yes
GATCCGTTTCTCTCTGCCTT	65	2	yes
GATCCGTGTGGCTGACGTGG	6948	409	yes
GATCCGTGTGAGGTGTGCTG	15	2	yes
GATCCGTGTGAAACTGAATG	13	0	yes
GATCAAGTCTTGTCATAGCT	3	3	yes
GATCCGTGTCATTCACACAC	79	24	yes
GATCAAGTCTCGCAGCATGT	56	12	yes
GATCCGTGCCCTGTAAAGTG	6	5	yes
GATCCGTCGGTGCCTGCTGG	260	4	yes
GATCCGTCCATGTCTGCCAC	16	3	yes
GATCCGGTCCCAGCCCCCGA	105	7	yes
GATCAACTACCATGGTTTTG	18	1	yes
GATCCGGTCAGCGAAAACCT	25	3	yes
GATCCGGGCTGCACATCAGC	3	3	yes
GATCCGGGATGTCGAAGAAC	43	0	yes
GATCCGGCTTCCCAAGAGTA	11	12	yes
GATCAACCTGGAGTTGTATG	16	3	yes
GATCCGGCACTACGGACCGG	13	10	yes
GATCCGGCACCCTCTTCTGT	28	18	yes
GATCCGGACACGCTCCCCCA	30	27	yes
GATCTGGGAGATGGTGCACG	29	1	yes
GATCAACACGCTCGAGTCCA	32	36	yes
GATCCGCGTCTACAGCATGA	257	17	yes
GATCCGCGGGGCTCAGTGTG	189	3	yes
GATCCGCGGGCGTAAACGCT	81	20	yes
GATCCGCGAGTACACGGACA	33	1	yes
GATCAAATTCCCACTCCCCC	309	85	yes
GATCCGCCTCTTCCTGGTCA	815	76	yes
GATCCGCCTCTCACCAGCCA	13	8	yes
GATCCGCCAGGACCGAGAAC	48	9	yes
GATCCGCAGTTACATCAATG	13	11	yes
GATCCGCAGGGAAGTGAGGA	67	8	yes
GATCCGCAGGCGCAAGGCCC	373	160	yes
GATCCGCAGCCGCCTAACTG	186	8	yes
GATCCCCGCGCAGAAGTAGG	200	11	yes
GATCTTCCAGAGCCTCAGTG	14	2	yes
GATCACGATTACTTGGTGTC	32	8	yes
GATCACCTTACACCTTCCTG	23	1	yes
GATCTGCTCTGTGGTGAACG	26	2	yes
GATCTGTCACGATTCTGTGT	106	2	yes
GATCTGGTGTCTGGAATCCT	4	3	yes
GATCTGGGCTTCCTGGGTGA	36	2	yes
GATCATCGAACAGCTAAGCA	2	2	yes
GATCCTGGCGAAGGGAGAGT	55	5	yes
GATCTGGACAGCAAACTCGT	3	3	yes
GATCCTAGTGGCCTGCAGGT	63	4	yes
GATCTGAGCAGTATTTGTTA	1	1	yes
GATCTGCTCCCCGCATCCTT	31	1	yes
GATCTCTCCATTCCTGGTTC	16	1	yes
GATCTCTCAGGCTTCTCTCA	56	8	yes
GATCTCCTTTGACCCTGAGA	107	10	yes
GATCTCCAGGGAGACTCCAT	16	3	yes
GATCTCATCAATCGTCAGAC	2	2	yes
GATCGACCGCATGGTCAGCC	3	3	yes
GATCCTTCTTGCTCATAAGC	51	3	yes
GATCCTGACACCTACACTCA	13	2	yes
GATCGCTCATCAAGAAACGC	9	10	yes
GATCTCTCTGAGTTTAAGGC	11	9	yes
GATCCTCCCCACGTAACCCA	4	2	yes
GATCCTACCAAAACCACTGC	4	3	yes
GATCAGTGAGTGTGTCACAC	16	4	yes
GATCTCAGTCTCTTCCTTTT	15	1	yes
GATCCTGATGCTGCCAAAGC	232	4	yes
GATCCCGTCAAGCTTCAGGC	7	3	yes
GATCCCGAAGTCTGTGACGC	71	2	yes
GATCCCAGTGTGTCGTTGAT	39	2	yes
GATCCCAGCCATCTCAGCCC	12	10	yes
GATCCCAAGGATGTGCAAGA	1	1	yes
GATCCCAACGAACCCACATA	47	2	yes
GATCCATTTTTCCCTCTCTG	22	8	yes
GATCCAGTGTGGAGAGAAAT	26	4	yes
GATCCAGTGCCCTCTTCTGA	1	1	yes
GATCCAGCCAGAAGGCACAA	10	0	yes
GATCCAGAGTGGAGAGTGTT	79	7	yes
GATCCAGACCTTTCACCTGT	4	2	yes
GATCGGCCGGAGCCCTTCCC	58	4	yes
GATCCAAGTTCAATTCCCAG	6	5	yes
GATCCAAGCACTGACACTGG	8	7	yes
GATCCAACACCATCTTCTGG	6	1	yes
GATCATTTGAACCCTGTAGT	3	1	yes
GATCATGGCTGCTACCAGGA	10	9	yes
GATCCCGATGACCATAGGCA	2	2	yes
GATCATATCCACCCTCCCAC	7	7	yes
GATCATAGGCAAACGTGGCA	366	37	yes
GATCCTGGGTACTAAGGTCG	101	15	yes
GATCCCTCAAAATGTGGAAG	1	1	yes
GATCAGCTGCTCACGCTGAT	19	4	yes
GATCTCATTTCAGAAGAACG	3	3	yes
GATCCAGAGTTTTCGGAAGG	18	4	yes
GATCCCGGCTAGTCGGACCC	2	2	yes
GATCACTACAACCATGTTAG	42	4	yes
GATCCACTCCCTGTACCGCC	95	8	yes
GATCCCAAGTACTGCCTGAA	548	31	yes
GATCCCAGCGGAGTGGAACA	6	6	yes
GATCTCTTCTCAAAGACAGA	14	13	yes
GATCAATGCTACCGCCAAGG	44	45	yes
GATCAAGAAAGAGATGGGAG	70	3	yes
GATCAACAACAGGGCATCGG	46	16	yes
GATCCTGGAACCCAAGGGTT	3	3	yes
GATCTCCGTGGAAGCCTCTG	2	2	yes
GATCCTGACTATGTCAGAAT	1	1	yes
GATCCACACGTGTGTGAACA	28	0	yes
GATCCCGTCACTCAACATGG	4	3	yes
GATCCAGGCCCTAGGAACCT	1	1	yes
GATCCGCACCAAGGTCATGG	115266	4145	yes
GATCCGCAATCCACGTGGGC	5	1	yes
GATCCGCAAGACAGACTATG	1	1	yes
GATCCGCAAATACGGGCTGA	116	5	yes
GATCCGAGGCACCAGCTACC	159	9	yes
GATCCGAGCCCCAGCGGGAA	193	34	yes
GATCCGAGATATACGCAGGA	156	12	yes
GATCCGAGAGACCAGCCAGA	234	11	yes
GATCCGAGACCTGGCAGAGC	192	12	yes
GATCCGAGAATTCCAGGACT	79	1	yes
GATCCGACTTCAAAAGGCAG	62	54	yes
GATCCGACTGTGCCCGGATG	89	2	yes
GATCCGACTCCAGTGCGGAC	16	3	yes
GATCCGACGCACCAGCATCG	25	1	yes
GATCCCTGAGACAGTCACTA	3	3	yes
GATCCCTCTCTTTGGCATCC	1	1	yes
GATCAGTACCTGGGAAGTAC	21	8	yes
GATCCGACCAGGTGGTAAGG	217	4	yes
GATCAAGCATTTGCGCCTGA	115	6	yes
GATCCGAATCCCTGCAATCA	81	10	yes
GATCCACGATGACATTGAGG	37	6	yes
GATCCGAAGGGCGGCCGCTG	49	4	yes
GATCAACCACCCAGACCACA	35	9	yes
GATCCGAAGAGTCATTCGTT	152	14	yes
GATCCGAAGAAACTGGCTGC	96	3	yes
GATCCCTTTTGAATCCGACC	67	2	yes
GATCCCTTGCAACTGGAAGA	9	8	yes
GATCCCTTCTGGTGCACACT	81	15	yes
GATCCCTTCTGGGACTCCCC	67	61	yes
GATCCCTTCTAAGTGCCAGT	108	8	yes
GATCCCTTCCCTTCCTTGTG	61	12	yes
GATCCCTTCCCTGATGTTGG	168	15	yes
GATCCCTTATCGAAGTGTCT	52	2	yes
GATCCCTGTGGACAACAAGG	17	5	yes
GATCCCTGGTTGCTCCCTCT	36	7	yes
GATCCCTGGGCCCCCGGGTC	67	16	yes
GATCCCTGGACACTTACATT	494	30	yes
GATCCACATGTCACGGAGGT	30	6	yes
GATCCCTGCTTTTCAGAGGC	32	17	yes
GATCCCTGCTTCCAGCTTCG	28	25	yes
GATCCCTGCTGGGTACTTGA	132	3	yes
GATCCCTGCTCTGGCCCACT	10	10	yes
GATCCCTGCGCCCTCTGCAG	52	10	yes
GATCCCTGATGCAAGCTGGC	59	1	yes
GATCCCTGAGGTCTGAGGCT	38	7	yes
GATCCCTGAATGCCAACCTG	4	0	yes
GATCCCTCTCTTGCTGTAGA	76	4	yes
GATCCCTCTCCCTGCCTCAA	31	5	yes
GATCCCTCTCCACAGGGTCT	28	0	yes
GATCCCTCCGTCGCCATCGC	3733	70	yes
GATCCCTCCCAGAAACCTGT	17	11	yes
GATCCCTCAGTCATCTACCA	86	0	yes
GATCCCTCACTGTGGTAGGA	33	29	yes
GATCCCTCAACTACAAATGT	13	2	yes
GATCCCTCAACACTGAGTCC	164	25	yes
GATCCCTACTCCAAGGTGAA	34	6	yes
GATCCCTACATCTTGTCCTC	67	6	yes
GATCCCTAACCCTGGGCTGG	71	8	yes
GATCCCGTTGAGAAGGTCAT	1307	13	yes
GATCCCGTTCGAGACGCAGA	189	28	yes
GATCCCGTGTATGTTATGAC	4	2	yes
GATCCAGCTCAGATAGACTG	2	2	yes
GATCCAAAGAAGGCTCTTCA	1	1	yes
GATCCCGGTGTATCATGGCA	79	5	yes
GATCCCGGTGGTGACCGTGA	31	5	yes
GATCCCGCAGTGGCAAGGTC	53	7	yes
GATCCCGAGCAGACACTGCA	4	0	yes
GATCCCGACACGGACTCTGA	2	2	yes
GATCCCGAATTTTCCTAAGG	95	14	yes
GATCCCGAACTGTGGTGGAG	73	4	yes
GATCCCGAAACCCACCAAAG	4	4	yes
GATCCCCTTGATTGCCCTGA	74	1	yes
GATCCCCTTACAGCTGGCAT	98	5	yes
GATCCCCTGAAGTATGGCTC	24	6	yes
GATCCCCTCTTGGCTTGCTT	29	1	yes
GATCCCCTCCTTAGTCTTAG	26	25	yes
GATCCCCTCCCCTGGTGAAC	118	10	yes
GATCCCCTCCCATAGGTAGC	103	14	yes
GATCCCCTCAGGTTGAGGGA	46	1	yes
GATCCCCTATGGAGACAGGG	14	6	yes
GATCCCCTACAGTTTCTTCA	104	14	yes
GATCCCCGTGGGCTCTTTGG	931	7	yes
GATCCCCGGGGGAGGGAGGG	3	3	yes
GATCCCCGGCAAAACCACAT	2635	81	yes
GATCCCCGCTGTGGCAGCCA	6	3	yes
GATCCCCCTTTTCAGCCCTG	52	2	yes
GATCCCCCTTACAAACACCA	105	44	yes
GATCCCCCTCTGGGAGAGCC	20	0	yes
GATCCCCCTAAATCCAGGAA	14	3	yes
GATCCCCCCTCTGGAAGGCG	11	0	yes
GATCCCCCCTCACTGACTGA	30	2	yes
GATCCCCCCGGAGGACTACG	19	17	yes
GATCCCCCATCTTCTCCCGA	11	5	yes
GATCCCCCAGTTGTCACCCT	74	7	yes
GATCCCCATCTCCATCAACA	275	33	yes
GATCCCCAGGATTCGGAGAA	4	4	yes
GATCCCCAGCTTCTAGGAAA	21	0	yes
GATCCCCAGCCGTGGCACTG	239	69	yes
GATCCCCAGCCACAGAATGG	138	30	yes
GATCCCCAGAGGCTACCACC	55	3	yes
GATCCCCAGAAAGGTGGTCG	211	29	yes
GATCACACTGCCCAGAGGAA	43	0	yes
GATCCCCAAGACCAAGTTCT	2	2	yes
GATCCCCAACACCAAGTGAA	18	1	yes
GATCCCCAAACCCACTCCAA	45	6	yes
GATCCCATGTCCTGCAAAAA	2	2	yes
GATCCCATGTACCCAGGAAT	13	4	yes
GATCCCATCCCCTTGCCACA	275	26	yes
GATCCCATCCAGCCCTCCAG	200	7	yes
GATCCCATCATGGGTTTCCA	56	25	yes
GATCCCATCATGCCCTGAGC	190	2	yes
GATCCCATCACCACAGCGAG	10	1	yes
GATCCCATAGCAAGAGAGGG	37	8	yes
GATCCCATAACACAGACCTT	237	15	yes
GATCCCAGTACCTCTACAGA	45	26	yes
GATCATTTCGTCAGTCTTAC	2	2	yes
GATCCCAGTAAAGATGCTGC	25	3	yes
GATCCCAGGGCTGACCATCA	50	0	yes
GATCCCAGGGCCTGTCTCCC	22	4	yes
GATCAGTCGAAGGGACCCCC	28	4	yes
GATCCCAGCCACTTTGAGTA	16	1	yes
GATCCCAGCATGGTCAGCGC	40	1	yes
GATCCCAGCAGCAGCATCGT	22	2	yes
GATCCCAGCAATGAGCTTCC	17	2	yes
GATCCCAGAGTGTAGTAATT	3	3	yes
GATCCCAGAGACATCAGGCA	1	1	yes
GATCCCAGAAGGTCGATGTA	288	7	yes
GATCCACAGCTCGCTAAAAT	4	4	yes
GATCAGTCACTCACAGAGGC	148	9	yes
GATCCCAGAACACCTGTCCC	54	2	yes
GATCCCACTGGTTAGGAATA	82	42	yes
GATCCCACCTACTTTGGACC	6	2	yes
GATCCCACCGTATCCACCAG	21	2	yes
GATCCCACCCAGTAGCCTAA	1	1	yes
GATCCCACCCACCAGCTACC	384	13	yes
GATCCCACCATCCCACTGGA	51	1	yes
GATCCCACATTACCTCTGCC	50	13	yes
GATCCCACAGGTCTTTCATG	98	5	yes
GATCCCACACAGGTGACAGG	56	2	yes
GATCCCAAGGTTTCAACACA	73	8	yes
GATCCCAAGGGCCTCGAATG	965	77	yes
GATCCCAAGGCCTATGTCTG	713	5	yes
GATCCCAAGCTCTTCTTAAT	791	13	yes
GATCCCAAGCTCATCATATG	4	3	yes
GATCCCAAGAATCTGGAGAA	42	4	yes
GATCCCAACCTTGGCCCTGA	50	5	yes
GATCCCAACCCTGAGAACTT	73	5	yes
GATCCCAACACAGCCTATGC	56	4	yes
GATCCCAAAGGTCCAAGCCA	28	8	yes
GATCCCAAAGCCTCTGTTGC	7	1	yes
GATCCCAAAGCACAATCTCC	140	19	yes
GATCCCAAACAGGCGCACGA	46	11	yes
GATCAGCCTGGGTGACAGGG	75	20	yes
GATCCAAGACAAGCAACAGA	21	1	yes
GATCAGCCCCTGACATTGTT	3	3	yes
GATCCCCACACCTACATCAA	51	16	yes
GATCCATTTCCATTCATTTA	3	3	yes
GATCCATTGCCTGGACTGAG	146	5	yes
GATCCATTACCTTCTCTTCA	7	6	yes
GATCCATTACCTGCTCTTTG	3	3	yes
GATCCATGTGTACCCATAAT	19	4	yes
GATCCATGTCCCACAGTAAC	6	0	yes
GATCCATGTAACTGTTCCAG	41	16	yes
GATCCATGCTGTGCGCTACC	183	25	yes
GATCCATGCCAACCACCAGG	126	12	yes
GATCCATCTCTCTGCCTTAT	21	6	yes
GATCCATCTCCCAGACTTAT	19	4	yes
GATCCATCCTCCGAGCACTG	1750	17	yes
GATCCATCCTAGGGTCTGTG	84	16	yes
GATCCATCCGTAAGCCCCGG	73	4	yes
GATCCATCCCCAGTGCCCCT	14	16	yes
GATCCTAGGACCAGTGGCAG	35	7	yes
GATCTCCAGGCTGGTGCGCG	17	2	yes
GATCCATCCCACTTTGTCTT	6	2	yes
GATCCATCCATTTGATAGCC	84	6	yes
GATCCATCAGCTCCTGTGGG	85	12	yes
GATCCATCACACCTGTCTTT	111	3	yes
GATCCAGTTTTGACAGTGAC	36	11	yes
GATCCACTGCTGAGCTAGAG	30	27	yes
GATCCAGTTGTGCCTCCCGG	68	11	yes
GATCCAGTTATTCAGTGGTT	7	2	yes
GATCCAGTGGTTGGAAGAAA	18	3	yes
GATCCAGGTTTCTGGAGGGA	57	9	yes
GATCCAGGTGCTGTGGACTT	40	1	yes
GATCCAGGTGAAGAACGAGG	472	20	yes
GATCCAGGTCGGTCACCAGG	39	7	yes
GATCCAGGGTCCTGCATCGG	122	1	yes
GATCCATCTGTGTAATGTGG	31	1	yes
GATCTCTACGGCCCTGCCAG	13	12	yes
GATCCTGGAAATGAGATGGG	9	0	yes
GATCAATCCTCTCTGCAGAG	6	6	yes
GATCTGTGCAGCCTTGAAAA	13	12	yes
GATCAAACTGTAGGGAAAAA	8	4	yes
GATCCTGGAAAGGAGAGCCA	4	4	yes
GATCCACGAGCCCAAGGGCT	56	63	yes
GATCCTGCACTGACTCTGGA	74	12	yes
GATCAGGCTCTGTGCCACTG	159	4	yes
GATCAGCAGGGGAATGAGGA	43	27	yes
GATCAGACAGGGTGGTGGTT	5	5	yes
GATCAGACACTCTGAGCTTG	2	2	yes
GATCCTGGCCACACCGGCAG	50	23	yes
GATCACCTTTACCAGTGTGA	7	4	yes
GATCACCACGTCCAGACGGC	13	12	yes
GATCACAGAATGGACAGGAA	88	9	yes
GATCACAAAAGGCCTTGCAA	56	13	yes
GATCCTCTCTCTAGGGCAGC	26	23	yes
GATCCTCCTTTGAAAAAGTC	13	2	yes
GATCAACCAGGTTTGGCTTT	64	1	yes
GATCCTTTCCTGTGGCTACT	89	6	yes
GATCTTTTAGGATGTTTGGG	11	2	yes
GATCTTTGGTTTCGTGGCCA	64	14	yes
GATCCTCAGTCAAGGTACAG	36	5	yes
GATCTTCTGGAAGCTCCAAA	11	10	yes
GATCTTCCCCTGATGGCACT	5	5	yes
GATCTTCCCCGAGGGTCGGC	23	22	yes
GATCCATCTTGTGTCCCTCT	41	2	yes
GATCTCTTCCCAGCCGTGGA	1	1	yes
GATCTCAGAGATGCGCCAGA	29	1	yes
GATCTGTGGGACAGAGGAAG	30	2	yes
GATCCAGCAAAATTACAAGA	2	2	yes
GATCCTGGGGGCTGACCTGG	14	3	yes
GATCCGCCCTTGTGCCCACT	42	13	yes
GATCCCCACGGCTGGTCTGA	53	5	yes
GATCTGGTGCCCTGCTGCTT	121	8	yes
GATCCAGTTCTAAGCAGATT	1218	45	yes
GATCTGCTGACTACAGCACG	21	0	yes
GATCTGCTCAGGGTCTACAG	58	7	yes
GATCTGATTAACCAGGTCAA	31	35	yes
GATCTGAGTTTCCACAATTT	33	6	yes
GATCTGAGACTTCTCCTGCT	59	3	yes
GATCTGAAATGAACCAGCCC	760	300	yes
GATCTCAACACTGACGTTAC	45	6	yes
GATCGTGAAAGGGAACGGGA	107	1	yes
GATCCTAGTGGGCAAGGCAA	4	4	yes
GATCCAAACATGAAAGCTGG	27	1	yes
GATCTGCTCCTGAAAAAAAA	16	15	yes
GATCACTTTGGCTAATGGAT	2	2	yes
GATCTTTGCCGGCAAGCAGT	17	16	yes
GATCCTGCTGGACCAGAGTA	5	5	yes
GATCCAGCTGCTCACGCTGA	24	8	yes
GATCCCCCAGGGTGAAGCAC	63	0	yes
GATCCCACATAACCAGACGT	49	15	yes
GATCCAGCAGACGCTGGGGA	61	9	yes
GATCATGTGGAATGAACTAG	6	6	yes
GATCCAGCAGGAAGAGGCCA	10	1	yes
GATCCCGGGGTGACCTAGGA	7	7	yes
GATCCAGAGGGGACTGATAA	8	8	yes
GATCAGTCCCGGAAGAGAGC	17	2	yes
GATCAAGCTACAGATATGGG	63	8	yes
GATCGGCCCTAACGCCTTGC	54	6	yes
GATCCAAAGGTGTGACACAC	5	5	yes
GATCGCCACCTACCGCCGTC	39205	2086	yes
GATCTTCTCTGCCTATATCA	3	3	yes
GATCTTCTCCCCAGGAAATC	9	10	yes
GATCTTACTCACCAGGAGGA	109	11	yes
GATCTTCACATGTGCACAGT	9	3	yes
GATCTGTCCTGTGACACAGA	3	3	yes
GATCCTGGATGTGAAGGGCG	36	7	yes
GATCAAGTTGTCCATCAAGC	13	6	yes
GATCTGCCTTGCTCTTCCAC	3	3	yes
GATCGCTCAGCACCGCGCTT	15	8	yes
GATCTGACTTTCCAGAGCTG	50	25	yes
GATCTGGGCCTGGAGAGACT	100	15	yes
GATCTGGCTACGTCTCCAGG	1	1	yes
GATCTGGCGCACTGGGCAGC	146	7	yes
GATCTTTTGCTAATGCAGTT	33	3	yes
GATCCTTTTGGTTTGGACAA	139	10	yes
GATCGCTTACGTGGGGGATT	3	3	yes
GATCTGGAAAATGAGTGTTT	39	0	yes
GATCTGCTTCCTCCTCCAGG	17	4	yes
GATCTGCTCCTTCTCCACCT	14	13	yes
GATCTGCGGATGACTGCAAG	1	1	yes
GATCACTTCTGAGGCTCCGT	219	14	yes
GATCACTTCATCTCCCTTCA	27	10	yes
GATCCAGGGGCTCATCAGCA	108	0	yes
GATCCAGGGCTCCATCCTGA	6	6	yes
GATCCAGGGCCACCGCGTGG	45	23	yes
GATCCAGGATTCCTAGAGCA	169	5	yes
GATCCAGGAGTGGATGTCCT	31	0	yes
GATCCAGGAGTATGAGAAGC	6	0	yes
GATCCAGGAGCACCTGCCTG	7	6	yes
GATCCAGGAGACAAGAGGAG	243	3	yes
GATCCAGGACTACAAGCATC	34	4	yes
GATCCAGGACAACGCCACGG	243	5	yes
GATCCAGGAAAGAAAAATGA	38	1	yes
GATCCAGCTTCAGGGCCAAT	23	8	yes
GATCCAGCTGTTCAACAGCA	58	8	yes
GATCCAGCTGCAGATGGAGC	28	8	yes
GATCGGGGTTTACCTTTTTA	163	147	yes
GATCCAGCTCATACCCCTGC	27	5	yes
GATCCAGCCTAGATGGGGGT	152	3	yes
GATCCAGCCCTCCTTTGCCT	39	14	yes
GATCTGCCCGCCTGGCGCGA	9	8	yes
GATCTGCCCCTTTAATTTAC	2	2	yes
GATCTGCCCAGCTCTGCCTC	3	3	yes
GATCTACCAGCCTTGGCTCA	240	29	yes
GATCCAGCAGAGGAAGAGGC	82	2	yes
GATCCAGATGTGCTCAACCA	7	1	yes
GATCCAGAGTCCCCGTATTC	126	114	yes
GATCCAGAGGCCACAGCAAG	25	7	yes
GATCCAGAGCAGGCACAGAG	148	5	yes
GATCCAGACCTATGCTGAGT	7	4	yes
GATCCAGACCAATCCAGTGT	111	13	yes
GATCCAGACAGCACCCACTG	6	6	yes
GATCCAGACACCCAGACTAT	21	0	yes
GATCCAGAATTTTCCAGCTC	16	3	yes
GATCTGGCGTCCTCTTCTGG	54	27	yes
GATCCAGAAGCTCCAATTTT	118	22	yes
GATCCAGAACAATCTACTTC	32	7	yes
GATCCAGAAAGCTGCCTGTT	1	1	yes
GATCCACTTGTCTTCGGAGA	25	1	yes
GATCCTCCAGCAGAAATATG	44	5	yes
GATCTTTGCCGGCAAGCAGC	1553	46	yes
GATCTCTTCTCCAAATTCGT	5	2	yes
GATCCACTGGGAGAGAGTGG	26	8	yes
GATCCACTGCCAGTGGTGTG	130	4	yes
GATCCACTCTTCTCCCGAGG	5	4	yes
GATCCACTCCTTACCGTTTT	47	12	yes
GATCCACTCCTAGCAACCAT	1	1	yes
GATCCACGTGGCACCAAGAT	63	2	yes
GATCCACGGGGTGCCCGAAG	46	5	yes
GATCCACGGAGTGCAGCAGA	118	7	yes
GATCCACGACAGTCCCCTGT	6	6	yes
GATCCACCTTAGTCGAAGCT	19	1	yes
GATCCACCTGACTACTCAGA	15	10	yes
GATCCACCTCAGCCGTGTCC	34	9	yes
GATCCACCTCAAACCAAGCC	30	8	yes
GATCCACCGAAGGACATCTA	80	0	yes
GATCCACCCTCAGGCACCAG	177	33	yes
GATCCACCCGGCACACAGGA	31	28	yes
GATCCACCCACCTCTGTTAC	285	24	yes
GATCCCGGCCGAGGTCCGAG	26	4	yes
GATCTCTGTCTTCAGTCTCA	3	3	yes
GATCTCTGCTGCCACCAGAT	16	15	yes
GATCTCTGCCTCCAAATATG	29	1	yes
GATCTCTCTCTTTCTTCTGA	313	2	yes
GATCTCTCTCACTTCTCTGA	63	4	yes
GATCAATCCCACCAGCCTTA	694	30	yes
GATCAATACCGCAACCTTTC	3	3	yes
GATCCACCAGTGCTCAGCAC	16	1	yes
GATCCACCAGTATTACCCAG	87	22	yes
GATCCACATTAAGGCCCTGA	4	2	yes
GATCCACATCAAGCCAGGAG	205	231	yes
GATCCACAGGCAGGAGGAGA	38	13	yes
GATCCACAGCGATATCCAGA	414	7	yes
GATCCACACTGGTGGCGGGG	27	9	yes
GATCCACACTGGACAGTTCG	2	2	yes
GATCCACACAGGAGAGCGGC	43	20	yes
GATCCACACAGACGCGGCGG	25	5	yes
GATCCACAATGTATCTGGCT	6	5	yes
GATCCACAACAGTGCGTGGG	28	2	yes
GATCCAATGCCTTCTTCTGT	53	5	yes
GATCCAATCTGCGGGTTACC	55	10	yes
GATCCAATCCTTGGTCCTGA	38	10	yes
GATCCAATCCCCCCACTCGC	20	5	yes
GATCCAATCAGGATGGGGAC	98	22	yes
GATCTCCTTCTCCAGCACCA	15	14	yes
GATCTCCTGTTTTAGTCTCT	14	3	yes
GATCCAAGGAGGGCCACACT	9	10	yes
GATCCAAGGAGACAATCTCA	25	9	yes
GATCCAAGCCCGGGGCCCGG	204	16	yes
GATCCAAGCAATGTGCAGGG	2	0	yes
GATCCAAGAGCCTTGGAGAA	14	5	yes
GATCCAAGACCAGAGGGACA	88	24	yes
GATCCAAGAAGGTTTCTCTG	8	2	yes
GATCCAACTGGCAGGAACCA	22	0	yes
GATCCAACGGAAGCCTCTGC	310	13	yes
GATCCAACGAGGCGCCCTGA	1152	187	yes
GATCCAACCCTGCCCAATAC	116	10	yes
GATCCAAAGCACATGTTTCT	136	26	yes
GATCCAAAGACCTCAAGGCA	590	163	yes
GATCTCCAGCATGCCATCAA	21	2	yes
GATCTCATTTTGTTTTGCAT	15	1	yes
GATCTCAGCGCAATTACAGT	22	4	yes
GATCCAAACCATCTTCCCGG	58	5	yes
GATCCAAAAACTGCAGGAGA	5	2	yes
GATCCAAAAACAGCTGACTG	119	11	yes
GATCATTTTTCTCCCACAGA	13	2	yes
GATCATTGTTTGTGATTGCA	45	2	yes
GATCATTGGCACGAAGACTA	2	2	yes
GATCATTCCTAGAGGTGCCG	1	1	yes
GATCATTCCCTGGGTTGGTA	10	0	yes
GATCTCAGCAACCGTGGTAG	658	31	yes
GATCTCAAACTCCTGTATGA	29	1	yes
GATCTCCCTTATGTGTGTAA	13	14	yes
GATCTAGTGTTTCAGAGCTG	3	3	yes
GATCTTGTTATCTGACTCAC	15	14	yes
GATCTTTCTACCTTTTGTTT	8	8	yes
GATCATGTCTATGCTATCCG	39	6	yes
GATCATGTCCCCAACTCCGG	32	29	yes
GATCATGCGGGAATGTTGGC	4	2	yes
GATCATGCCTTGGCAGAGCG	3	3	yes
GATCCAGCAGCTGCTTAGCA	6	6	yes
GATCATGCACTGGGTTGGCT	88	5	yes
GATCAATCCCCTTCTGCTGC	105	4	yes
GATCATCTTGGTTGTGGGGG	280	14	yes
GATCATCTGGTCCAAAAGTT	18	0	yes
GATCATCTCCCCTGCCACCC	44	5	yes
GATCTTTAGGAAGGGGAGAT	27	1	yes
GATCATCCTGGAGATTGACA	87	18	yes
GATCATCCGTGAGGCGTACA	22	9	yes
GATCATCCCCTCTGAGAAAC	16	1	yes
GATCATCCCCCAAGGGTAGG	22	13	yes
GATCCTTGGAATTCACATAA	29	3	yes
GATCCAAAGAACCCAATGGA	74	1	yes
GATCTGTGCTGGCCAAAGTC	1	1	yes
GATCATCCAGTCCAACGGGC	489	9	yes
GATCATCCAGCAGGTGTTTG	13	2	yes
GATCATCAGAAACACTCCAG	143	13	yes
GATCATCACTCAAGACGGTG	505	4	yes
GATCATCAAGACTCTGTCCA	21	11	yes
GATCATACGCCCCTCCCTCC	27	1	yes
GATCCTCAATCAGTGGGTGG	88	13	yes
GATCTGGGGAAAGGTAACTA	1500	28	yes
GATCTGGCAGTACGGGCTAC	46	17	yes
GATCAGTTCGCACGCGGACC	9	9	yes
GATCAGTTCCCCCCACCAGA	14	13	yes
GATCAGTTCCAACATCAGCT	22	4	yes
GATCAGTGTTGAAGGTGGGA	10	5	yes
GATCAGTGTGAGTGACTGCA	133	4	yes
GATCAGTGTCTGTGGAATTG	48	10	yes
GATCAGTGTCAACTGCTTGT	10	11	yes
GATCAGTGGTGGGAATCTGT	25	10	yes
GATCCAGAAGAAACTGTGAG	1	1	yes
GATCAGTCTGACTGTTCTTG	184	16	yes
GATCAGTACGAGAAGATGGC	44	45	yes
GATCCCTCTGGGGTTTGAGC	13	0	yes
GATCCCCCACCCCCAGCTGA	20	0	yes
GATCCTAAGAAGCCGAGAGG	17	0	yes
GATCCCCCTGACCCCCCCGA	30	8	yes
GATCAACCTGTGCACTTTTG	25	28	yes
GATCTGTGTTACCCATCCAT	42	8	yes
GATCTGTCTTCAGCTTCTCC	2	2	yes
GATCACCAAACCAGTCAACA	431	388	yes
GATCACATTTTGAAATGCCT	51	1	yes
GATCTTAACCCAGCCCTCTT	3	3	yes
GATCTCCTCTTGTTCCCCTT	17	3	yes
GATCTCCCTGGCCGACATCG	78	34	yes
GATCGCGGACGGGCTGTGCG	31	28	yes
GATCAAAATCTGGTTCCAGA	2	2	yes
GATCTCCAGAGACCATGATT	105	7	yes
GATCTACACGCACTTCACGT	45	41	yes
GATCCCACGGAAGAACCTGA	5	5	yes
GATCTGGCTTATCTTCTTCT	34	4	yes
GATCTCATCCCGGTGAAGCA	1	1	yes
GATCTCAGTCTTTAGACAAG	6	6	yes
GATCTCAGAGTGAGAAGCAT	4	4	yes
GATCTGCTTAATCTGCGGGG	13	11	yes
GATCTAGGCTGACCTGAGAG	83	3	yes
GATCTACTTCATCCAGTTGA	18	21	yes
GATCTCCAGGGCTCCATTCA	24	27	yes
GATCTACCGCACTGAGCTCA	1	1	yes
GATCTACAGCCATGGCCTGA	57	17	yes
GATCCGCAGAGAACTGTTCA	14	1	yes
GATCTGAATGTTGGCTCTCA	7	8	yes
GATCACAGGTGATTCACACG	11	0	yes
GATCCACATGGCCTCCCCGG	11	10	yes
GATCTAAACCTGAATGACTG	234	28	yes
GATCGCCTGGATGGTGCTTT	80	13	yes
GATCGCCTCATCAAACTTGA	32	2	yes
GATCGAGCTTCCCTATGCAG	21	6	yes
GATCTAAACTCTGCAATATC	15	6	yes
GATCGAATGGGCAATGCTTT	18	3	yes
GATCCTGAAGCTGTGTTGTG	10	2	yes
GATCCTGTGTTACCCGGCAA	492	9	yes
GATCCTGTGCTGTCTATGGC	51	1	yes
GATCTCCAGGCTCGGGATGA	43	39	yes
GATCCTGTACCATCTGCAAC	4	3	yes
GATCTGCCTTACGTGCACGG	25	3	yes
GATCCCTGGGCTCGGGCGAT	44	5	yes
GATCCAGAAAGATGGCTACC	88	24	yes
GATCCTAGCAGCCAGTTTGA	2	2	yes
GATCCTACATCTGTCCTGGA	46	44	yes
GATCCTGCCCTGCGTTAATG	1	1	yes
GATCCTGCACTCACACTTGG	117	4	yes
GATCCCGGGGACACACAATT	55	1	yes
GATCCTCTTCCTGACTCGCA	39	9	yes
GATCCTCCTGGGAGGACAGG	200	5	yes
GATCACCAAGCAGGAGTACG	273	35	yes
GATCCTCCCCGCCCCCCGAT	17	2	yes
GATCCTCCAGCAAGGCTCCG	13	11	yes
GATCCACTGTGAAGGATGGC	507	21	yes
GATCCCAAGCGCACCATTGC	1	1	yes
GATCCTCAAACAGCAGGTGA	5	0	yes
GATCCTAACCCTCCTTTTAC	23	1	yes
GATCAGTGCTCTAGAAGCAT	7	8	yes
GATCCGTTGCGGAGGCCTGG	529	18	yes
GATCCGCTGCTGCCGAGGAG	26	10	yes
GATCCGACTGCGGATATATG	4	4	yes
GATCCCTTGGGAGGTAGGGG	97	14	yes
GATCCAGACAGAAACTTCAG	39	5	yes
GATCCAGAATATGACCATCC	983	102	yes
GATCGGCCCTCAGCACTGGG	4	4	yes
GATCTGTCCTCTCCATGTCA	3	3	yes
GATCCCTCGCTGAGAGCCCG	19	3	yes
GATCCCTAGGAGGTCCGGGG	1	1	yes
GATCCCTACCCCCACTTTTT	194	9	yes
GATCCCGCCAGCGTTCTGTG	18	0	yes
GATCCCGAGTTCAAGGCCAG	3	3	yes
GATCCCCATCTGCGAGCCAC	4	3	yes
GATCCCCACCTACGGGTTGG	97	0	yes
GATCCCATTCCTCAAGACTA	122	3	yes
GATCCCAGCAGTCCTGGCAT	16	1	yes
GATCCCACTGATGCCAAGTA	257	11	yes
GATCCCACTGAGACTTAAGC	131	17	yes
GATCAAGAACGCAGACATGT	9	10	yes
GATCCCAATGCTCAGGGCGA	5	2	yes
GATCCCAACTCGACGGTCCA	126	26	yes
GATCCCAACACCCAGCAAGA	3	3	yes
GATCCATTTCCTCAGAAAAA	12	5	yes
GATCCAGTTCAACCTCCTCC	5	5	yes
GATCCAGTCCTGCAAATGTA	95	13	yes
GATCCAGTATTCGAAGCACC	24	2	yes
GATCCAGGAGTTCAAAGAAG	988	86	yes
GATCCAGGAGTATTGCTATG	18	7	yes
GATCCAGGAGGTCTCAGGAC	37	13	yes
GATCATGTCTCAACAGCAAA	51	3	yes
GATCCAGCTGGACAAGCTCA	124	3	yes
GATCTGAGCCCTGAGGGGGG	24	4	yes
GATCCTGTCCGGATTATGAT	90	9	yes
GATCTGAACTTGAGTTAGGG	48	0	yes
GATCCACAAGTTTGAAGAGC	21	24	yes
GATCCTAGTGGGTGAAGCAA	13	10	yes
GATCCTAGGACCTTGTCCAC	8	8	yes
GATCCTAGCAAGATGTGATG	61	7	yes
GATCCTAGAACGCAATGAAT	2	2	yes
GATCTCACAGACTACCTCAT	3	3	yes
GATCGCTTTATCAGACTAAG	3	3	yes
GATCCTGGACGTTCCTGTCT	110	2	yes
GATCCACATCCAGCAGCAGG	5	2	yes
GATCCTGAGGGCCATGCTGA	2	2	yes
GATCCTCTTGGCTTAAATGT	36	6	yes
GATCTCTGCCTTCTCAAGAG	4	3	yes
GATCTCTGCCTGGTGATTGG	14	1	yes
GATCTCTCCTTCCTCTCTCT	27	1	yes
GATCGGCCTGTGCCTTACAT	3	3	yes
GATCCAAGTCGCAGCAGTAC	1	1	yes
GATCCGCCTGCTGCTCTTAG	40	1	yes
GATCCTCCCATGGGGCACCA	60	4	yes
GATCCTCACCACATACCCAG	53	3	yes
GATCATGTTGCTGGCTTTTA	3	3	yes
GATCCTAGAGAACCGAATAA	2	0	yes
GATCTGCCGCTCCCTCTACA	7	1	yes
GATCCAGGTGTCTGAGGGTT	147	23	yes
GATCCCTGTCGAGAAGCCAG	24	6	yes
GATCCTTTGCTCTGAACTTA	102	24	yes
GATCCCTCTGGCTTCCCCTC	29	1	yes
GATCTCTACTAAGGCGGCCT	25	28	yes
GATCACATGTCACAACTACA	2	2	yes
GATCCAACTCCAATTCAACA	249	61	yes
GATCACAGGCTGAAACTTCT	14	14	yes
GATCCCGACACCAAGAAGAT	15	14	yes
GATCCTGGTTTCCTAGGAAA	8	4	yes
GATCCTGGGAACTTAACTGA	10	0	yes
GATCCCCTCCCACAGAATAA	1772	122	yes
GATCTAGTCACTCCCTTCTG	5	0	yes
GATCTAGGCATTTGGGCTTG	35	8	yes
GATCCCTTACTTCTTTCAGG	39	2	yes
GATCTACGTGGACGATGGGC	24	22	yes
GATCTACCCGGGACACGGGC	1651	83	yes
GATCCCTATGGTTCAGGAGG	25	28	yes
GATCCAGGCAGGAGCTGAAA	58	4	yes
GATCAGCCCTACAGTGTATT	41	6	yes
GATCGTGTTGTTTACCGTTG	11	10	yes
GATCGTGGCTCCCATCAGTG	285	9	yes
GATCGTCGTTCTGGTAGGAA	121	56	yes
GATCGGTAGAGGGGAGGGTT	2	0	yes
GATCCCATCCCCTGCAGAGG	81	5	yes
GATCCCAGGTCACACCTATG	43	16	yes
GATCCCAGGACTCAATAATT	41	2	yes
GATCCCAGGACAATAAGGAG	42	1	yes
GATCCCAGACCCTTCAGTGA	8	9	yes
GATCACTGTCCTGCGGCAGC	71	2	yes
GATCTCTCTCTCTTTAGACG	43	6	yes
GATCGGGCCGCTGCTGACTG	92	4	yes
GATCGCTTTGATGACCACAA	151	0	yes
GATCCAGCTTCAGGAGGAAG	8	0	yes
GATCGCCGGATTGGAACAGA	7	8	yes
GATCCCAAAGCTGGCCCTGC	9	9	yes
GATCCATGATGACAGCTAAG	48	6	yes
GATCGACATTGTCTATGGAC	3	3	yes
GATCCATGACATCCGCTGGA	947	25	yes
GATCCAGGTGTATCAAGCCA	5	5	yes
GATCCAGCTATAGGGAACTC	15	9	yes
GATCCTTTGCCCGGCCAGGA	9	9	yes
GATCCATGTCTCCTCGACCA	168	6	yes
GATCCATGAGTACTACAGCA	695	11	yes
GATCACTGTCACTTCAGAAG	17	3	yes
GATCCTTGCTGCAAAGCTTT	75	3	yes
GATCCTTGCCTCTCACTCCC	72	1	yes
GATCCTTCTGTCATTTGTCA	27	1	yes
GATCCTTCGGGGGTTCCAGT	11	1	yes
GATCCTTCCTCGACTCTTTC	151	0	yes
GATCCTTCAAGGACTGGCTG	58	0	yes
GATCCTGTGTGGGTCCCTGC	2	0	yes
GATCCTGTGGACCAGGGTTA	11	1	yes
GATCCAGATGCACTATGAGA	8	8	yes
GATCCAGTTTGTCCTGGTCT	421	14	yes
GATCTACCACCCAGCCTTCA	32	8	yes
GATCTGACGTGCCGCCTGGG	20	19	yes
GATCCACGGTGAACATTTAC	2	0	yes
GATCTCTTCCGCTCTCCTTC	2	2	yes
GATCCTGGTTCTTCCCGTTG	8	4	yes
GATCCTGGTGTGTGTGTGTG	949	29	yes
GATCCTGGCTTGGGGTGCTT	33	5	yes
GATCCTGGCGTAGTTCCAGA	2	2	yes
GATCCTGGCCCGGCAGCTGG	206	20	yes
GATCCTGGCCAGGCCAGGCT	132	2	yes
GATCCTGGCCAAGCACCCGA	248	31	yes
GATCCTGCGGTTCAATGAGT	24	4	yes
GATCCTGCGGAAACGCGAAT	36	1	yes
GATCTCTGGGAAGGGGTTCA	4	4	yes
GATCTTCCCGTTGGCCGCTC	1121	95	yes
GATCTCTCTTTTTCTGAAGG	16	2	yes
GATCTCGGAGACCTTTGGTG	1	1	yes
GATCCTCTTCTAAAGCCAGA	9	3	yes
GATCCTCTCCCCCACTGGCA	23	3	yes
GATCCTCATGGATGAGACGC	17	16	yes
GATCCTCAGTTCCTGTTGTT	6	5	yes
GATCCTCAGTCTGAATACTT	1	1	yes
GATCCTATCCAGCTAGCTCT	951	7	yes
GATCCTAAGCCCAGGGCTGT	92	9	yes
GATCCGTGTCCCGGACCCTG	2	2	yes
GATCTCACCCAAAGGCAGCC	34	0	yes
GATCTATGAAACCACCGTGG	116	5	yes
GATCTGGGCTGCCTGTGTAT	1	1	yes
GATCCAGCAAGTCACCATGC	44	5	yes
GATCCCTTGGGGCCCGATGA	69	8	yes
GATCCCTTGGAACTGGAGTC	1	1	yes
GATCCCTTACCTGGATGGAA	304	26	yes
GATCCCTTACAGAAACAGTC	24	2	yes
GATCCATGACAGTCATGGTG	20	5	yes
GATCCCTGGGGGAAGCAGAT	47	10	yes
GATCCAAAACAATGGCAATT	7	3	yes
GATCCCTGCTCCTCCTCAAG	382	147	yes
GATCCCTGCGTAGCCCCTAG	55	7	yes
GATCCCTGCCTTTCATCAGG	3	1	yes
GATCCCTGAAATGGTGGTAT	107	14	yes
GATCCCTACATCCCATAATC	4	4	yes
GATCGCTTCTGCCTGGGTGG	17	4	yes
GATCGCTCATTGGAACAGCC	13	5	yes
GATCCAAAGCCAAAGCCGAA	50	0	yes
GATCAGCTGGTCCAGGCAGA	43	10	yes
GATCTTCCCACAGTCACGAA	2	2	yes
GATCGAGGCCCAGAGCCAGG	63	6	yes
GATCTTGCTGTGTAGAGCAC	86	6	yes
GATCATGTTGATAATGCTCG	88	1	yes
GATCCTGGTCCTTCTCACAG	39	10	yes
GATCCTGGGCTAGAGTTGTG	16	1	yes
GATCCTGGGAGACTTTGAAG	23	3	yes
GATCTGTGTTTGAGGGATAG	33	5	yes
GATCAGCTCATGTGACAGCC	27	7	yes
GATCAGGACCCTCGTACAGC	66	60	yes
GATCCCGGCTAGACTCCTAT	3	1	yes
GATCAGCAGGAGGCTGAATA	25	3	yes
GATCATATCAAGTTTCCTAC	2	2	yes
GATCTGCCAGTGTGACTTCC	17	3	yes
GATCCTTGTGTTGTTCGTGA	5	4	yes
GATCAACCTTGATGGCAATG	13	12	yes
GATCTGAGAAAACGAGCCTG	255	31	yes
GATCCTTCCAGCCAGGGGAG	1	1	yes
GATCTGTTCAATGTAGCATG	2	2	yes
GATCTGCTGGGTCACCAAGG	44	40	yes
GATCCTTTGCCTCTGATGAG	14	1	yes
GATCCTGGAGCTTGTATGTG	11	1	yes
GATCTCAACCAAGTTCGTAT	20	5	yes
GATCTTGCCAAAGCAGTAGC	58	4	yes
GATCCTGTACTCTTAGGGCT	8	8	yes
GATCCTGGTAAACCCTGTGT	3	3	yes
GATCCTGCCTCCTTGGACAC	41	8	yes
GATCCTAGCCTAGGACACTG	2	2	yes
GATCAACTCCATGTAGGTTT	9	10	yes
GATCCTAGCTCCCCTGCTGG	29	9	yes
GATCTGAAATCCAGGGAGTA	6	5	yes
GATCGGGAAAGAGAGAAAGA	2	2	yes
GATCGAGTTCCGGCTAGTGC	13	6	yes
GATCCCTCACAGTCTGTTAC	3	3	yes
GATCTCGCGCCAGGAGCTGG	47	3	yes
GATCCCGGCCTCCTACACAC	178	1	yes
GATCCAAGTTCAGGGGGTTA	15	1	yes
GATCCTGGGGGAAAAGGGAG	27	30	yes
GATCAAAGTGGAAGGTTGCA	24	2	yes
GATCTCCCATGGGTCACCCA	34	1	yes
GATCTGCACATGTCATCGCG	40	3	yes
GATCCTGAGGACCTGGACAG	20	2	yes
GATCCTGAGAGTTTTCCTGC	1	1	yes
GATCATGCTGGAAGATGGCA	67	13	yes
GATCCCACAATTAAACTGCA	181	8	yes
GATCCAAGACAAGGAAGGCA	131	2	yes
GATCATCATTGAGGTGGATG	8	8	yes
GATCCCATCCCAACACCTCC	107	31	yes
GATCTCACACAGTAGTGACA	10	11	yes
GATCTCGAGAGGCTTTGTGG	39	23	yes
GATCTCCTCCATTCCTAGCT	29	3	yes
GATCTCCTCAGCCTGTGCCT	3	3	yes
GATCTCATCATGGCTCTGGC	7	8	yes
GATCCCAGGCTGGGCCGGGA	3	3	yes
GATCAGCTCAGTTTGCTGCT	21	3	yes
GATCTCACTGGTCCCGGGAA	58	6	yes
GATCATTCTCTTGCGCTTTA	9	1	yes
GATCAGCGCTGGGAGAGGCC	57	7	yes
GATCAGCAAGCAGGAATACG	185	35	yes
GATCGTTCTCGAGAACCTGT	13	0	yes
GATCATCCTGTGGCTACTAG	183	23	yes
GATCCCCTGGAGACGCCTGG	28	25	yes