#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCCTCTCGTGGCTTCCTA	1	1	yes
GATCAGAGGTGTACACTAAC	6	5	yes
GATCATAGTGGACGTTGTTA	2	2	yes
GATCAAGCAGCAAAAAAAAA	2	1	yes
GATCATAAACAGCTGTATTG	7	6	yes
GATCAGTGTGTGCCAAGGAG	128	20	yes
GATCAGTGGGTGGACTGCGA	4	3	yes
GATCAGTCAGTGACAACCAA	43	19	yes
GATCAAGAGAAAGAAGTGGG	117	25	yes
GATCACCCCAAAGCTCGTTA	24	23	yes
GATCAGTAGAGCTTGGACCC	192	31	yes
GATCAGTACACGGTGTATGT	44	7	yes
GATCAGGGCAATGGTCACTG	74489	1467	yes
GATCAAGACGCTCATTGCCA	7	5	yes
GATCAAGACGCAGGTCGAGG	37	11	yes
GATCAGGCTCTTTGTTTGTG	56	3	yes
GATCTGGCCAACGGCAACAT	116	15	yes
GATCTGGCAGTCATAGCTTG	201	8	yes
GATCTGGCACTACAGACAAA	9	1	yes
GATCTGGCACTAACAGAACC	2	1	yes
GATCTGGCACCCTCTCCTGG	12	9	yes
GATCTGGCAACTGTGCGGGG	24	23	yes
GATCTGGCAAAAACTACGGG	256	1	yes
GATCTGGATTTGGTTGAGAT	28	16	yes
GATCTGGAGTTGGCTTGTGC	49	38	yes
GATCTGGAGTCTGGTGTGGC	331	226	yes
GATCTGGAGAAGAATGGTCG	24	2	yes
GATCTGGACTTTGCTCAACC	14	13	yes
GATCTGGACTGGTGTTTCTT	52	2	yes
GATCTGGACTCACCTGGGAG	18	14	yes
GATCTGGACTCAAGGGGCAT	29	12	yes
GATCTGGACGGAAGTGGAGT	63	13	yes
GATCTGGACGATTCTGAGCC	182	29	yes
GATCCTGTGTTTGAATGACA	117	1	yes
GATCAGGCCCACTCCAGGAG	14	2	yes
GATCAGGAGAACTCCTGGTC	1	1	yes
GATCAGGAAGACACGGACTC	15	4	yes
GATCAGCCTACGCTCACATT	110	18	yes
GATCAAGAATGGACCAAGAT	39	30	yes
GATCACCAAGTGGTACCTGG	7	6	yes
GATCAGACTGTTGCTTTCGC	251	114	yes
GATCAGCACCAAGTGACTTG	11	3	yes
GATCAGAGTACTCAAGAGAG	5	5	yes
GATCAGAGCTGCTGACGCTG	27	13	yes
GATCAGAGACAGTCCCCGTT	26	6	yes
GATCTGGACCAGGCTTGGAA	9	7	yes
GATCTGCTTTGTGCTTGGCT	422	25	yes
GATCTGCTTTCTCAGGACTC	59	12	yes
GATCTGCTTGTGTTGTGTTG	124	69	yes
GATCTGCTTGGCTGCCATTA	115	16	yes
GATCTGCTTGCCCCAAACAA	72	55	yes
GATCTGCTTCTACCTCCCTA	19	4	yes
GATCTCTACCACCCAGGTAC	3	2	yes
GATCTCGGACGCTCAGTGGG	240	6	yes
GATCTCGCTGGTTCGCACCT	13	10	yes
GATCTCGCTGCATTTACATA	57	9	yes
GATCTCGATTCTACAGTGGT	20	15	yes
GATCTCGAGCACTCTCGTCC	23	17	yes
GATCAGAACCTTGCCGAAAC	15	1	yes
GATCAACGTGATGGACGCAC	95	1	yes
GATCACTGTTTGTGCCTCTG	86	7	yes
GATCACTGTGTCCCAGGCTG	105	14	yes
GATCACAATGAAGTCCTGGG	2	1	yes
GATCAGAATGGCGGAGGCGG	131	27	yes
GATCACAAGTGGAAAGCAAT	18	14	yes
GATCACTCTTCCCGCTGCTG	178	0	yes
GATCACTATGTCCAGGCCAA	49	7	yes
GATCACGCTGCTCCGACAGG	27	7	yes
GATCACAAAGCCAGTGCTGG	4	3	yes
GATCACAAAGACTACAGCAG	3	2	yes
GATCAACCAGTGCAGAAACC	36	10	yes
GATCACCTGTGTCGTAGCCT	22	4	yes
GATCACCTGTGGAGTTGTCA	25	19	yes
GATCACCTGACTCCTAACCG	73	16	yes
GATCTGTTGGCCCATGCATG	7	6	yes
GATCTCCTCTCCAGGGAGCT	15	11	yes
GATCTCCCTGTGCCGGTGCC	97	16	yes
GATCAATTGGCACTAGACCC	5	3	yes
GATCACATGGGTCGAGGGTT	35	14	yes
GATCACAGGGGAACTAATTC	11	12	yes
GATCACAGAGTGGGAATCTC	210	99	yes
GATCTTGAAGAAGATGAGGC	24	18	yes
GATCAACACTCCCCACGATG	7	6	yes
GATCACACTGTCTGAGGCGT	19	7	yes
GATCACACGCAGAATGAAGT	2	1	yes
GATCTCCAGGACTTGTGTGG	5	4	yes
GATCAAGTTCAACGGTTTTT	1	1	yes
GATCTCAGTCGGATGCACCC	23	17	yes
GATCAAGGACATCCATGTGC	32	24	yes
GATCTCAGGTCACGGCTTTG	29	22	yes
GATCAAATCCGACGACGAGG	22	7	yes
GATCAAGAAGTCTGAAAGAA	4	3	yes
GATCAAATATGTGCCCTATG	27	15	yes
GATCGCTGCCAACATCCAGG	7	6	yes
GATCTCAGGGCAGAAATGAT	75	5	yes
GATCTCAGAGGCTCGGTATC	40	1	yes
GATCAAACCCAGGGCTTTGT	108	24	yes
GATCACTTTATTTGCTAGGG	284	10	yes
GATCAAAGGAAATGGAGCCA	106	7	yes
GATCAAACTACGGCACAGCA	4	1	yes
GATCAAAAACCTGCGGATGG	4	3	yes
GATCAAAGCACTGGCGGGCT	75	10	yes
GATCAAAGAGCACACTGGGG	145	111	yes
GATCAAAGACTGCGACACCA	10	8	yes
GATCAAAGAAGGCTGTTGAC	474	330	yes
GATCTCACAAAAGTGCTGCT	19	15	yes
GATCAAACGTGGCTGAGCGC	304	4	yes
GATCAAACGTGGCTGAGCGA	15	21	yes
GATCAAACGCCCTGGCAGAA	4	5	yes
GATCATCTTGTGAAAACCCA	447	48	yes
GATCCACCTGAGAGGGATGG	10	10	yes
GATCAAACCTGAGGGCACAT	12	1	yes
GATCTTTTCCACCTTCAGAG	68	18	yes
GATCAAACCCGTGGAAGAGG	56	9	yes
GATCAAACAGGCTGTCAAGA	91	10	yes
GATCTTTTACTTCGTGGCTG	167	22	yes
GATCAAACACACACAAGCAT	15	6	yes
GATCAAAACCCATCAACACC	17	13	yes
GATCTTTGTCCAGTTCTGCA	13	10	yes
GATCGTGACCCCAAGGACTG	10	8	yes
GATCTTTCTGGCAAGGAAAC	2471	277	yes
GATCGCCTTTCTTACAACCA	1	1	yes
GATCAAAAGGACAACCACTC	4	3	yes
GATCCGGGCGTGGGGAGCTT	2	2	yes
GATCATCCAGAACACAGCCT	191	12	yes
GATCTGCGCTTCCAGAGTGC	6910	37	yes
GATCCACTCAGCCGTGGTTT	34	20	yes
GATCCTGAGCCAGATGTCAT	52	24	yes
GATCCTGAGATGCAGCTCAT	11	2	yes
GATCCTGAGAGAAAACAGCA	55	4	yes
GATCCTGAGACAGGGAAAAG	39	7	yes
GATCCTGACTTTGCCAGCTG	22	3	yes
GATCCTGACTCTGACACTAC	21	9	yes
GATCCTGACCTGGGCTTCCT	136	13	yes
GATCCTGACCACATGAACAA	199	34	yes
GATCCTGACAGTGCACCTAA	83	8	yes
GATCCTGACAGAGCCTTGGT	306	13	yes
GATCCTGAATGACGTTCAGG	83	8	yes
GATCCTGAAGTGGCCTCAGC	106	2	yes
GATCCTGAAGTAGACAAAAA	7	7	yes
GATCCTGAAGGTCATCCGCA	11	6	yes
GATCAGAAATGAGGTGTAAA	5	8	yes
GATCCACGGCTCTTCACACT	1	1	yes
GATCCGCATCCTCAACCCAT	82	2	yes
GATCCGCACCGGGTGGGGAA	9	5	yes
GATCCTGAAGAACTTTGTCA	5	5	yes
GATCCTGAACGAGAGCCTGC	4	4	yes
GATCCTGAAAGCCAAGTTAG	95	36	yes
GATCCTCTTTGCCAACCCCA	57	12	yes
GATCCTCTTGCTGCAGCTTC	73	26	yes
GATCCTCTTGCGGGACAGTC	42	12	yes
GATCCTCTTGATTCCTTCTG	71	4	yes
GATCCTCTTGATGCAGAGAG	41	2	yes
GATCCTCTTCTTCAGCACAC	134	33	yes
GATCCTCTTCCTGCTCCAGC	77	27	yes
GATCCTCTTCCCATCCATCC	47	12	yes
GATCCTCTTCATCTTGGGCA	123	2	yes
GATCCTCTGTTGGGGCCTCG	83	8	yes
GATCCTCTGTTGCGTATTCT	16	3	yes
GATCCTCTGTGGACTCATCT	90	8	yes
GATCCTCTGTGCCTCACTCC	73	19	yes
GATCCTCTGAGGCAGTATTG	83	4	yes
GATCCCCGCCCTGCCCCCGC	5	5	yes
GATCCTCTCTTGTGCTACCT	100	1	yes
GATCCTCTCTCGGTGTGGTT	208	4	yes
GATCCTCTCATTCAGTCTTC	15	1	yes
GATCCTCGTGCCTGTCTCCC	707	79	yes
GATCCTCGTCCACCCTAACT	46	5	yes
GATCCTCGTCACCACAGTTG	27	9	yes
GATCCTCGGGCAAGCCAAGA	955	43	yes
GATCCTCGGGAGACCACTGG	117	9	yes
GATCCTCGGGAATTTTTACC	83	6	yes
GATCCTCGGAGGCTACCGAG	26	0	yes
GATCCTCGCAGCTTCTATGA	60	3	yes
GATCCTCGAGTGAGGACGAC	1	1	yes
GATCCTCGACAGGAAGCCAC	31	0	yes
GATCCTCCTTGTCAAGTACA	350	88	yes
GATCCTCCTGTGAAGTGCCA	1	1	yes
GATCCTCCTGCGTGCTGACA	26	5	yes
GATCCGGTCCATCGTGCGAG	2	2	yes
GATCCTCCTGCCCCTCCAAT	40	1	yes
GATCCTCCTGCCCCGACAAG	18	14	yes
GATCCTCCTGAGTGCTGGGA	25	6	yes
GATCCTCCTCAGACTTGTCC	19	15	yes
GATCCTCCGTGAGTATGCCT	36	20	yes
GATCCTCCCCTTTACGGACA	29	5	yes
GATCCTCCCCAGGGATGGGG	291	57	yes
GATCCTCCCAAGTGAATGAC	24	5	yes
GATCCTCCAGTCAGTCTATT	3	4	yes
GATCCTCCAGGACAAGGGGT	37	11	yes
GATCCTCCAGCAGAGTGGAC	39	10	yes
GATCCTCAGTTACTCGCTGC	5	5	yes
GATCCTCAGTGCTACTTGCG	86	9	yes
GATCCTCAGGGTCTGCCCTT	31	17	yes
GATCCTCAGGAGTTGCAATG	273	20	yes
GATCCTCAGGAAACAGTCTC	71	4	yes
GATCCTCAGCTGGCTGGAGC	87	3	yes
GATCCTCAGCTGCCCTGCCT	81	4	yes
GATCCTCAGAGACGTGCTCG	101	5	yes
GATCCTCACCATCCACGTTT	10	3	yes
GATCCTCACCAGCCGCGGGC	1058	82	yes
GATCCTCAAGGAAGACTTGC	41	8	yes
GATCCTCAAGCGCCTCAACC	153	6	yes
GATCCAGTGCCTGTGTAGAA	47	3	yes
GATCCAATGCGAGGTGGCCC	10	10	yes
GATCCCTGCTCTGCAATGAG	1	1	yes
GATCCAGGCCCTGGGAGGCT	71	4	yes
GATCCTCAACATCCGCCTGC	20	1	yes
GATCCTCAACAAGATGCTAT	40	1	yes
GATCCTCAAACAGACATTGT	1	1	yes
GATCCTATTGAGTTGCTAAG	6	6	yes
GATCCTATTCCAGCCAAATG	209	7	yes
GATCCTATTAGCCAAACTTT	11	2	yes
GATCCTATGTGTTGGCCATT	7	2	yes
GATCCTATGTAGCCCAGGCT	1	1	yes
GATCCTGGCACTGGTGAGAC	91	7	yes
GATCCTATCTCCCGGTTGGG	17	3	yes
GATCCTATCATTGCTGGTGG	173	13	yes
GATCCTATCACCAGCACTGA	61	6	yes
GATCCTACTGTGGATGACAC	336	4	yes
GATCCTACTGATGAAGTGCC	149	17	yes
GATCCCTGAGGCTGCCTCGA	77	17	yes
GATCCCTGAGCTATTGCTAG	30	1	yes
GATCCCTCTCCCAGGAACAA	15	3	yes
GATCCAAGCTGTCAAGAAGG	637	19	yes
GATCCAAGCTCCATTGTACC	16	13	yes
GATCCCTCCCAGAAGAATCT	2	1	yes
GATCTTTTCCAGGGATTTTT	1	1	yes
GATCCAAGCAGCCTTCAGGG	2	1	yes
GATCCAGAAGTTCATTGCCG	4	4	yes
GATCCTACGGAGCAAGTCTA	33	17	yes
GATCCTACCTTCTGCTTTCG	24	3	yes
GATCCTACCTGAGTGGCAGC	434	68	yes
GATCCTACCACAGAGCCTTA	7	8	yes
GATCCTACATCCATTCGGCT	18	2	yes
GATCCTACAGTGGCTGGCAA	208	13	yes
GATCCTACAGTCACTTCACA	28	16	yes
GATCCTACACTCCTGGCAGT	100	3	yes
GATCCTACACATGGAGGCTG	16	5	yes
GATCCTACACACCTACCAGA	16	1	yes
GATCCTACACACAGTGGTGA	55	1	yes
GATCCTAAGCAGATTCTGGG	29	0	yes
GATCCTAACTGTGGAACCTC	4	4	yes
GATCCTAACCTAAGATGCCT	31	3	yes
GATCCTAACCCAGTGGACTC	34	0	yes
GATCCCGTGTCCTGCAGACG	50	28	yes
GATCCCGTCTCAGCCACGTC	7	2	yes
GATCAACAACAGCGGCCCCA	57	10	yes
GATCCTAAATTTGACCCAGG	62	10	yes
GATCCTAAAGGCCGGTCACA	169	4	yes
GATCCTAAAGAAAGATTACG	11	1	yes
GATCCTAAACTCTGTTGCCA	15	1	yes
GATCCTAAAACTGAGGAAAG	50	11	yes
GATCCTAAAACCAAGGGAAT	7	8	yes
GATCCGTGAGCTAGTTCTCT	54	19	yes
GATCCGTTTGGCCTCTCAAT	8	12	yes
GATCCGTTGGAAGGTTTACC	57	14	yes
GATCCGTTGCCTCCTTAAAG	224	0	yes
GATCCGTTGCCAGTTACCTG	538	98	yes
GATCCGTTCCTTATTGCCTG	6	5	yes
GATCCGTTCCTAGGGTACCT	91	70	yes
GATCCGTGTGTGTGTGGGAG	600	89	yes
GATCCCAGGCTTCTGGGGAC	30	1	yes
GATCCGTGTGAAACTGGATG	3022	139	yes
GATCCGTGTATGTCTAAACA	119	1	yes
GATCCGTGGCTGCAGCAGAA	166	31	yes
GATCCCGGCTCAATCTCTGG	14	10	yes
GATCCAAAGGAGCTACTTAG	3	2	yes
GATCCTAGCCACCTTGAGGG	6	5	yes
GATCCCGCCGCACGTTCCCA	12	5	yes
GATCCGTGCTGAGCGTCGGC	924	74	yes
GATCCGTGCTGAATTGGTTT	15	1	yes
GATCCGTGCATCTCATTGGC	36	10	yes
GATCCGAAGATGCTAGAAAG	4	3	yes
GATCCGTCATCTCCAGGACA	29	6	yes
GATCCGTATCAGGTTCATGT	46	3	yes
GATCCGTAGTCTGAGTGATG	207	15	yes
GATCCGTACCCTGGTGCTGA	266	3	yes
GATCCGTAAGAAAGAGAAGG	86	17	yes
GATCCGGTTCTGGGACAGCA	81	11	yes
GATCCGGTCCCAAGACCGCT	961	70	yes
GATCCGGTCCAAGGCTCTTG	97	13	yes
GATCCGGGTGTCCAGTGACA	244	38	yes
GATCCGGGTGATGCGAATCG	39	0	yes
GATCCGGGGGTTCAATTTAT	203	29	yes
GATCCGGGCAAAGCCTGCTC	597	23	yes
GATCCGGGAGTGCTGGACTT	15	15	yes
GATCCGGGAGGTGTGCGGCT	5108	117	yes
GATCCGGCTGTGCCAGGTGT	26	8	yes
GATCCGGCTGGGCCTGGCTC	59	24	yes
GATCCAAAATGTTCCATGGA	86	2	yes
GATCCAAAAAGCAGTTCAAC	3	2	yes
GATCCCCTCCGTTGGCCCGG	6	3	yes
GATCCGGAAGAAGATGATGG	5	0	yes
GATCCGCTTGGCAGCCATTC	368	30	yes
GATCCGCTTCGTGGAATGGG	5	2	yes
GATCCGCTTACAGAGACTTT	77	2	yes
GATCCGCTGTCAGGAGCTGA	59	1	yes
GATCCGCTGCAACCCGGTGC	419	27	yes
GATCCGCTCTGTGGTCGCCT	229	3	yes
GATCCGCTCTGAGGTTCTGT	213	11	yes
GATCCGCTCTCTGCATCTGT	57	1	yes
GATCCGCTCCTGGCGACTCC	190	25	yes
GATCCGCTCAGAGCCCAGCA	171	4	yes
GATCCGCTCACGCCCAGCAG	86	31	yes
GATCCGCCTTCTACTCGGAA	3	2	yes
GATCCGCCGCTAAGACCTGG	118	49	yes
GATCCGCCCGCTCACACAGG	5	5	yes
GATCCGCCCACACCCACGTG	263	42	yes
GATCCGCCAAGTTATTCAGG	25	4	yes
GATCCGCCAAAAAAATGCAC	37	36	yes
GATCCGCATGATGGGAGGAG	153	21	yes
GATCCGCATCCGCAAGCCCT	281	4	yes
GATCCGCAGGTCAGATGACA	50	12	yes
GATCCGCAGCTTTTCCAGCA	50	3	yes
GATCCGCAATTATGAAGAAC	32	31	yes
GATCCGCAAGGTGCTGGACG	1022	21	yes
GATCATTTCGGGCCAGTAGG	197	61	yes
GATCCAGACAGCCATCAAGG	509	29	yes
GATCCCCGAAGTCTCTCTCC	26	12	yes
GATCATTGTCTTCTGTCTTC	161	3	yes
GATCATTGGTGGAGACCAAT	2	1	yes
GATCCCCAGGGTTTGCTGCT	27	3	yes
GATCCGCAACTGTCCGGAAG	18	14	yes
GATCCGATTTCTGATTTTGC	176	15	yes
GATCCGATTGAAGCCTCAGG	102	16	yes
GATCCGATGGGCCAGCCTTT	263	4	yes
GATCCGATGAGGAAGATGAC	78	6	yes
GATCCGAGTGAAAGCCGGAG	49	14	yes
GATCCGAGGCTAGAGGGAGC	49	2	yes
GATCCGAGGCAGCCAATACA	537	150	yes
GATCCGAGGCAGATTTTCTT	8	2	yes
GATCCGAGCGACTGTCACCA	149	6	yes
GATCCGAGCCTCACTACCTG	10	0	yes
GATCCGAGCAGCCACATTCC	60	22	yes
GATCCGACAGGAGGGTGTAA	418	1	yes
GATCCGACAGAGGTGCCCCG	29	22	yes
GATCCGAATAATCCAGGAGG	287	36	yes
GATCCGAAAGGACAATCAGT	33	1	yes
GATCGATGTCCCTCTTCTCC	3	2	yes
GATCCACATTCCTGACCTGG	75	3	yes
GATCCCGGGCAGGCAGTATG	5	3	yes
GATCTGCTTCCCATTGTGGT	117	14	yes
GATCTGCTTCCCAACTGTTA	36	0	yes
GATCTGCTTCCATCCATCTC	29	3	yes
GATCCTAGGCTTCCTTCCCA	101	34	yes
GATCCTAGCTCAGAGAGGCT	49	6	yes
GATCTGCTGTTCCTCACGAA	49	10	yes
GATCTGCTGTGGCACAGGGC	171	28	yes
GATCTGCTGTCTACTACCTA	42	6	yes
GATCTGCTGTAGCATCAAGC	35	27	yes
GATCTGCTGGTCATTAAGGG	677	10	yes
GATCTGCTGGCAGTAGTAGT	20	9	yes
GATCTGCTGGAAGATAATCT	7	0	yes
GATCTGCTGCCAGGTTTTGC	6	5	yes
GATCTGCTGCAGGGTTCTGT	468	52	yes
GATCTGCTGCAGCTAAAGTA	35	34	yes
GATCTGCTGATGTTACGTCG	56	11	yes
GATCTGCTGATATTCCGGGC	35	15	yes
GATCTGCTCTTTTCGTGTTC	22	4	yes
GATCTGCTCTGTAGAAAGAA	11	2	yes
GATCTGCTCCTTCTGTCCCA	85	12	yes
GATCTGCTCCTTAACGTTTT	5	5	yes
GATCTGCTCCTGGAGGTGGT	81	23	yes
GATCTGCTCCCAAGTTATCT	92	24	yes
GATCTGCTCCAACTACAGGA	24	5	yes
GATCTGCTCAGTGACTTGTG	188	5	yes
GATCTGCTCACTCTATTACT	2	2	yes
GATCTGCTCAACAACTCCTT	9	8	yes
GATCTGCTATTGAATCGAAT	4	3	yes
GATCTGCTATGTACTCCAGG	82	5	yes
GATCTGCTATCTCACCTGGC	286	137	yes
GATCTGCTAGCAGAACTTGT	8	6	yes
GATCTGCTAGAGCTGTAATA	241	141	yes
GATCTGCTAGACCAAAACAG	4	3	yes
GATCTGCTACTGGAGATGTT	19	6	yes
GATCTGCGTATGGCGGCCAT	3448	1569	yes
GATCTGCGTACACCTGCGTC	418	78	yes
GATCTGCGGTGACTTGATGT	1504	67	yes
GATCTGCGCTATAGAAAAAA	119	18	yes
GATCTGCGCCTGCCTTGTCT	162	18	yes
GATCTGCGCCTGAGCCAAAG	485	9	yes
GATCTGCGAAGCCAGGCTTC	21	16	yes
GATCTGCCTTGGATTTCCTC	137	11	yes
GATCTGCCTGTTACCTCTTC	17	13	yes
GATCTGCCTGTCACTGTGGC	232	19	yes
GATCCCAGTGTCCTTGGAGC	191	28	yes
GATCTGCCTGCCTCTGCCAC	33	11	yes
GATCCTGCAGCACGTTATCG	39	5	yes
GATCTGCCCTTTCTGGGTGA	78	6	yes
GATCTGCCCTTGCACCCGGC	25	19	yes
GATCTGCCCGAAGCCATGAG	128	13	yes
GATCTGCCCCATGGTGTTTT	11	0	yes
GATCTGCCCAATCCTTCCTC	9	9	yes
GATCTGCCATTCCCATCTGT	155	5	yes
GATCTGCCAGTTTTGGTGCC	255	19	yes
GATCTGCCAGTCCGAGGTTC	423	12	yes
GATCTGCCAGGACAAGCTGG	98	17	yes
GATCTGCCACTGCTTCTCTA	36	2	yes
GATCTGCCACAGCAAGAGTG	63	20	yes
GATCTGCCACACAGTAGACT	17	13	yes
GATCTGCCAATGGTGCCGTT	199	6	yes
GATCTGCCAAGATGAACAAG	1	1	yes
GATCTGATTGTTCACTGCTA	16	1	yes
GATCTGATTGCCTTCATGGA	55	14	yes
GATCTGATTCCTTCTTTGGG	4	4	yes
GATCTGATGTTCTCTTCTGG	1	1	yes
GATCGGTCTGAGATGACTCA	12	17	yes
GATCTGATGTCAGTCGTGGT	87	17	yes
GATCTGATGTATGCCAAGCG	432	4	yes
GATCTGATGGGTTTCTGGCT	37	11	yes
GATCTGATGCCCTGTTCTGG	61	47	yes
GATCTGATAGTCAAGTGTAT	47	10	yes
GATCTCAAAACCAAAACCAC	15	12	yes
GATCGCCATGCTCCTCTTCT	62	10	yes
GATCTATCGGCCTCTGCCTC	35	27	yes
GATCTATCCTAGCCGGGAGG	591	100	yes
GATCAGTCTCCATCAGACTT	38	1	yes
GATCTGAGTGGGTGGGGGGT	196	26	yes
GATCTGAGGGTGATTTCTCT	56	11	yes
GATCTGAGGAGCAGATGATG	15	12	yes
GATCTGAGCTTTGTATAACA	5	3	yes
GATCTGAGCTGCCCTCTGCT	51	7	yes
GATCTGAGCCTCCACCTGTG	61	13	yes
GATCTTTGGGTTTGAGGATA	54	19	yes
GATCTACTCCCGGGCCCAGC	278	49	yes
GATCTTTGCCCAGGCCCTGG	16	13	yes
GATCTTTGCCAAAATGTGTG	26	2	yes
GATCTTTGATTTTGCCCTGA	18	14	yes
GATCTTTGAGGTGCTAAGTT	33	25	yes
GATCTTTCTACATCCCTGGG	15	12	yes
GATCTTTCGTCTACTGGTCA	38	29	yes
GATCTATACAGTCGGGAAAC	925	646	yes
GATCTGAGCCCAGATGGAAG	9	7	yes
GATCTGAGCATAGAAGAAGG	135	29	yes
GATCTGAGAGAGGAAACCTT	1	1	yes
GATCTGAGAAGTGTGCAGAT	3	2	yes
GATCTGACTGTTCCTGCAGG	19	1	yes
GATCTGACTCTCTCTTCTGT	4	5	yes
GATCTGACCTCTCCTGGCAC	5	3	yes
GATCTGACCGAGAACTGAAC	8	6	yes
GATCTGACCAACAAGACCAC	28	2	yes
GATCTACCTGGATGGGGCGC	27	7	yes
GATCTACCGTGCAGGGACTG	46	2	yes
GATCTACCGTAATGGCTCCA	5	3	yes
GATCTACCACCCTAACATCG	17	13	yes
GATCTACACATGGGGCAACC	520	36	yes
GATCACTGACTGCCCCAAAC	4	3	yes
GATCTTGTTTGTGTCTCTGC	14	10	yes
GATCTTGTTGGGAAACTAAT	2	1	yes
GATCTGAATTTCTTCCTCTT	5	4	yes
GATCTGAATGTCCGAGAGAG	178	40	yes
GATCTGAAGTTCTGTGTTCA	3	2	yes
GATCTGAAGTCTGAATGGCA	127	26	yes
GATCTGAAGCTGCTGATGAA	22	22	yes
GATCTGAACTCCAGAGAACA	78	16	yes
GATCTGAACCTGCCTGGAAA	5	3	yes
GATCTGAACACCCAGCGAGG	11	8	yes
GATCTCTTTTGCCAAGAAGT	11	8	yes
GATCTCTTTGTGTTCAAGAC	78	32	yes
GATCTAATTGCAGTGGTTAA	47	4	yes
GATCTACGCACGCATCAGCA	65	8	yes
GATCTACCGTGCACACCCAG	44	34	yes
GATCTTGTATTCTCTGGCTT	85	21	yes
GATCTTGTACAAACCGGTTT	29	22	yes
GATCTCTTTGTCCTCCCAAT	1	1	yes
GATCTCTTTGCCCTGTATTT	37	11	yes
GATCTCTTTCTTGTTCCCCC	61	13	yes
GATCTCTTTCTGAGACCTTT	1	1	yes
GATCTCTTGTGAAACGAAAC	26	20	yes
GATCTCTTGAAGTGCCAAGG	25	19	yes
GATCAGACCCAGCAGCCTAC	4	3	yes
GATCTTGGGGGAGAGAGGGA	13	18	yes
GATCGTTGCTCTACTCGTGT	3	2	yes
GATCTTGGGGAGTTTGACTG	13	4	yes
GATCTTGGGAAGCAAGAAAC	7	6	yes
GATCTTGGCTCTGTGGAATG	128	1	yes
GATCTTGGATGCAGACTCGG	46	35	yes
GATCTAAGACCCAGCAGATA	43	33	yes
GATCTCTGTGTTCAGGCTCT	10	10	yes
GATCTCTGTGTGTGTGTGTG	49	50	yes
GATCTCTGTGGGCCTTTGGG	12	12	yes
GATCTCTGTGCTGGCGCCTG	30	29	yes
GATCTCTGTGAGTTTGAGGG	92	89	yes
GATCTCTGTGAGTTCAAGGG	35	50	yes
GATCTCTGTGAGCCTAGGAG	7	6	yes
GATCTCTGTGAATACTTTTC	14	13	yes
GATCAGTGCAGCCCGGTCTT	4	3	yes
GATCTAACTCCTGTTGCTCT	4	5	yes
GATCTTGCTTCAGCCAACGC	234	94	yes
GATCTTGCGTGTTCTGTCCG	5	4	yes
GATCACGATGGCTATGGCGC	6	5	yes
GATCTTGCCCCTGCCAGTGG	215	96	yes
GATCTTGCATCCGCCAGCCA	20	21	yes
GATCACGTCTATGACCGGCT	8	6	yes
GATCGTCTGGCTCCGGCTCC	42	32	yes
GATCGTCTGCTGTGAAACGT	121	19	yes
GATCGTCCCCAAAATTGCCT	53	6	yes
GATCGTCCAGAGTCACTCAA	9	7	yes
GATCGTACGGGGCTGGAAAC	66	4	yes
GATCTTGACCTTATCCAGTC	12	5	yes
GATCTTGACAGGGAAGCCCT	26	20	yes
GATCGGTGGGACCCGGGCGA	484	22	yes
GATCTTGACAGGCTGGACCT	31	24	yes
GATCGTGGGCTTCAGCACCC	327	63	yes
GATCGTGGCACAAAATAGCT	10	8	yes
GATCTTGAAAACCTGTCAGT	20	15	yes
GATCTTCTTCATGGAGGACT	16	13	yes
GATCGTGACCAGCACCTACA	12	9	yes
GATCGGTCTGAGATGACTCC	82	29	yes
GATCACACTGAAGATGCCTC	84	18	yes
GATCACAAATGTGTCAGAGT	1	1	yes
GATCGGCTTTGAGAGAGGGT	64	39	yes
GATCACCGGTTTCCGACTGA	248	58	yes
GATCGGCTTGAACTAGCAAG	10	10	yes
GATCGGCGTGGCAGCTGTGG	45	34	yes
GATCTTCTCTCCACGTGGGA	4	3	yes
GATCTTCGTCCCCGACCATC	41	10	yes
GATCTTCGAGGAGGGCGAGT	17	13	yes
GATCTTCGAGACTTTGTTAG	8	6	yes
GATCGGCAAGCTGGAAGGCT	190	33	yes
GATCGGAATCGGAAGGAGAC	15	11	yes
GATCAGTTGACAGTGGCAAT	755	16	yes
GATCGCTGGACAGGTGGCAA	36	52	yes
GATCGGCGGGAAATGGCGGA	262	46	yes
GATCGGCGCCGTGAGATTCG	35	9	yes
GATCGCTCATTGGAACAGCT	1017	174	yes
GATCAACTGTGGAAGGCCAG	8	0	yes
GATCAACTGGCCAGGAGGAG	5	3	yes
GATCTTCCCAACAGTGCTGC	4	1	yes
GATCGCCGAGCCAGCGCCGG	30	23	yes
GATCGCCCTTGCTGGTCTGC	231	11	yes
GATCAACCAAGCCCTGGGAG	1	1	yes
GATCTGAAGCAATGTGACTG	12	9	yes
GATCAGGATGGCGAGGACAA	15	12	yes
GATCTTCAGCCTCTTGGGGA	31	23	yes
GATCTTCACTCACGTCCGGC	42	6	yes
GATCGCCTGCTAGTGCGGGA	254	52	yes
GATCTGGCACCACACCTTCT	7	6	yes
GATCTCGCTGCCTACCTCAG	139	94	yes
GATCTGTTGGTGCTGCTACT	36	8	yes
GATCACAGTTGGAGTTGTAT	9	6	yes
GATCTCTTTTCAGAAGTGTC	6	5	yes
GATCAAGTAGATTTTTGTGG	1	1	yes
GATCTGAGCCGGTCGAGCCC	372	251	yes
GATCATTCACAGCTTAAGAT	6	1	yes
GATCATGTTCACAACGCAGG	162	7	yes
GATCTCTGTGCTGTAAACTA	50	23	yes
GATCTCCCTGAGGGTGTGGA	192	61	yes
GATCCCTTTTCCATTCTGGA	19	5	yes
GATCCCTTTGGGGTGTGGAA	123	5	yes
GATCCCTTTCTCTGGCCCAG	620	9	yes
GATCCCTTTCCACCTAAAAC	2	1	yes
GATCCCTTTACCCAATCGTC	18	14	yes
GATCCCTTGTGAGCCCTAGT	44	34	yes
GATCCCTTGTCATGGTTTGG	4	4	yes
GATCCCTTGTAGCCAGAGTT	82	0	yes
GATCCCTTGGGCAAGTATCA	76	6	yes
GATCCCTTGCTTGCCTCTTG	154	8	yes
GATCCCTTGCTTCAACCTCC	167	23	yes
GATCCCTTGCTACATCTCCT	2	2	yes
GATCCCTTGCCTCCTGAGTT	57	7	yes
GATCCCTTGCCCTTGCATTC	14	10	yes
GATCCCTTGCAGTTCTGTGC	142	3	yes
GATCCCTTCTTTTTTGGCAT	19	4	yes
GATCCCTTCCTGCCCTCTTT	144	5	yes
GATCCCTTCCCCAGCGGTTC	102	6	yes
GATCCCTTCCAGCTGAGCCC	294	22	yes
GATCCCTTCCAAATCTGCTC	45	1	yes
GATCCCTTCATTGGGGACCC	12	5	yes
GATCCCTTACTGTTGTGTCT	2	1	yes
GATCCCTGTTTCTGCGGAGA	2	1	yes
GATCCCTGTTCCCCTGAGAA	4	4	yes
GATCCCTGTGGTCACTTAGC	49	5	yes
GATCCCTGTCTGATTTCTGA	1	1	yes
GATCCCTGTCTCGGGAGGTC	5	5	yes
GATCCCTGTCTAGTCCCTGT	90	14	yes
GATCCCTGTCCTTTCTGTTT	14	1	yes
GATCCCTGTCCCCCTACCCC	23	7	yes
GATCTTGCTGCTGTAGGAAG	14	13	yes
GATCATGGGTTGGGAGCTCA	200	34	yes
GATCTTGCCAAAGGAGTGAC	3	2	yes
GATCATGGGCAAAAAGCCCG	288	31	yes
GATCTACAGACTGAAGGCTA	1214	117	yes
GATCCCTGGTTGCATCTTCG	11	4	yes
GATCCCTGGTGGCTGCCCTT	1068	156	yes
GATCCCTGGGTGCCAGTTTT	214	25	yes
GATCCCTGGGGGCTGTGATG	37	6	yes
GATCCCTGGGGCTGCCTGTC	301	3	yes
GATCCCTGGGGCATGTTGTA	116	13	yes
GATCCCTGGGGAGCCTGCGG	39	5	yes
GATCCCTGGGAGGATATGAG	2	3	yes
GATCCCTGGGAACGAAGCTG	7	3	yes
GATCCCTGGCTCAGTGAACA	35	9	yes
GATCCCTGGCGTCCCTATCA	78	11	yes
GATCCCTGGCCCCTGTGCCA	225	16	yes
GATCCCTGGCCAGAAGTACA	7	8	yes
GATCCCTGGCACTGCTGCCT	63	24	yes
GATCCCTGGCACCCAGCATC	213	33	yes
GATCCCTGGAGTGACCAGAG	721	70	yes
GATCCCTGGAGTCTCTGAAG	61	7	yes
GATCCCTGGACTGGAACAAA	29	0	yes
GATCCCTGGAAGCTGTGATG	5	7	yes
GATCCCTGGAACAGAGTTAT	20	7	yes
GATCCCTGCTTTTGTGGCCT	195	3	yes
GATCCCTGCTTCCTGCCCAG	233	22	yes
GATCCCTGCTCTTAGGTGCT	92	3	yes
GATCCCTGCTCTGGACCCTC	141	4	yes
GATCCCTGCTCCCCTCTGGG	46	10	yes
GATCCCTGCTCCAGGTCCTC	72	0	yes
GATCCCTGCTAAAACCATGT	17	18	yes
GATCCCTGCCTGTGGGGGGT	336	29	yes
GATCCCTGCCTCGTCTGCCT	61	23	yes
GATCCCTGCCGAGGTGCTCA	243	8	yes
GATCCCAGGGACTCTGTTTT	2	2	yes
GATCATGGCTTTGAGGCCAG	376	25	yes
GATCATGGCGGTCAGCAGAA	63	1	yes
GATCATGGCCGACACCAGTG	9	8	yes
GATCATGGCAGGGATACGCA	45	6	yes
GATCATGGCAGGCCTTTAAC	291	28	yes
GATCCCAGCACCGACGCCAG	14	13	yes
GATCCCAGATTGCCAGCGTC	10	10	yes
GATCCCAGAGTGCTTGATGC	5	5	yes
GATCCCTGCCCTTTGGCCTG	76	11	yes
GATCCCTGCCCATGCTGTTC	34	3	yes
GATCCCTGCCACCTCATTGG	88	91	yes
GATCCCTGCATTTCCTCAAG	124	1	yes
GATCCCTGCATAGGACTGTT	7	4	yes
GATCCCTGCAGTACCATCTG	131	23	yes
GATCCCTGCAGGTCGCTCAG	156	6	yes
GATCCCTGCAGCGCTGTTTG	283	7	yes
GATCCCTGCAGAGGCTTCCA	106	5	yes
GATCCCTGCACAAGGTGTTT	146	24	yes
GATCCCTGCAACAGCAAGGG	42	4	yes
GATCATATTCTTTCCCCTCC	2	1	yes
GATCCCTGAGTTTACCAGCG	65	10	yes
GATCCCTGAGTTCAAGGCTA	27	2	yes
GATCCCTGAGTTCAAGGCCA	105	4	yes
GATCCCTGAGGTCTCCTGCC	18	16	yes
GATCCCTGACATAGCAGGAC	1	1	yes
GATCCCTGAATCCCCTACTC	13	10	yes
GATCCCTCTTACCTGCAACG	200	5	yes
GATCCCTCTGGTGACTCCAC	269	7	yes
GATCCCTCTGGGTCATGTCT	299	112	yes
GATCCCTCTGAACCGCCGAG	46	7	yes
GATCCCTCTCTCTGGGGAAT	6	1	yes
GATCCCTCTAAGCCCCCTCC	77	19	yes
GATCCCACTTCTGCGTCTTA	34	10	yes
GATCAACCGATGAGCATGGT	19	9	yes
GATCCCTCGGTGACCACATT	13	2	yes
GATCCCTCCTTGTGAGCAGC	241	33	yes
GATCCCTCCTGGGCATTGCT	46	4	yes
GATCCCTCCTCAGGCATCTG	822	13	yes
GATCCCTCCCTTGGGCCTCC	52	6	yes
GATCCCTCCCCTCCCTGGCT	57	3	yes
GATCCCTCCCCACCCTGCTC	70	3	yes
GATCCCTCCCAGAAACCTGC	837	198	yes
GATCCCTCCCACTCTGGCTC	165	20	yes
GATCCCTCCAGCCTCTACTG	21	1	yes
GATCCCTCCAGACACCAAGG	65	7	yes
GATCCCTCAGGGTGTGTGCC	71	22	yes
GATCCCTCAGGAACAGAGGG	28	8	yes
GATCCCTCACCTCCTTCATC	57	4	yes
GATCCCTATGCTGACCCCAA	27	13	yes
GATCCCTATGAAGTGTCTTA	75	5	yes
GATCCCTAGTGGCCCATCAT	12	2	yes
GATCCCTAGGGAGAAGGTGG	142	5	yes
GATCCCTAGCATTCTGTACT	180	7	yes
GATCCCTAGAGCCAGCACAT	238	34	yes
GATCCCTACTGCACCACCTT	46	15	yes
GATCCCTACTATTGATTCTG	19	6	yes
GATCCCTACTACGTGCTGGA	895	74	yes
GATCCCTACCTACAACCCTA	35	6	yes
GATCCCTACCCCACATGCTG	45	18	yes
GATCCCTACCCATGGGAATG	91	1	yes
GATCTGAGCAAGGGCAGGAA	18	26	yes
GATCATGACATTGTAGCCAG	24	0	yes
GATCATGACAGTCCCCCCAC	113	22	yes
GATCCCAAGTGGCACTGTTT	2	3	yes
GATCCTCAGTCACACACCCA	25	24	yes
GATCCCTACCCATGGACCCT	75	5	yes
GATCCCTACCACCTGCCCGA	41	7	yes
GATCATAGCAGATGCAGGGG	64	49	yes
GATCCCTAATGAGAGCAGAG	19	3	yes
GATCCCGTTTGTGAAGCCTG	2	3	yes
GATCCCGTGGACTGTTTGCT	112	32	yes
GATCCCGTCCAAGGAGCATC	358	34	yes
GATCCCGCGAGGCCCGGAAG	4939	423	yes
GATCCCGCCTGCCCAGCTGA	558	6	yes
GATCCCGCCGTTCCACCCTC	41	5	yes
GATCCCGCCCACCCAAAGCT	50	6	yes
GATCCCGCCAAAAGAATTAC	164	6	yes
GATCCCGCACATCCACAAGT	203	2	yes
GATCCCGAGATTGCCAGCCT	366	30	yes
GATCCACAAACTTCCTGACA	24	7	yes
GATCCCAAACCGGCTCCCGA	7	0	yes
GATCTTCCAAATCCTGGTCA	67	9	yes
GATCCATTGCGTAGCTGTCC	3	2	yes
GATCCCGACACCAAGGAGAT	2343	44	yes
GATCCCGAAAACCAGAACTT	2	3	yes
GATCCCCTTTTTGAACAGGT	78	21	yes
GATCCCCTTTCTTTACCTTC	50	1	yes
GATCCCCTTTCCTGTGAATG	174	4	yes
GATCCCCTTTACCTTCTGGG	147	12	yes
GATCCCCTTGGTTGCTGGAT	25	2	yes
GATCCCCTTCTCAGGGTCTA	31	2	yes
GATCCCCTGTTGACTTACAA	52	7	yes
GATCCCCTGGGTTGAGAGAT	1	1	yes
GATCCCCTGGGGCAAGCTGC	434	51	yes
GATCCCCTGGGAGGAGACAG	473	11	yes
GATCCCCTGGCAAGAAGGAA	81	6	yes
GATCCCCTGGATACATGGTC	17	17	yes
GATCCCCTGCTACACTGATG	6	6	yes
GATCCCCTGCTAATGAAAAT	7	3	yes
GATCCCCTGCCTCCACCTCC	34	33	yes
GATCCCCTGCCTCAGCTCCT	243	12	yes
GATCCCCTGCCCCCCAACCA	143	1	yes
GATCCCCTGCAACAGACATT	37	14	yes
GATCCCCTGAGATGGAATTA	6	4	yes
GATCCCCTCTTCCCAAATAA	66	19	yes
GATCCCCTCTGTGGGTATGA	47	1	yes
GATCCCCTCTGGGCCTCCGA	81	1	yes
GATCCCCTCGGACCCCCTTG	990	104	yes
GATCCCCTCCTCCAGGCAGT	117	4	yes
GATCCCCTCCCTTGCTTTCT	10	5	yes
GATCCCCTCCCTCTGATTTT	52	3	yes
GATCCCCTCCCACAGAATAG	1532	108	yes
GATCCCCTCACATGTGCTAT	123	2	yes
GATCCCCTATGGGGAGGAGG	90	15	yes
GATCCCCTATGCAAGCTGTG	134	44	yes
GATCCCCGTGTGTTTGCAGG	225	1	yes
GATCCCCGTGCCCCTGCCTA	244	1	yes
GATCTCTTCATGCTGGACCG	24	20	yes
GATCATCCGGATGCCTGGTC	3	2	yes
GATCATCCCCTGGCAAAGGC	4	5	yes
GATCCCCGTCTGTGTCTGTG	156	31	yes
GATCCCCGGTGCTCTTCGTG	142	3	yes
GATCCCCGGGAAAGTGTAGT	85	10	yes
GATCCCCGCAAAGTGAGCGA	117	14	yes
GATCCCCCTTTGCTGCCTCC	3	2	yes
GATCCCCCTCCCTGCTCTCA	2	3	yes
GATCCCCCTCCCCCCAGTGG	200	166	yes
GATCCCCCCACCCCACCACC	860	464	yes
GATCCCCCCAACTGTGTGCC	36	2	yes
GATCTTGTTGGCCCATCTAT	20	15	yes
GATCCCCCAGGTCTCAGAGG	111	35	yes
GATCCCCCACCTCCTCGGCC	28	18	yes
GATCCCCCACCCCCACCCCC	38	3	yes
GATCCCCCACATCCTGGGGC	234	30	yes
GATCCCCATTTGCAGTAAGA	263	3	yes
GATCAGCCAGCCGACCGAGG	28	6	yes
GATCATATGGGTGATTCAGT	18	14	yes
GATCCCCATGTTGAGCTCTG	124	7	yes
GATCCCCATCTGCAGTACAA	2	2	yes
GATCCCCATCTGACTCAGTA	85	20	yes
GATCCCCAGTTGTGTCAATG	6	1	yes
GATCCCCAGTGAAGGGTCTG	2	0	yes
GATCCCCAGTCTTTAGTCCC	512	53	yes
GATCCCCAGTATGCAGTAAT	4	1	yes
GATCCCCAGGTCCCCTTCAA	20	6	yes
GATCCCCAGGGGCTCCCGGT	4	4	yes
GATCCCCAGGAGATGAGGTC	15	3	yes
GATCCCCAGCCTTGGATAGT	34	10	yes
GATCCCCAGCCCAATCTTTC	233	33	yes
GATCCCCAGCATTAGGCCAT	5	0	yes
GATCCCCAGCAGTAACACTT	15	15	yes
GATCCCCAGCACAGGAAGGC	37	14	yes
GATCCCCAGAGTCCCCTGTG	254	11	yes
GATCCCCAGAGCCTTGGGGA	344	7	yes
GATCCCCAGAATCCCCAATA	88	3	yes
GATCCCCACTTTTGTGACTT	57	59	yes
GATCCCCACTTGTGTGACTT	56	33	yes
GATCCCCACTTCTGTGACTT	37	39	yes
GATCCCCACTGTGCCTTTTT	462	9	yes
GATCCCCACCAGCCACCCCC	715	274	yes
GATCCCCACAGCTGCGTATG	249	21	yes
GATCCCCAAGTCTGTGACAC	31	3	yes
GATCCCCAAGGCCCCACCAT	708	499	yes
GATCCAAACATTCCAAGAAA	29	5	yes
GATCCCCAACAATGTGAAGA	1105	0	yes
GATCCCCAAAGGGCAGGTCC	47	49	yes
GATCCCCAAAGCCTGGAGCC	226	61	yes
GATCATACCCACGTTGCCCA	12	7	yes
GATCATAAGAGGCACGTGAT	171	79	yes
GATCCAGTGACAATGTTCCA	1	1	yes
GATCACCCAGGCACCGGCAA	86	4	yes
GATCCCATTTTTGACAGCAA	60	2	yes
GATCCCATTGTGCTTAGCCT	111	17	yes
GATCCCATGTTCAAGCTGGT	139	63	yes
GATCCCATGTGTCTTTTTGC	184	1	yes
GATCCCATGTGTCTCCCCCA	24	5	yes
GATCCCATGTGCCACCATCA	54	37	yes
GATCCCATGTCCTGCTTTCT	65	2	yes
GATCCCATGTCCTCTTCTGG	7	2	yes
GATCCCATGCTTTGAAAAAT	4	4	yes
GATCCCATGCTAGCCTCTTG	93	2	yes
GATCCCATGCCTGGAATTTG	26	5	yes
GATCCCATGCAGAGCGGCCT	1606	69	yes
GATCCCATGATGGAAATATT	30	1	yes
GATCCCATGAATCATTTGCC	7	7	yes
GATCCCATGAAATCCCCAAA	112	9	yes
GATCCCATCTCCTGGAAGGA	31	18	yes
GATCAGGGCAAGAGTGTGCG	3	0	yes
GATCCCATACCTGACATGAC	30	8	yes
GATCCCATACAATGCCGCCC	101	39	yes
GATCCCAGTTTGCTTCATGA	42	1	yes
GATCAGTTTCTAAGATTGCC	1	1	yes
GATCCAGTCACACCCCACCC	61	26	yes
GATCAGTGAAAGTGGAGTGT	4	3	yes
GATCAGTTACTTACCCACTC	33	25	yes
GATCCAGGTGTGAGATGATG	108	5	yes
GATCAGTGGGTGCCCGTGAT	61	19	yes
GATCAGGCCATAATGTCTCC	3	2	yes
GATCAAGGCCACGGGGAGGA	174	66	yes
GATCCCAGTTCATAATGAAC	49	5	yes
GATCCCAGTGTTGCTACGTG	127	27	yes
GATCCCAGTGTGAATCATGG	101	5	yes
GATCCCAGTGGTATTCCGCC	32	22	yes
GATCCCAGTGGATGAAGTGT	50	6	yes
GATCCCAGTGCTGTGGAAGT	39	5	yes
GATCCCAGTGCTGGTCAGTT	139	0	yes
GATCCCAGTGAGATGCTGGT	44	7	yes
GATCCCAGTGAAGGGTTTCT	87	13	yes
GATCCCAGTCTGAGTGATTA	3	2	yes
GATCCCAGTCCTCCTGGGCA	10	5	yes
GATCCCAGTACTTGAGAAAC	86	3	yes
GATCCCAGGTGTCCCCATTT	26	27	yes
GATCCCAGGTGGAGCAACCC	62	18	yes
GATCCCAGGTCCCTCTGGGA	203	18	yes
GATCCCAGGGGTCCTAGGGG	302	28	yes
GATCCCAGGGGCTCTTCTGC	129	17	yes
GATCCCAGGGAAAGTGCTAT	65	10	yes
GATCCCAGGCTCCACCAGCG	26	10	yes
GATCCCAGGCTAGCAAGCAA	71	32	yes
GATCCCAGGCGTCAAGCTCG	41	3	yes
GATCCCAGGCAAGGGATGGT	16	2	yes
GATCCCAGGAGTCAAGCTCT	159	15	yes
GATCCCAGGAGAGAGGCTTC	122	19	yes
GATCCCAGGAAGGACCATCA	2	3	yes
GATCCCAGGAAAGTTCTAAT	26	10	yes
GATCCCAGCTGGAGAAGCCC	59	1	yes
GATCCCAGCTATGATGTAGC	24	0	yes
GATCCCATTTGGGAGGACTT	16	17	yes
GATCCCAGGGCCACAAGGCT	6	9	yes
GATCCTCTTTGACTTCACGT	12	5	yes
GATCACTGTCAAAATACAGG	7	5	yes
GATCACTAATGGGATGGGTT	2	1	yes
GATCCTTTCCTTAAAGGTCT	24	5	yes
GATCTCTGTCTTTCCCTGGT	129	33	yes
GATCTCTGTCATCCCCCACG	26	25	yes
GATCTCTGTCACATCCGATG	212	77	yes
GATCTCTGTAAACAGTTTGG	25	19	yes
GATCTCTGGCCTGTGGAGTA	157	52	yes
GATCTCTGGATGGAAATGTA	36	28	yes
GATCTCTGGAGCCTGAATTC	13	10	yes
GATCTCTGGAAGGTGAGCCT	28	22	yes
GATCTCTGCTGTGGGAAAGG	151	6	yes
GATCTCTGCTGTCGGTTTCT	20	3	yes
GATCTCTGCCACCCACCCAC	111	13	yes
GATCCGAGTGTCCCCTCTGC	32	8	yes
GATCTCTGCAAGCAGTTGTC	4	3	yes
GATCTCTGCAAAATAGACTT	57	2	yes
GATCCTAACCCTGTCATGAC	20	7	yes
GATCAAAAGGTAAAGGCCAG	15	11	yes
GATCTCTCTTCCCAGAGGAA	659	38	yes
GATCTCTCTGGAACTGTAAG	26	20	yes
GATCTCTCTGCTCATACCCT	148	1	yes
GATCTCTCTCCTTGGCCTTC	16	1	yes
GATCTGTCCTCTCTGCTGAA	122	1	yes
GATCTCTCGGATGTAAATGT	36	11	yes
GATCTCTCGAGCAGCAGCAG	15	12	yes
GATCTCTCCCGTTCTCAGCA	2	1	yes
GATCTCTCCCCAGAGCAACG	74	57	yes
GATCTCTCCATATCAAGCGA	1144	195	yes
GATCTCTCCATATCAAGCAA	20	29	yes
GATCTCTCAGTTGAATACAT	5	3	yes
GATCTCTCACTGGACCAGCG	26	20	yes
GATCTCTATGTACAAGTGGA	15	12	yes
GATCTCTATCCTAACGTCCA	71	4	yes
GATCCCAGTGGCATCATCGG	7	6	yes
GATCTGCTCAGCTCTGGCTG	1	1	yes
GATCAAGATAACGGTGGCTT	5	4	yes
GATCTGCCAAGATGAATAGG	16	13	yes
GATCTCTACTTTGGAGTCCT	3	2	yes
GATCTCTACTGGCAGGCCAT	210	51	yes
GATCTCTACTGCTGTTAGGT	34	26	yes
GATCTCTACTCCCAGGAGAT	4	3	yes
GATCTCTACCCAACTGTCCA	16	3	yes
GATCACGATTAAGAAACAGA	13899	1179	yes
GATCTCTACCACCCAGGTAG	144	28	yes
GATCTCTACAGACAAAATCT	41	5	yes
GATCTCGTTCATTGGCAAAA	47	14	yes
GATCTCGTGCAACTGTTGTC	80	7	yes
GATCTCGGTTTCGTTTCGCT	14	13	yes
GATCTCGGTGTCATCAGAGG	4	3	yes
GATCTCGGTCTGTGCCGGGG	230	108	yes
GATCTCGGCCTCACAAATCC	54	11	yes
GATCTCCTTTGTGAATGGTG	1	1	yes
GATCTCCTTTCCGGAAGCAA	22	11	yes
GATCTCCTGTTGTCTGGGCT	10	8	yes
GATCTCCTGTCTATGTGGGC	166	83	yes
GATCCCTTCAGACACACCAG	1	1	yes
GATCTCCTCGCTGGAAAAAG	51	49	yes
GATCTCCTCCTTATTCCCCA	138	39	yes
GATCTCCTCAGAGAAGTCTG	4	4	yes
GATCGGGCCTGAAACCTTGG	15	11	yes
GATCGCAGAGAGGCGAGAGC	99	34	yes
GATCCTTGTGTATGCCTTCC	16	5	yes
GATCTCCCTGAGTTCGAGGC	538	252	yes
GATCTCCCCTTTGTAGGACT	2	3	yes
GATCTCCATTCTGGAGCTGA	1	1	yes
GATCCTTTCAACTCAAAAGC	22	11	yes
GATCCTTGGTTCATCAGGTA	6	1	yes
GATCTTATTGCCAAGTTCCT	11	2	yes
GATCTTAGAGAAGGAGACAG	21	16	yes
GATCTTAGAGAAAGGCCAAC	134	49	yes
GATCTTAGACAGGCGATGTG	44	4	yes
GATCGCAGCACTGAAAACAA	173	30	yes
GATCTCCAGTCCAAGGCTTC	26	25	yes
GATCTCCAGCTTCTCTGCCT	14120	2	yes
GATCTCCAGAGTCGCTTGGA	9	8	yes
GATCTCCACTTTCTACAACA	83	9	yes
GATCTCCACTCTCCCTCTGG	30	1	yes
GATCTCCACGGGTGCTTAGT	63	6	yes
GATCTCCACAGGCCAGCCTT	9	8	yes
GATCTCCACAGCGTGTTCAT	156	11	yes
GATCTCATTTTAACATCCAC	3	2	yes
GATCACAGCCAGTTCAAAGC	469	23	yes
GATCACAGCAGTAAATGTGA	222	0	yes
GATCACAGCAGCTGAGCTGT	10	8	yes
GATCACAGATTTAAGGGGAG	35	34	yes
GATCACAGATTGCTTCTCTG	18	14	yes
GATCACAGAGTGGTTACTGG	77	11	yes
GATCACAGAGAACACAGAGG	41	15	yes
GATCACAGACTTCGGCCTTG	40	11	yes
GATCACAGACTGTTGGCCCC	78	16	yes
GATCACAGACACCTGCACTG	27	21	yes
GATCACAGACAAGAAATACC	11	8	yes
GATCACAGAAGTGAGCGGAT	88	28	yes
GATCCTTCTGACTTGGCTTT	2	3	yes
GATCCTTCTCAGAAGAGTCT	5	3	yes
GATCACACTTCCCACAACCC	163	11	yes
GATCACAGGGAGCCTGTGTT	17	5	yes
GATCTTACCCGGGACAAAAT	8	6	yes
GATCAGCCCTGAGATTGCTG	55	8	yes
GATCTTAAATGGCGTAGTAT	55	30	yes
GATCACAGCAGAGATGGCCA	232	33	yes
GATCTCATTCCGGATGAAGC	36	1	yes
GATCTCATTCCCGAGAGAGG	49	34	yes
GATCTCATGTGTGGGAACCA	63	7	yes
GATCTCATGTCTCTGGAGGA	116	17	yes
GATCCCCTTGGGCCCAACTG	41	3	yes
GATCTCATCCAGTCTGCTGT	10	0	yes
GATCTCAGTTTTCATCAAGT	15	3	yes
GATCTCAGTTTGAGTGGATG	68	6	yes
GATCTCAGTTTCGCTGATGT	37	29	yes
GATCTCAGTTCACGGGGTGG	259	8	yes
GATCTCAGTTCAACAGCTCC	119	74	yes
GATCTCAGTGTGGAGAGCAT	5	3	yes
GATCTCAGTGGGGGTGGGAG	162	8	yes
GATCTGCAAACATGATGAAT	4	3	yes
GATCACACTGATGGAGCTGT	19	8	yes
GATCACACTGAGCAACACCC	1	1	yes
GATCACACGGCAAAACAGTA	105	14	yes
GATCACACCTTGCTGTTCCC	5	3	yes
GATCACACCTGTCCCTACAC	474	5	yes
GATCACACCTGCCCCAGTGG	2	1	yes
GATCACACCTGCAGTTTGGG	280	14	yes
GATCACACCGTTTCTTCCTA	44	2	yes
GATCACACCGAGACCAGTGG	31	24	yes
GATCACACCATTGAGTTCCG	1	1	yes
GATCACACCAGTCCTGTGAG	65	17	yes
GATCACACCAAGCCCCAGGA	40	13	yes
GATCACACATTTGCAAGGGA	49	2	yes
GATCACACAGAGCTGAGGGC	3	2	yes
GATCACACACTCAGTCCTTG	127	37	yes
GATCACACACGGCAACCGAC	82	21	yes
GATCACACAAGTGTGGGTTT	177	15	yes
GATCACACAAAACTGTCAGC	5	4	yes
GATCACAATCTAGTCAATGC	5	3	yes
GATCACAATCAGGAACTCAC	139	12	yes
GATCACAAGTTTGAGACCAG	49	5	yes
GATCACAAGTTAAGGTCAGC	5	3	yes
GATCACAAGTGCAGCATTCT	122	28	yes
GATCACAAGGTTTACATCTG	13	10	yes
GATCCTTCATGTTGAGCCAG	128	13	yes
GATCACAAGCTTGGGGCAAC	146	14	yes
GATCTGTTGTGCTTGAATGA	55	20	yes
GATCTGTTGGTGGTATAGGC	1	1	yes
GATCCTTGACTCTCAAGCCC	83	32	yes
GATCCTTCTGTCGGCTTCCT	158	4	yes
GATCCTTCTGTCCTGGATTT	50	7	yes
GATCTGTTACTTTGGCGAGG	108	14	yes
GATCTGTGTTGCAGACTCCT	4	3	yes
GATCTGTGTGTCATCAGATG	36	28	yes
GATCCTTCTCTGCCCTTCCC	61	21	yes
GATCTGTGTGGGACCAAGGC	261	100	yes
GATCTGTGTGGATGTCCTGA	20	15	yes
GATCCTTCCTTTCCCTTGGC	19	3	yes
GATCCTTCCTTCTTCTCTTC	57	4	yes
GATCTCAGTAACTGTCGAGC	234	11	yes
GATCTCAGCTTGCATAGCAT	759	24	yes
GATCTCAGCTCCACTGTGAA	4	3	yes
GATCTCAGCTATTCACAGAG	1	1	yes
GATCTCAGCCCCTACTCCCA	29	22	yes
GATCTCAGCACTGTGGCTGT	161	3	yes
GATCGCTCTCGCCCACCGCC	68	22	yes
GATCTCACTGTTTCATGCTG	45	24	yes
GATCTCACTGCCTCCCTCTC	47	6	yes
GATCTCACTCAGCAACAAGT	61	1	yes
GATCTCACGGGCCGACCGAG	51	31	yes
GATCACAAGAGGCCCGTTTG	126	14	yes
GATCACAAGAAGTTAGTTTG	15	4	yes
GATCGGGGGGATGACCAGCT	90	25	yes
GATCACAACTGTAGGGAATA	397	30	yes
GATCACAACTGATTCCTGCT	4	3	yes
GATCACAACGGCTTGCGTGT	97	30	yes
GATCACAACCCTGATGGCAG	473	109	yes
GATCACAACCCCCAAGTCAG	60	14	yes
GATCCTGTTTGTTGCACACA	24	2	yes
GATCACAAATACAGATTCTG	40	31	yes
GATCACAAAGTTTGAGAATG	1552	275	yes
GATCACAAAGGTGGAATGTT	3	2	yes
GATCACAAACTTCTGCAAAA	42	2	yes
GATCCTGTGCCTGGCCTTTG	52	2	yes
GATCAATGGGCAGCAGCAAT	22	17	yes
GATCACAAAAACTGAAGGTG	14	10	yes
GATCTGTGTCCCAGCGAAGC	18	14	yes
GATCTGTGTATACCCCACTC	15	6	yes
GATCATACCCATCTTACCAT	4	4	yes
GATCTGTGGACGACGAGAAC	49	6	yes
GATCTGTGCCATCCCATACA	493	3	yes
GATCCTGTCTCCCGTGGACA	5	0	yes
GATCTCACCGTGAGGCCCCG	36	27	yes
GATCTCAATGAAGTAGCTAA	2	1	yes
GATCTCAACTGACTCCTCTT	131	12	yes
GATCTCAACCTGGTGTTCAC	1	1	yes
GATCTCAAACTCAGAGGTTT	36	9	yes
GATCTATTTTCCTAACCGTT	4	3	yes
GATCAATGCAATGACGTGGG	146	81	yes
GATCAATGCAAAAATCACCG	13	10	yes
GATCAATGATGAGGACAAAC	1211	96	yes
GATCAATGAGGCCTTTGCAA	42	32	yes
GATCAATGACAACCAGAAAG	5	4	yes
GATCCTGGTAGGAGCACTTG	50	20	yes
GATCCTGGGTACTGCACAGT	1889	345	yes
GATCCTGGGGGTGGACTGCA	73	6	yes
GATCAATCCAGGAGTCTCTG	141	10	yes
GATCTCGACCTCTGGCTGCT	5	4	yes
GATCCTGGGAGAGTACTGCA	27	11	yes
GATCCACAGGTCCACTGACA	24	0	yes
GATCCTGGGGTTGGACCCCA	31	24	yes
GATCCTGGGGCTGGAGAAGT	9	2	yes
GATCTGTCTCAACAGTCTGG	91	34	yes
GATCAACGCATGGGACCTCC	4	3	yes
GATCTATCTCTCCTGGTGGC	3	0	yes
GATCAATATCACCCAAACCT	21	16	yes
GATCTTCCAAACTTCAGCAA	49	14	yes
GATCGATGGATTTTGGTTAA	15	5	yes
GATCAATAAACCGTTTTGAT	37	29	yes
GATCAAGTTTTGGCTCTTGG	10	10	yes
GATCAAGTTTTCAACACCCC	64	25	yes
GATCAAGTTTGTGGTGTGTT	66	4	yes
GATCAAGTTTGGTGTTTCCT	23	17	yes
GATCAAGTTTCAGGAAGGCT	29	14	yes
GATCAAGTTTCACATCCTTC	29	8	yes
GATCCTGCATATCTCAAAGA	14	2	yes
GATCCTGCATACCAACGGCC	286	29	yes
GATCCTGCAGCAGGAGTGCA	53	6	yes
GATCTGTCCTGATGAAGGCT	186	26	yes
GATCCTGGAATCCAGGAGTG	4	4	yes
GATCTGTCCATCTTGGAGTT	7	2	yes
GATCTGTCATGTCGGAAAGC	148	4	yes
GATCTGTCAGTGTTATGGAA	3	2	yes
GATCTGTCAGCTCGCCAAGG	37	21	yes
GATCCTGCTCAGACCATACC	4	4	yes
GATCCTGCCAGCCAGACCAA	32	11	yes
GATCCTGCAGACACTCAGAG	17	13	yes
GATCTGTAGCAACCTGACAG	21	16	yes
GATCAAGTTGGGAATGAGGG	298	8	yes
GATCAAGTTGCCAGCATTTG	7	6	yes
GATCAAGTTGAAAGAGTGTG	129	1	yes
GATCAAGTTCCTTTCAAATG	3	2	yes
GATCAAGTTCAGTGCGCAGG	17	13	yes
GATCAAGTTATGTGTGGTTT	5	4	yes
GATCAAGTGTTTGCAGGACG	72	5	yes
GATCAAGTGTGACCCAGAAA	1	1	yes
GATCAAGTGTCGGATGGAAT	1109	71	yes
GATCAAGTGTAAATGTGCTG	57	23	yes
GATCAAGTGGATTCGGCGGT	179	25	yes
GATCAAGTGCTTTGCCAAGT	4	3	yes
GATCAAGTGAGCTGTATCAG	21	16	yes
GATCAAGTCTTGTCAGTTTG	80	27	yes
GATCCTGAGTGGCTTGCTAG	47	18	yes
GATCAAGTCGTGCTTCTGGC	5604	731	yes
GATCAAGTCCTTTGTGAAAG	560	103	yes
GATCCTGAGGGCTGCATACC	70	12	yes
GATCCTGAGGAGTCAAATAT	4	3	yes
GATCAAGGTTTCCATTTTGA	3	2	yes
GATCCTGAGAGCATCTTCGA	1	1	yes
GATCAAGGTGTTGCCTGGTG	62	20	yes
GATCAAGGTCCAGGTGGAAG	117	3	yes
GATCTGTACCTGCGGCTCCA	32	2	yes
GATCCTGAATGGGCAAGAGT	110	34	yes
GATCTGGTTCCTGAGCCCAT	170	209	yes
GATCCTGCCCTGTTCCTGGC	1	1	yes
GATCCTGAAGCTCTGGCTGA	35	12	yes
GATCTGGTGTACAGAGAGTT	1	1	yes
GATCTGGTGGGGTTACTGGG	7	6	yes
GATCTGGTGCTGATAGGAAG	70	10	yes
GATCTGGTCACTGGTCAGAG	6	6	yes
GATCTGGTATGAACATCGGC	164	22	yes
GATCTGGGTTTGTCAACAGG	13	10	yes
GATCAAGGTCCACTTAGTGG	56	43	yes
GATCAAGGGTTCCCTTCCAA	38	29	yes
GATCAAGGCTTTCCTCGGGC	9	8	yes
GATCAAGGCTCCCGGTTTTG	850	42	yes
GATCAAGGCCTTTCTGTCCT	1202	9	yes
GATCAAGGCCCACTGTGGAG	14	13	yes
GATCAAGGCCACTGTGTAAC	5	6	yes
GATCCTGAAAGACCGGGAAA	6	5	yes
GATCAAGGCAAAAGGAGGAT	29	0	yes
GATCAAGGATTGAAGGAATG	1	1	yes
GATCAAAGCAGCGAGACCAA	27	1	yes
GATCAAGGAGGCTGTTGCTG	46	26	yes
GATCAAGGAGGAAGTGTTGT	5	4	yes
GATCAAGGAGAGAAGCAGGA	23	7	yes
GATCCTCTGGCAGATGTTTG	119	21	yes
GATCAAGCTTAGCAGTCAAG	61	6	yes
GATCAAGCGGGCTTTCCTTA	417	31	yes
GATCAAGCCTGTTAGCCCTG	22	17	yes
GATCCCTTTGGTGCCCCTGA	60	12	yes
GATCTGGGCTGAGCTTGGTT	11	1	yes
GATCTGGGCAGTTGTTTTGC	71	1	yes
GATCTGGGCACCGAGGCTGG	224	38	yes
GATCTGGGATAAGGAGAGCG	53	29	yes
GATCAAGCCCTTCTTCCATT	2382	312	yes
GATCAAGCCATCCATCAACT	311	39	yes
GATCAAGCATCATGATGCTC	46	35	yes
GATCAAGCAGTTTCTGGAGT	88	18	yes
GATCAAGCAGTAGAGTTTTT	34	0	yes
GATCAAGCAGCGTCTCTTTG	11	8	yes
GATCAAGCAGCGAGAGGCTG	408	40	yes
GATCAAGCAGCAGCACGGGG	191	106	yes
GATCAAGCAGAACCTGGAGA	86	29	yes
GATCAAGAGTTTATTGCATT	14	2	yes
GATCCTCCTGCACCATGCCT	10	8	yes
GATCCTCCTCACTTAGCACC	34	18	yes
GATCAAGACTGTGACTTTTG	24	10	yes
GATCAAGACTCTCCTGGAGA	159	17	yes
GATCAAGACGCCTGTCATTT	34	12	yes
GATCAAGACCCTCCAGAGGT	30	29	yes
GATCAAGACCACCACTGCAT	62	9	yes
GATCAAGACAGCTTGTTGGT	58	41	yes
GATCCTCCCAAAAGCCATCT	58	11	yes
GATCAAGACAACCAAGGCTA	36	3	yes
GATCCTCCAGCTCCATCAGC	8	6	yes
GATCCTCAGGACGAGTCACA	2	2	yes
GATCCTCAGCCACTGCTACG	98	2	yes
GATCCTCACCCACCTGCTGG	224	18	yes
GATCTGGGAAGACTTCTCTA	15	12	yes
GATCTGGGAAACAGCATTGC	9	7	yes
GATCTGGCTTTTGTTTTCCA	11	8	yes
GATCTGGCTGGTCCAGTACA	11	12	yes
GATCTGGCTAGAATTGCAAA	5	3	yes
GATCTGGCGTTTGCGCTGGA	6	3	yes
GATCTGGCCTGAGCCTGTCC	15	12	yes
GATCTGGCCGGTATCCCCAA	9	9	yes
GATCTGGCCCTTTTGTCCTT	51	13	yes
GATCCTGGTTTGGATAAACC	1	1	yes
GATCAACTTGCTGGGACCTA	4	4	yes
GATCAACTGTGCAGACAACA	2944	159	yes
GATCAACTCTTTGTTTTGGC	34	33	yes
GATCAACTCTTGGCTTTGAC	28	22	yes
GATCAACTCGGTGATGGCAA	64	25	yes
GATCAACTCCCACGCAGGGC	1	1	yes
GATCAACTACTTTGGATGCT	1	1	yes
GATCAACGGAGGACTATCAT	27	11	yes
GATCAGGATGTGTGCATGCT	6	3	yes
GATCCTGCTGTGTGAGCCCT	7	4	yes
GATCTGGCCAACACAAGAAC	54	1	yes
GATCTGGCAGATGTGAGGTT	15	3	yes
GATCTGGCACTACTGCCGAG	54	5	yes
GATCTGTGTAATGGGCAAGG	13	10	yes
GATCTGGATTGTGGAGCCAA	31	24	yes
GATCTGGAGGTGGAAGTGGT	56	7	yes
GATCTCCTTTGCCCATGTTT	13	10	yes
GATCAACCTGAACTTGGGAC	1	1	yes
GATCAACCTCCTGGGCTTCA	23	11	yes
GATCAACCACTGCAAATTCG	7	6	yes
GATCAACCACTGACCTGCCT	34	2	yes
GATCAACATGTTCGTGATGT	8	6	yes
GATCAACATGAACTGAGATT	15	1	yes
GATCAACAGTGAGGCAAGCA	53	25	yes
GATCAACAGTAGTTGTCTTT	2	1	yes
GATCAGAGACCGAAGCTGGC	20	15	yes
GATCCCCGGCGGGTGCTGTA	5	5	yes
GATCAGAATGACTGGATTGA	45	64	yes
GATCCCCAGAAACTGAGTGT	10	2	yes
GATCCCACTCTGCAACTACT	87	4	yes
GATCAGCTCCAACTATGGTG	5	3	yes
GATCCTGCGGGAGGCCTATG	23	17	yes
GATCGGCTCTTCCCACCTAC	29	2	yes
GATCGGACACACAAATGTTG	3	2	yes
GATCTCCCCGTCACAGAACC	68	16	yes
GATCTTGAGAAAACTACTCT	2	1	yes
GATCAGTGAATGGGTCAAGA	19	7	yes
GATCAGTGAATAAAACCATC	6	5	yes
GATCCAGGCTCCTGGCCCAC	25	3	yes
GATCAGTCCTTCCCTCGAGA	63	12	yes
GATCCAGGAGGCTCTGCACG	309	23	yes
GATCCAGGACCACAAGCCAG	24	5	yes
GATCAGTTTCAAGAAGCGTG	5	0	yes
GATCCAGGCTGGAGTCCGAG	25	11	yes
GATCCCAGCATCGGCAAGCG	97	6	yes
GATCCCAGCAGTTCCAACAC	37	9	yes
GATCCCAGCAGCTGTTACCT	156	36	yes
GATCCCAGCACACACCGTGA	52	1	yes
GATCCCAGATGATACCCACT	37	4	yes
GATCCCAGAGGAAAGGGTTT	7	0	yes
GATCCCAGAGACAATCTCAT	290	42	yes
GATCCCAGAGAAGTGGGGCC	6	5	yes
GATCCCAGACGCCTCAAATG	19	7	yes
GATCCCAGAATGAACAGAAC	27	13	yes
GATCCCAGAAGCCGCACAGG	5	5	yes
GATCCCAGAAGCACACTGGC	230	48	yes
GATCCCACTTCACCTGTTAT	60	12	yes
GATCCCACTGCTCATTTGAC	24	18	yes
GATCCCACGGTAGAACCTGA	46	11	yes
GATCCCACGAGCCAGAGAAC	148	17	yes
GATCCAGGAAAAAGTGTTTC	15	7	yes
GATCCTAGCGGACCTCAACC	84	0	yes
GATCAGTAGACTGGGCGTGG	12	9	yes
GATCAGTAGACCATAGTGTG	4	3	yes
GATCTGTCTGTAGCGGTCAA	1	1	yes
GATCAGGTTTCTTCTTTTCC	26	10	yes
GATCTGTCCAGGGGACATTA	99	14	yes
GATCCCACCTGTCACCCCAT	81	4	yes
GATCCCACCTCACGTGTGAT	86	19	yes
GATCCCACCGCAGCTACCAG	147	30	yes
GATCCCACCCCGAGCCTGGT	25	26	yes
GATCCCACCCCAGTAGGAAG	5	5	yes
GATCCCACCATTCTCCTTGG	46	6	yes
GATCCCACCATCCTACCTAC	9	4	yes
GATCCCACAGTTCAGAAATA	20	11	yes
GATCCCACAGTGTGACTGAT	35	6	yes
GATCCCACAGGCCGGTGGAG	78	29	yes
GATCCCACAGCCAGGCTCAC	690	146	yes
GATCCCACAGATGTAGTTTG	1	1	yes
GATCCCACACTTAAGACTTC	112	29	yes
GATCAGGTGGATGTGCAGGA	21	11	yes
GATCCAGCAGGTGACACTGA	2	2	yes
GATCAGGTCCTAAACATGGC	202	21	yes
GATCCAGCAGCCGAGACTGA	18	2	yes
GATCCCACACAGCAGACAGA	3	4	yes
GATCCCAATTGGTGGAAAGG	96	19	yes
GATCCCAATTCTGTCCCAAT	161	24	yes
GATCCCAATGGTCACACACC	5	5	yes
GATCCCAATGCTGCCCCATC	62	5	yes
GATCCCAATGAGCCCACCTA	15	4	yes
GATCCCAAGTGCTGGGAAAG	51	15	yes
GATCCCAAGTCCAACACCCA	55	17	yes
GATCCCAAGCCTCACCGGCT	123	7	yes
GATCCCAAGCCAAGAAACAC	7	3	yes
GATCCCAAGAGGAAGGGTAT	2	3	yes
GATCCCAAGAAACTACTTGA	57	12	yes
GATCCCAACTGTCAGTGCCA	228	1	yes
GATCCCAACTGTAACAGCAA	4	4	yes
GATCCCAACTCTGCAAGAGC	7	3	yes
GATCCCAACGTGACCATCAT	202	24	yes
GATCCCAACATTGTTGGCAA	21	6	yes
GATCCCAACACAGCGATATG	244	18	yes
GATCCCAAATCTGTGGTGTG	157	13	yes
GATCCCAAAGGCTCCAGGGT	8	12	yes
GATCTGGTTTCAGGTTTCTT	2	3	yes
GATCTCATCCAAGCAAATGG	7	6	yes
GATCAGGGCTCCAGTGGTCC	79	17	yes
GATCAGGGCCTGGACTCTGG	31	30	yes
GATCAGGGCAATGGTCACGG	15	15	yes
GATCCCAAACTGAGGCAGCA	188	12	yes
GATCCCAAACAGCTAATATG	5	5	yes
GATCCCAAACAACTAAGAAT	12	1	yes
GATCCCAAAATGCTGCGGAG	151	6	yes
GATCCCAAAATAGGTGTTGA	5	5	yes
GATCCCAAAAGGGACATTGT	62	0	yes
GATCCCAAAAACCGTGCAGC	30	1	yes
GATCCCAAAAAATCTGTGCC	60	7	yes
GATCCATTTGCTTACACTGT	34	5	yes
GATCCATTTGATGCTTCCAG	10	2	yes
GATCCATTTCTTCTGCATGA	68	9	yes
GATCCATTGTGTGGTTTAAC	36	10	yes
GATCCATTGGTTTCTCAGTC	393	17	yes
GATCCATTGAGACGTATGAA	2	3	yes
GATCCATCTTTTTCTTTGGA	1	1	yes
GATCCATCTTCAGCTGACTG	10	10	yes
GATCCATCTTCAAACCTCAA	24	18	yes
GATCCATCTCTTTCCTTCTG	2	2	yes
GATCCATCTCCTCTGGCTCT	281	19	yes
GATCTGGGTGGCCAGTACTT	126	97	yes
GATCCAGAATGTCAGCTGGA	67	5	yes
GATCCAGAAGGGTCTCTCTC	123	13	yes
GATCAGGCCGGGGCGGCAGG	609	51	yes
GATCAGGCCCTAAAGCATTG	33	9	yes
GATCCAGAACAACGATGGGC	20	1	yes
GATCCATCGACTGTGATAGG	40	4	yes
GATCCATCCTATCCATCCGT	3	0	yes
GATCCATCCCCGGCAAAGAG	71	4	yes
GATCCATCCCAGAGGGACTG	286	22	yes
GATCCATCCAGCATTTATGT	19	13	yes
GATCCATCCAATGGCTTACC	88	1	yes
GATCCATCACAAGGCAAAAC	45	11	yes
GATCAGGAGCAGGCAACACC	207	103	yes
GATCCACTCACAGCACCTCC	15	1	yes
GATCCATACAGCATTTTGCG	27	2	yes
GATCCATACAATTTGTGCCA	668	6	yes
GATCCATAAGTTTGCCCAGT	46	0	yes
GATCCAGTTTTGGGAAAGGA	228	1	yes
GATCCAGTTTCTGACTCGGG	88	4	yes
GATCCAGTTTCATTCTCTAA	29	10	yes
GATCCAGTTGTTTGAAGATT	7	5	yes
GATCCAGTTGTGCAGTAGAG	17	1	yes
GATCCAGTTGGAGAGATTTG	15	1	yes
GATCCAGTTGCTCTAAGTTT	5	5	yes
GATCCAGTTCTGCTCAACTA	92	8	yes
GATCCAGTTCTACGAGCGGC	891	35	yes
GATCCAGTTCTAAAACTTGT	185	32	yes
GATCCAGTTACCAGAAGATG	57	4	yes
GATCCAGTGTGTTGCTGGCA	54	4	yes
GATCCAGTGTGCTGGTCTTT	329	100	yes
GATCCAGTGGCAGCCTCAGC	265	12	yes
GATCCAGTGCCTCATTGTTG	7	2	yes
GATCAGGAACCCCCTCCAGA	28	22	yes
GATCCAGTGAGAGCCAGACA	195	7	yes
GATCCAGTGACGTCAGACGC	82	15	yes
GATCCAGTCTTTAAAGAAGC	136	11	yes
GATCCAGTCTGTCCTAGATG	1283	34	yes
GATCCAGTCCTGGAGGACAG	585	7	yes
GATCCAGTCCATTCAGCAGT	14	1	yes
GATCCAGTCAGGAGTACTCA	5	5	yes
GATCCAGTCAGGACATATGA	4	3	yes
GATCCAGTCAGCCCCTGGGG	248	35	yes
GATCCAGTACTTGGTTTGTG	73	1	yes
GATCCAGTACTACCAGAATG	6	6	yes
GATCCAGGTTCACCACCGGG	37	9	yes
GATCCAGGTTCAATTTCCAG	133	8	yes
GATCCAGGTGTGCTGAGTGG	105	6	yes
GATCCAGGTCCGTGAACCCC	71	21	yes
GATCCAGGGTGTGCAGTGGG	601	28	yes
GATCCAGGGTGCCCCTCCAA	7	2	yes
GATCCAGGGTCCTCTGCCTG	107	6	yes
GATCCAGGGGGGACACCTGC	39	8	yes
GATCCAGGGCTCAGGAGCAC	76	1	yes
GATCCAGGGCGATGTTGGGG	212	5	yes
GATCAAAGTATGACCACTAG	26	20	yes
GATCCAGGGCCTGGTGGAGG	484	23	yes
GATCCAGGGCCTCTGCGCCT	111	3	yes
GATCAGCGGCCGAATGTCCC	20	19	yes
GATCAGCGCAATGCAAAGCA	1	1	yes
GATCTGGCACTGCTTTAGCC	35	5	yes
GATCCACCACAGCAGGCAGG	11	16	yes
GATCAGCCTCTTCCTTTTGT	4	5	yes
GATCAGCCTCAGTCTTCAGG	144	12	yes
GATCAGCCGGGGCTTTGAGG	180	23	yes
GATCTTTGCGAATTACAATG	37	4	yes
GATCTTTGCCTCTCTGTAGA	6	5	yes
GATCCAGGGAATCAAGGAAT	4	1	yes
GATCCAGGCTCTGATGTTTC	21	6	yes
GATCCAGGCTCGGGAGCTAA	5	5	yes
GATCCAGGCTCACAGTGTGA	75	10	yes
GATCCAGGCTAAAATCCCCG	161	24	yes
GATCCAGGCGGCCCTGCCAG	90	4	yes
GATCCAGGCGGCCAAGAACT	629	65	yes
GATCCAGGCGGAGGATGACG	7	3	yes
GATCCAGGCCTCCCTTCTTG	12	0	yes
GATCCAGGCCTACTTCGCGT	123	17	yes
GATCCAGGCAGAGCTCTTCA	5	0	yes
GATCCAGGAGTTCAAAGAGG	3077	233	yes
GATCCAGGAGCAGGAGCTGC	59	2	yes
GATCCAGGAGCACGTGAAGA	136	22	yes
GATCCAGGACTTCTTCATCC	21	6	yes
GATCCAGGACCTGGAAGTAT	24	3	yes
GATCCAGGACCATCCTCTCA	73	19	yes
GATCCAGGAAAGCAGCCTGT	235	3	yes
GATCCAGCTGGGTGAGGGAT	7	7	yes
GATCCAGCTGGGCGAGGATG	232	25	yes
GATCCAGCTGGGCAAAATTC	31	5	yes
GATCCAGCTCCTAAACTGTT	4	4	yes
GATCCAGCTCAGGCGGTGTC	26	10	yes
GATCCAGCGCTCTCGGGACT	132	19	yes
GATCCAGCGAGAAAGAAGAA	195	12	yes
GATCCAGCCTTCCTTAGGCC	39	12	yes
GATCAGCATGGGGCTCTTCT	3	2	yes
GATCCAGCCTGAGCTCAGTG	32	11	yes
GATCCAGCCTGACCTGCACA	222	40	yes
GATCCAGCCCCTTTGTCACC	146	51	yes
GATCCAGCCAGTCTCTCATT	67	5	yes
GATCCAGCAGTTAAAGCAGT	56	9	yes
GATCCAGCAGAGAGGGCAGG	144	25	yes
GATCCAGCACCGTGTGTACC	258	5	yes
GATCCAGCAAACTTGGTTGG	101	35	yes
GATCCAGATTTCCAGCCGGA	2	0	yes
GATCCAGATGGCCTCAAACT	2	3	yes
GATCCAGATGATGGTTCTTT	138	2	yes
GATCCAGATACAACGCTCAC	12	5	yes
GATCCAGAGTGGCACAGGGT	321	26	yes
GATCCAGAGTGGAACTGTCC	56	17	yes
GATCCAGAGGTGCTGGGCAT	15	5	yes
GATCCAGAGGGGGTGCCTTT	4	3	yes
GATCCAGAGCTTCTGCAAGG	70	15	yes
GATCAGCAGATGCAAAAGAT	4	3	yes
GATCCAATGCTGACCTGGCT	36	0	yes
GATCCAATCCTCCTGCCTTC	49	28	yes
GATCCAGAGCTGGGCTCAGG	4	4	yes
GATCCAGAGAGATGGGTCAG	7	5	yes
GATCCAGAGAGACTTGGTTG	11	4	yes
GATCCAGAGAACTCAGCTGT	116	3	yes
GATCCAGAGAAAGCAAAGGC	7	7	yes
GATCCAGACGAATCTTGTCA	5	0	yes
GATCCAGACCTGCCACAGAC	21	0	yes
GATCCAGACCCGGGAAGGGA	255	15	yes
GATCCAGAATTGCTTTCCCA	16	3	yes
GATCCAGAAGTTGGGAAAAC	102	2	yes
GATCCAGAAGCAGTGGAATC	3852	11	yes
GATCCAGAAGAACCTACCAC	3	0	yes
GATCCAGAACGACCTGAACC	1	1	yes
GATCCAGAACCTCTCAGCCA	86	9	yes
GATCCAGAACATTCTAGAAA	21	0	yes
GATCCAGAACAGTACAGCGT	239	38	yes
GATCCAGAACACATTAACCT	21	22	yes
GATCCAGAAAGAACGATTTG	2	1	yes
GATCCACTTGGGCTCTGTCA	278	36	yes
GATCCACTTGCTGCCTGAGA	378	12	yes
GATCGCCACCTACCGCCGCC	2602	987	yes
GATCCTGGGGCCTGGGTGGG	6	9	yes
GATCAAGGCTGCCCAATACC	8	6	yes
GATCAAGAGCACCTGGATAA	1	1	yes
GATCTTGTGTTTTGCTATCC	5	4	yes
GATCTACGCTTCCAGAGTGC	2	2	yes
GATCGCCACCTACCGCAAGC	133	102	yes
GATCAAGTTTGCCGTCCATG	5	3	yes
GATCTTGCTGTTGTGGATGT	29	13	yes
GATCAACACTACGGTGCCAG	4	5	yes
GATCAAATTCCCACTGCCCG	79	17	yes
GATCACCTTCAAGGTCAACA	3	2	yes
GATCCGTGCTTCCTGCACCC	3	0	yes
GATCACAGTGACCCGACAGC	2	1	yes
GATCCCAACTCATGATGCGC	5	3	yes
GATCCCAAACATTACAAGCC	3	2	yes
GATCGACTTGGATTACAGAA	20	5	yes
GATCCTCAACGAGGATGGCA	30	3	yes
GATCCTATGTTGCTGGAGCT	48	7	yes
GATCCTAGTGGGTCTACCAG	12	1	yes
GATCCTAGTGCTGCTCTGGC	191	24	yes
GATCCTAGGTGTCTTCTGTT	2	3	yes
GATCTGAATGTGCCGTCTCT	6	5	yes
GATCCTACTGGGGAAGGCCA	12	13	yes
GATCCTACCGCCTTTAACAA	45	12	yes
GATCCTACAGAAGGCCCACT	36	8	yes
GATCTGGAGCTCCTGGGATG	957	109	yes
GATCTGGAGCCCACAGACCA	33	25	yes
GATCTGGAGAAGCGACGTAT	612	135	yes
GATCTGGACTTCTGAATCTG	4	3	yes
GATCTGGACTGTCCATGTAC	9	7	yes
GATCTGGACTGTAGGGAGAG	10	3	yes
GATCTGGACCTCACCTCTGA	133	50	yes
GATCCACTTGTGCATGTAGT	10	8	yes
GATCTGGAAGTTGGCAGATG	158	18	yes
GATCTGGAAGTAAGCAAATG	15	12	yes
GATCAACAAATCTCCTAGGC	47639	1360	yes
GATCAAATTGGTCTTCACCT	2	1	yes
GATCAAATGTGCCATAGCAC	44	13	yes
GATCCGTGTCCCTGCGTGCA	519	139	yes
GATCCGTGGGCCTGGCCTCC	316	112	yes
GATCAAATGAGAACACTGCT	9	7	yes
GATCTGGAAGAGACTTTGGC	929	639	yes
GATCTGGAACAGTTTTTGGC	9	7	yes
GATCTGGAAAGCTCTGGGGA	13	2	yes
GATCCGGGTGTTGTGCCTAA	46	3	yes
GATCTGGAAAACGCTGGAGA	7	6	yes
GATCTGCTTGCCAGGCCACT	42	14	yes
GATCAAGAATTTGGTGTGGA	728	134	yes
GATCTGCTGTCCAGAGCAAG	75	11	yes
GATCTGCTGTAGTCATTCTT	7	3	yes
GATCTGCTGCTGGTGCTTGC	62	13	yes
GATCCTAGAATGTTTGTAAG	40	1	yes
GATCAAATCACTGGCAGACA	10	10	yes
GATCAAAGTTGTTTCACTGT	24	2	yes
GATCAAAGTGAGGGAAGCGG	31	18	yes
GATCAAAGTCTCCATAGTTG	129	6	yes
GATCAAAGTCATTGCGGTTA	52	40	yes
GATCCGGGCAGCCCAGGAAA	68	1	yes
GATCAAAGTACTTGTTAGGG	46	10	yes
GATCAAAGGGGCCATTTCTC	36	28	yes
GATCAAAGGCTTCAATCACA	63	12	yes
GATCAAAGGAGACTGGCAGC	37	21	yes
GATCAAAGGAGACAGACAGT	26	20	yes
GATCCGGCCCTACTGTGTGT	88	17	yes
GATCAAAGGAAAGGGGAGGG	952	8	yes
GATCAAAGCTGGCAAGGTAC	425	248	yes
GATCAAAGCCCGGAAAGGCA	2245	366	yes
GATCAAAGCCACGGGGTCAG	86	8	yes
GATCAAAGCCAAGTATCCTG	5	3	yes
GATCAAAGCAGCTGCCTTAC	12	9	yes
GATCAAAGCACGCCTGCATG	9	8	yes
GATCCGCTGTACTCTCCTCC	30	1	yes
GATCCGCGCTGAGGAGCAGC	57	8	yes
GATCTGCTGCAGGACCTGGG	63	7	yes
GATCCGCGAATGCTCGGAGG	998	213	yes
GATCTGCTGAAGGAGAAAGC	61	17	yes
GATCTGCTCTTCAATGTTGT	10	0	yes
GATCTGCTCTCGGGCCTCGC	77	5	yes
GATCTGCTCCCTGTATGTGC	17	3	yes
GATCCGCAGTGGCATGTTCT	541	62	yes
GATCCGCAGCGCCTCTTCTT	318	67	yes
GATCCCTGAGAACAGGGACT	5	5	yes
GATCCGTTGCTGACCTTGCG	6	5	yes
GATCAAAGAGTTCAGCAAGA	32	4	yes
GATCAAACTGAGTCTGAAGG	288	34	yes
GATCAAACTAATCAGGCATC	31	0	yes
GATCAAACCAGCCTGTTTTT	19	3	yes
GATCAAACAGTAAAGGTGTG	70	4	yes
GATCAAACAGCAGCCAAGTG	10	8	yes
GATCCGACTGCAAAATTCAT	4	1	yes
GATCCGAATGGGTCGACTGA	46	18	yes
GATCCCTTTCACACACCTGC	8	2	yes
GATCAAAATGTGGTGCCAGA	708	82	yes
GATCCGTGGTATCAGTGGGA	4	4	yes
GATCCCTGTGCCTAGCTGCT	9	9	yes
GATCTGCCTGAAACCAGGGG	8	6	yes
GATCTGCCTCAGTCCACAAG	134	38	yes
GATCTGCCTATCTGTCTATC	4	3	yes
GATCCGTCACAGAGAGCAGG	4	3	yes
GATCTGCCGTGCCCACCAAT	20	15	yes
GATCCGTACAGCGGCAAAAC	207	22	yes
GATCTGCCGAAGCGGGCTTG	1	1	yes
GATCTGCCCCTGACCCTCCA	35	36	yes
GATCTGCCCATAAGACTTCC	38	3	yes
GATCCAGAGGCTGGGCCTCT	44	2	yes
GATCAAAATGCTTGGAGAAA	24	23	yes
GATCAAAATGAGGCAGAGGA	62	17	yes
GATCAAAATCGCAGTTACTG	172	126	yes
GATCAAAAGATATGGTCCTT	29	22	yes
GATCAAAACTCAAGAAAAGG	12	9	yes
GATCCCTGGTCCTTAGGTGG	95	22	yes
GATCAAAACCTGTGACGGAG	3	2	yes
GATCAAAAATGCACAAAAAT	5	3	yes
GATCAAAAACAAAAGCGAAA	104	14	yes
GATCCGGGGCCTCTGGAAAG	21	20	yes
GATCTGCCCACCATATTCCT	69	7	yes
GATCCGGGCGTCGGCAGAGC	29	8	yes
GATCTGCCCAAAGAAACCCT	13	10	yes
GATCTGCCAGGAACATGAGA	19	7	yes
GATCTGCCAGCCGTACATCC	122	27	yes
GATCCCTGATTGCCTCCATG	272	64	yes
GATCCCTGATGCAAAAGAGA	118	6	yes
GATCGCTCTTTTGGAGGAGG	8	6	yes
GATCCGGCTCCAGATTCAGG	4	4	yes
GATCTGCAGTTCCTGGAAGG	66	2	yes
GATCTGCAGGTGCCTGGGAA	170	36	yes
GATCCCTCTGCAAACCAAAC	222	18	yes
GATCCCTCTCCCAGCTCTTC	46	35	yes
GATCTGCAGGAGGATGTTGA	5	4	yes
GATCTGCAGGAGGATGGTAA	33	11	yes
GATCTGCAGGAGGATGCCTG	514	32	yes
GATCTGCAGGAGCCGTTTGC	32	2	yes
GATCCGCTTCCTGCACGACC	222	30	yes
GATCCGCTGGTGTGTGTGAA	52	51	yes
GATCTGCAGAATTACAGCAG	36	27	yes
GATCACTACTGGCACTTTTT	30	11	yes
GATCCCTCAGTGTAGCATAG	59	17	yes
GATCCCTCAGTCTGCCGTAG	58	1	yes
GATCGGGAGTTCAAGGTCAT	15	11	yes
GATCTGCAAACGGGAAGGAG	4	3	yes
GATCTGCAAACACGCCTGAG	26	20	yes
GATCTGATTTTGACCAAGAT	52	1	yes
GATCCCGTCAACTTCAAGCT	379	60	yes
GATCTGATTTTCCCCCTGTT	2	1	yes
GATCCCGGGGGCTCCAGGAA	37	13	yes
GATCCGCAGACGTCACTCTG	29	7	yes
GATCCCGGGGCAGTCCAGCC	41	17	yes
GATCCGAGTTGGGGAGCCTG	9	3	yes
GATCAAATTCCCACTGCCCC	2118	71	yes
GATCTGATTCCCGCAGGTTC	347	0	yes
GATCTGATACTCTCTTCTGG	11	8	yes
GATCTGAGTTCCCGAAGCAA	31	8	yes
GATCTGAGTCCCCTGCTGGG	6	5	yes
GATCCACAGCACCTTCACTG	2	3	yes
GATCTGTCCTTTGTGTGCAG	25	24	yes
GATCCCCTCCCCCAGCTAAA	28	40	yes
GATCCCCTAAAACGAGTTGC	21	2	yes
GATCCCCGGCGTCTGTTTGA	4022	274	yes
GATCCCCCAGCCAGGCCAAA	116	50	yes
GATCCCCATTGGAGCAAAGC	14	10	yes
GATCTGAGGAAGACATTTTG	17	13	yes
GATCTGAGCCCCCTGAGGTT	119	15	yes
GATCTGAGATGAGCAGTGAC	20	15	yes
GATCCCTGCTTTCATGGAAG	36	7	yes
GATCCCACCATAGAGGATTC	2	1	yes
GATCTGAGAAGCTGTGATGG	5	3	yes
GATCTGAGAAACGGGGAAGC	81	12	yes
GATCCTCACCCTTCTGTGGC	44	10	yes
GATCCCTGAGAAGTTCCAGC	15	2	yes
GATCTGACTGCCTGCACAGG	27	11	yes
GATCTGACTGCAAAGCTTGT	77	7	yes
GATCTGACTCCACTGCCCAG	81	10	yes
GATCTGACTACCATTTACTG	1	1	yes
GATCTGACGCCGAGGAGGTA	507	48	yes
GATCTGACCTGGGTCCTGAC	129	2	yes
GATCCCTATGGACACTGACA	27	2	yes
GATCAGCACCTGCATCCTGC	10	10	yes
GATCTGCTTCGGGGACGGGC	5	3	yes
GATCCCGACAGCAGCACTGG	6	4	yes
GATCAGACTTTTAGCTGCTA	34	26	yes
GATCATGACCTGGTGCCGCA	47	18	yes
GATCCAGCTGCAATGACATT	32	8	yes
GATCGAGGAAAGCCCTGTAC	17	9	yes
GATCGAGCTCAGAGGCGAAA	6	6	yes
GATCTGCTTCCTGGCAACAC	19	1	yes
GATCCAAGACTATCAGAGCG	1	1	yes
GATCCACTTCAGAAGCAGCC	91	9	yes
GATCCACTGTTGTCCAGAGG	45	11	yes
GATCCACTGTGTGTCTGGTA	20	4	yes
GATCCACTGTCTTCCTAGAG	329	1	yes
GATCCACTGGTGGAGACAGA	2	2	yes
GATCCACTGGGCCAAGGAGC	227	13	yes
GATCCACTGGCTGGATATAG	37	24	yes
GATCCACTGGAAGCAGCACG	71	4	yes
GATCCACTGCTGGAAGTACC	183	3	yes
GATCCACTCGGGGGCTGTGA	86	13	yes
GATCCACTCCTGCAGAGCAC	2	3	yes
GATCCACTCCAGGCTGCGAG	376	40	yes
GATCCACTACTACCAGGGAC	4	4	yes
GATCCACTACCAATCTCGTA	39	15	yes
GATCCACTAATGCAGCTGGT	32	4	yes
GATCCACGTCTCGTCGTCAG	518	7	yes
GATCCACGGGGCACCCGCAC	200	5	yes
GATCCACGGGCTGGAATCTG	131	13	yes
GATCCACGGACACCAAGTTA	83	4	yes
GATCCACGACAGAGTGGAGA	5	2	yes
GATCAAACAGAAGCGCCAGG	5	3	yes
GATCCAACTGCCTTTGCCTC	482	67	yes
GATCAGAGCTACACAATGGC	58	3	yes
GATCAGAGCGACAGGACAGC	2	1	yes
GATCAGAGCCGCCTGACTTC	102	12	yes
GATCAGAGCATAGCCTATGT	12	1	yes
GATCCCAGCTTCAGGACACC	5	3	yes
GATCTGCTCGTGTTCCTGTC	13	6	yes
GATCCAACATACAGCACTTT	3	4	yes
GATCCAACACCTTCTTCTGG	2	3	yes
GATCAGAGACACGGAGCTGG	15	1	yes
GATCATGTTCCGCCAGCGGT	40	4	yes
GATCCACCTGCTTCTCCCTT	5	5	yes
GATCCACCTGCCTGTGCCTC	270	77	yes
GATCCACCTACTTTTTCAGC	4	4	yes
GATCCACCCACCCTGGGCAT	13	18	yes
GATCCACCAGTGCTTCTGCT	91	32	yes
GATCCACCAGTCCTTGAAGC	62	19	yes
GATCCACCAGGATGTTTGAT	14	1	yes
GATCCACCACATGTGCCAAA	7	10	yes
GATCCACCAAGTCCTGGCCC	83	19	yes
GATCCACATTTGCTGGTTTG	153	19	yes
GATCCACATTACCATCAAGC	16	1	yes
GATCCACATGTGCTCGCAAA	2	2	yes
GATCCACATGTACCATCAAC	7	2	yes
GATCCACATGCGTGTAGCAG	1643	2	yes
GATCCACATGAGGAGATACT	167	8	yes
GATCAGACCGTGGCGGTTGG	34	2	yes
GATCAGACCGACGTATGCAG	5	4	yes
GATCCACAGTCCCTATGTGT	19	7	yes
GATCCACAGTCAGCAAATCC	2	2	yes
GATCCACAGGGTACCTCCCT	7	0	yes
GATCCACAGGAGGGTTCCAA	131	13	yes
GATCCACAGATTCTGCCTGT	65	3	yes
GATCCACAGAAGCACTGCAG	32	6	yes
GATCCACACGGAAGGGGAAA	166	8	yes
GATCCACACCTGAAATGCTA	7	0	yes
GATCCACACCCTAACTCCCA	116	10	yes
GATCCACACCCGCTCCGCAT	1	1	yes
GATCCACACACGACTCTCCA	95	11	yes
GATCCACAAGTCTTAGCTGT	8	4	yes
GATCCACAAGCGACTCATTG	2273	47	yes
GATCCACAAGCAATCCAGGA	40	1	yes
GATCCACAACCTGATTCCCG	47	9	yes
GATCCACAAAGGCAGAGCCC	75	10	yes
GATCCACAAAACCAATAAAA	25	24	yes
GATCCAATTGTGGTGTTCTG	3	2	yes
GATCTGCCATCCCCTTCAGA	40	17	yes
GATCTGCCACTGAAGTAGAC	6	5	yes
GATCATTGCCAAGCCAGGCT	32	1	yes
GATCATTGACTCCCAGATTT	11	8	yes
GATCCATGGGCTTCTCCTGG	61	11	yes
GATCCAGAGGCAGGTGCAGA	27	2	yes
GATCCAATCGACTGGGTTTC	258	10	yes
GATCCAATCCCTGTGCAGCA	151	31	yes
GATCCAAGTTGTACATGAAT	2	1	yes
GATCCAAGTGTTTAACCATA	131	34	yes
GATCCAAGTGCCCTTCTGCT	4	4	yes
GATCCAAGTCCAGGAACCCT	143	14	yes
GATCCAAGTCATGATTTGAA	15	4	yes
GATCCAAGTCACCCCCCGAA	136	16	yes
GATCCAAGTATTGGCACCCA	36	8	yes
GATCCAAGGTCAAGGCAGAG	281	9	yes
GATCCAAGGCCTCAGGTCAC	448	10	yes
GATCCAAGGAGTGGTACCCA	7	0	yes
GATCCAAGCGTTACAATCGC	7	2	yes
GATCTGCCAAACGCTATGGC	3	2	yes
GATCCAAGCGTGAGCCAGTC	77	13	yes
GATCCAAGCAGGTGCTTCCT	63	11	yes
GATCCAAGCAGGCCCCTTAT	36	7	yes
GATCCAAGAGGAGGAGCACA	86	7	yes
GATCCAAGAGACCACCTTTG	7	8	yes
GATCCAAGACCAGGGTGGCT	148	1	yes
GATCCAAGAAGTCAGTCGGC	55	14	yes
GATCCAAGAAGAAAAGCAAG	19	9	yes
GATCCAAGAAAGGAAGAAGA	13	8	yes
GATCCAACGTGTTAGCCTTG	83	1	yes
GATCCAACGTGGTCTTTAAG	185	10	yes
GATCCAACGTAATCTTTAGG	4	4	yes
GATCCAACGAGTAGGAGTGT	101	5	yes
GATCCAACGAAAAACACTTG	41	5	yes
GATCCAACCCCACCTCAAGT	7	4	yes
GATCCAGCACGCTCAACATC	2	1	yes
GATCCAACATTGTCTTCTGG	2	2	yes
GATCCAACACCCTCACACAT	1	1	yes
GATCCAACAAAGGTTGTGAG	138	13	yes
GATCCAACAAAACACGCAGG	14	1	yes
GATCACTGTCGTGTTTGGTA	141	9	yes
GATCACTGGCCCCGATGGTG	17	7	yes
GATCACTGGAGGCCAGAGAA	52	22	yes
GATCACTGGAGCAGGCCTCC	42	32	yes
GATCATGCTCTGGCTGAGTT	11	4	yes
GATCCAAATCTTCCAGGCCC	5	3	yes
GATCCAAATCTTCAGTGTAG	4	4	yes
GATCCAAATATTGTCATAGC	218	21	yes
GATCCAAGCAGGTTGGGGAA	6	1	yes
GATCCAAAGTTGGCCAGCAT	129	6	yes
GATCCAAAGTGTTATGTCAA	25	24	yes
GATCCAAAGTCACACCTCCA	60	7	yes
GATCCAAAGGCAGCAAGAAG	35	6	yes
GATCCAAAGCCCCAGTAGAA	4	4	yes
GATCCAAAGCAGTGCTCCCA	147	30	yes
GATCCAAAGAGAGAAAGAGC	158	28	yes
GATCCAAAGACTCAGGTGTT	40	1	yes
GATCCAAAGACACAGTCTGT	657	2	yes
GATCCAAAGAAGACAAAATG	15	3	yes
GATCCAAACTTAACGAGCCC	47	7	yes
GATCCAAACCCCAGTGTACC	149	7	yes
GATCCAAACAAAGACACAAG	137	2	yes
GATCCAAAATGCTACTGTTA	24	0	yes
GATCACTGCAGCCCCAAACT	4	4	yes
GATCCCGCCAAAAGAATTAA	14	20	yes
GATCTGATGTCCTCTTCTGT	15	21	yes
GATCCTGGAGACTCAAACCC	43	7	yes
GATCACTGAAGCTCCGCATT	13	10	yes
GATCTTCTTGCTGGTCTTGC	9	8	yes
GATCCAAAAGCCTGCTCGGT	42	22	yes
GATCCAAAAGCAGCGTTTGC	15	14	yes
GATCCAAAACAGCAAATAGG	24	20	yes
GATCCAAAAATGGGGATGTT	10	0	yes
GATCCAAAAATACAGCCTGC	32	12	yes
GATCATTTTTCTGTAGCCAT	21	8	yes
GATCATTTTGTCGAGTGAGT	10	2	yes
GATCATTTTGTAAAGTACAG	15	11	yes
GATCATTTTCTGCCGTACCA	2	1	yes
GATCATTTTCCCAACGTTAC	46	0	yes
GATCACTCCTTGCTTTGCCA	6	1	yes
GATCACTCAGGGTGGGCAGT	47	22	yes
GATCACTCAGGACGGTACCC	37	29	yes
GATCACTCACGAGAACATCT	26	15	yes
GATCACTAAAGGGTTTCCTG	17	3	yes
GATCATTTGTCCAGGAGTGT	8	6	yes
GATCATTTGCGTTTGGAGGT	24	23	yes
GATCATTTGATTCCCCTCCC	26	20	yes
GATCCCAAATGTGAAGACAG	167	31	yes
GATCATTTCTTTCTGGCCTG	535	42	yes
GATCATTTCTCGCTCAGATT	3	2	yes
GATCATTTCGGTGACTGAAG	20	19	yes
GATCATTTCAGGTGAGCAAT	2	1	yes
GATCATTTCACTGGTGGCTG	32	4	yes
GATCATTTACCTTCTTCTTC	1	1	yes
GATCACGGCATCGAAAGGAA	717	128	yes
GATCACGCTGAGGGTGTCTG	228	16	yes
GATCATCCCAAAGGCCCAAG	11	8	yes
GATCACGCCCCACTTTACAT	21	8	yes
GATCACGATGCCACACCCTG	2	1	yes
GATCATTGTGGCCCCGCCCC	469	195	yes
GATCATTGTCCTCCAGTCAG	30	3	yes
GATCATTGTCAACTAAGTGC	11	8	yes
GATCATAATCACAAACAGCC	23	7	yes
GATCATTGGTTGAATCGGTT	47	36	yes
GATCATTGGAGAGGGGTCTG	67	52	yes
GATCATTGCCACGGAAAACA	45	18	yes
GATCATTGCAGTCTGAGGCT	9	2	yes
GATCATTGCAGACAGTGCTA	14	2	yes
GATCATTGATGTTGTCTACA	12	9	yes
GATCATTGAGAGCAAGCGAG	163	5	yes
GATCACCGCTGCCGCCTGGG	1	1	yes
GATCACCGCCTGCACCGCAG	451	20	yes
GATCACCCTGGGCCTGGTCA	17	13	yes
GATCTGAGAGGAGTGTGTGG	5	3	yes
GATCACCCCCAGGAAGAGTA	3	2	yes
GATCATTCTCCAAAGGCAAC	126	22	yes
GATCATTCATCAGTTTCGGC	952	53	yes
GATCATTCAGGACAAAGGAG	30	23	yes
GATCATTCAGACAGTACATT	3	2	yes
GATCATTCACAGAACAGAGT	7	6	yes
GATCATTAGGGGTTTGGTCT	3081	34	yes
GATCATTAGCCCACATACCC	38	29	yes
GATCATTAGCCAGAAATCAA	60	58	yes
GATCATTACTGTGTGAGTGT	9	1	yes
GATCATTACTGCAGTCTTGG	1	1	yes
GATCATTACCTTTGTTGTCC	4	3	yes
GATCATTACACGGAGAACAC	17	13	yes
GATCGCTCGAACTTAACCAG	15	11	yes
GATCCAGCAGTACCTGAAGG	1	1	yes
GATCCTTGTCCTCACTCTCC	1	1	yes
GATCGGAGCCAGTGGGGTGG	26	0	yes
GATCCCAAAGTCCTAACGCA	2	1	yes
GATCCTTCTGAATGCCTGCT	253	7	yes
GATCGACTCTCCCTCACCGG	2	1	yes
GATCTGGATTTTAGGTGGTA	116	41	yes
GATCTGCTCAGTGTCTTGGG	25	4	yes
GATCTGCCTGTATCTACCCT	3	2	yes
GATCTGTTTACAAGGTTTGT	106	1	yes
GATCCGTATAACTTCACTCT	6	3	yes
GATCTTGGCAAGCGGATGGC	4	3	yes
GATCCAATTCTGTTCTTCTC	1	1	yes
GATCCTCACGTCCTTTGTGG	14	1	yes
GATCTCAAGGTTAATCGGTT	3	2	yes
GATCCCCAATGTTACTCACC	5	2	yes
GATCCCCAATATGCTGTTGA	46	15	yes
GATCCCCAAGGCAGCTACCA	30	23	yes
GATCCCTTCTCTGACCTTTG	15	2	yes
GATCCCGGATTTGCTCCTGT	7	2	yes
GATCCCAGTGGATGAGCATG	16	7	yes
GATCTGACCCACCACGGAGA	14	10	yes
GATCTGACATTGGTTCTTTG	8	8	yes
GATCTGACAGGACCGCAGAG	57	15	yes
GATCCCAGCAGCAGAGCATG	12	7	yes
GATCCCGTTCCTATAGTCCA	60	17	yes
GATCTGACACTCTTCTGGAG	12	9	yes
GATCCCAGCACCGAGGGGAA	552	134	yes
GATCCCGGACGCGAACCCGG	26	12	yes
GATCTGAATCTGAAATCCCA	13	10	yes
GATCCCACTGCACATAGGAC	10644	1758	yes
GATCCCACGGGGTGCAGTGA	75	41	yes
GATCCCACGAAGAATTCTTC	10	8	yes
GATCCCACCTAGCAGCCACC	121	35	yes
GATCCCACCCATTTTACAAA	12	5	yes
GATCCCACCACCATGTTCAG	7	8	yes
GATCTGAAGAGGAATCTGTA	14	10	yes
GATCTGAACTTTGTACAGGA	48	9	yes
GATCCCCTCCCTCATGTTAA	17	13	yes
GATCAAACAACCCAACAGGA	5863	321	yes
GATCCCCGTGTCTGTGGAAA	6	6	yes
GATCTGAAAGTAGACTCTGC	13	10	yes
GATCCCAAAGGCTGCACCTT	10	0	yes
GATCACTTTCTGAGCTGTAA	3	2	yes
GATCCCAAGTTTTTCCTTAA	4	1	yes
GATCTGAAACCAAGTATCTT	11	8	yes
GATCCCAAGACCACCCACCT	240	7	yes
GATCTCTTTTCCTGACCCTC	138	5	yes
GATCCCAAAGCCTCGTATGC	13	10	yes
GATCCCCAGTCCAGGATGTG	4	1	yes
GATCTCTTCTGTGGTCCTTC	25	9	yes
GATCCCCACGTGAGTATCGG	12	12	yes
GATCCGCAAGGTGAACGAAC	1	1	yes
GATCCATTCTTCACCCTTGA	2	1	yes
GATCCATGTTTTCCAGGTAT	23	15	yes
GATCCATGTTGGGGGTTGGG	10	8	yes
GATCCATGTTGACCAAATGC	5	0	yes
GATCCATGTGTTGGTTGAGA	77	13	yes
GATCCATGTGATTGGAAAGT	26	13	yes
GATCCATGTGATGGACTGCA	4	3	yes
GATCCATGTCCTTTGGCTCC	31	10	yes
GATCACGTACTGTGCCTTGT	15	0	yes
GATCCATGGTGGGGCCATTT	66	10	yes
GATCCAAAACCACAGAAGCA	1	1	yes
GATCCATGGTAGTCAGATAG	31	14	yes
GATCTCTGTCAAGGTGGTGG	3	2	yes
GATCCATGGGCCTTAGGGCT	132	41	yes
GATCCATGCTCTGATGAGCG	76	6	yes
GATCCATGAAGTTTTCAGTC	27	11	yes
GATCCATCTGCATTTGCGGC	5458	789	yes
GATCCATCTGCACATGGCTC	5	1	yes
GATCCATCCTCTGTCCTCTT	8380	1341	yes
GATCTCTGGGAAGGGCTGCG	54	41	yes
GATCTCTGCTATGAGGCTAC	88	13	yes
GATCTCTGCGGTTTGCTTTT	61	1	yes
GATCCCAGGAAGTCCCACGA	31	18	yes
GATCTTGACATGCAAAAGTC	7	6	yes
GATCTCTCGCCTGGACCCCT	86	20	yes
GATCTCTCCAAAGCACACGC	68	4	yes
GATCTCTCAGGCCATGGGTC	161	31	yes
GATCTCTCACGCAGACAGAA	17	1	yes
GATCTCGTTAGTCACGCTTC	2	2	yes
GATCCCAGAACCTGCAGCTA	27	21	yes
GATCTCGTAGCTGCCTTTTT	4	3	yes
GATCCAGTGTGGAAGAGGTG	77	34	yes
GATCAGACACTCAGACTACC	7	6	yes
GATCCCACTGCATTCTCTGT	15	21	yes
GATCTCGGGAGATTGGCTGG	21	4	yes
GATCCCACTCTCTCAGTCCT	2	3	yes
GATCTCGGGAATCAGAGTTC	13	10	yes
GATCTCGCTTACAAGAAACC	13	10	yes
GATCCCACCTCCCCCCAGTC	149	58	yes
GATCCAGGTTGAATTCCCAG	21	6	yes
GATCTCGCCCTGTCAAGCAT	28	14	yes
GATCTCGCAGCCTTCCCCTC	456	67	yes
GATCTCGCAAGCACAAAGCC	31	6	yes
GATCTGCTCTGGCATCTCGC	5	4	yes
GATCCCACACCCACCTGCTC	14	10	yes
GATCAGGGCCGGGAGGGGGG	11	0	yes
GATCCAGGGTGGGAAGGAAG	50	3	yes
GATCCAGGAGACTCGAAGAT	100	3	yes
GATCCAGCTTCCCTCCGAGA	308	96	yes
GATCCAGCGAGGGAGCTGCC	30	19	yes
GATCTCCGCCCGAGCCTACG	100	14	yes
GATCTCCCTGGTCCTGGCAT	127	5	yes
GATCCAGCATGGGTGTCCCG	12	13	yes
GATCCAGCATCACCCAGACA	81	10	yes
GATCTACTTCCTACGGCACA	1265	0	yes
GATCCATTTTGTTCGTGGAC	62	15	yes
GATCCATTGTACTACAAGTT	14	2	yes
GATCTCCCCACCACCCCAGG	7	10	yes
GATCTCCCCACAGTACACAG	4	3	yes
GATCTCCCAGGAGACAACCG	5	4	yes
GATCCATTAGCTTTGTCTGA	15	12	yes
GATCCATGTCATCGTTCATT	1	1	yes
GATCTCCAGTTCAAGTTCAT	2	2	yes
GATCAGCTGCCCTTGACCTT	3	0	yes
GATCCTTCTCTGTGTCAGCT	31	12	yes
GATCCTGCTCACCTTGGGCT	30	23	yes
GATCTCCACCCTATGCGAGT	157	152	yes
GATCTCCACACAGCACACAG	311	7	yes
GATCTCCAAAGAGTTACTCG	1	1	yes
GATCCTGCCATGCTTCCTGC	3	0	yes
GATCGGGGACTCGGGGGTAG	30	1	yes
GATCTACACTGGCCTGAAGA	2	1	yes
GATCGCTAAGTACATGGAGT	4	3	yes
GATCGCGTTGTGAACGTGAG	10	2	yes
GATCAAGTTTCTGGCCTTGC	5	4	yes
GATCGGCGTGGGCCTGTCCA	5	5	yes
GATCACCCAGGAAGAGAAAT	16	13	yes
GATCAGTTCCTCTTCAGAAT	3	2	yes
GATCACCAGAAGCCATGCTC	130	80	yes
GATCTGACTTATCGTCCACT	3	2	yes
GATCATTAAGACCCTGTATC	1	1	yes
GATCATGTTTTTGAGTGAAA	2	2	yes
GATCATGTTTCAGGAAGGAA	107	9	yes
GATCATGTTTACTGTCACTG	14	14	yes
GATCATGTTGATTCTGAAAT	72	3	yes
GATCATGTTCTTTCCGCAGG	548	6	yes
GATCATGTTCGCCTGGACAC	558	16	yes
GATCATGTTCCTGGAGGTCA	134	10	yes
GATCATGTTACACTTGCCAG	85	7	yes
GATCATGTGTTCAAGTCCAC	21	20	yes
GATCATGTGTAAGTGTCAAA	162	0	yes
GATCATGTGGATTCCAGGAA	34	3	yes
GATCATGTGGATGCCTTCCC	410	95	yes
GATCATGTGGAAGGTGAGAT	22	9	yes
GATCATGTGCTCACCTGCAT	106	18	yes
GATCCATGACTTACGTGTCA	2	1	yes
GATCACATTTTGCCTTTGGT	240	22	yes
GATCGTTTTGTTTTGTTTTG	14	10	yes
GATCATGTGAGCATCGTGGA	344	230	yes
GATCATGTGACAAGTGAGAG	27	9	yes
GATCATGTCTTCTCCATGTT	148	26	yes
GATCATGTCTGTGAAATGAC	5	3	yes
GATCATGTCTCAAGGTGGCA	137	0	yes
GATCATGTCTATCTCAGGGG	210	6	yes
GATCATGTCATTGCCTGTTA	10	5	yes
GATCATGTCAGAGGGAGATG	14296	121	yes
GATCATGTACTGGCTGCAGG	39	5	yes
GATCATGTACAGAGGTCTTT	21	20	yes
GATCATGTACAAGCTGATGG	336	44	yes
GATCATGTAAAGACGCTGGG	54	52	yes
GATCATGGTTCTGATGAAGC	5	5	yes
GATCATGGTTCAAGTGACAA	290	23	yes
GATCATGGTGTGGCTTGTGG	26	25	yes
GATCATGGTCTTCGGAAAAC	59	7	yes
GATCATGGGTGTTGCTACCA	36	10	yes
GATCATGGGTGTGCCAGGGG	132	3	yes
GATCACATCTACCACATGTA	31	30	yes
GATCTGTCTACTTTTCCTAT	4	1	yes
GATCATGGCCTTTACGATGC	12	13	yes
GATCATGGCCTTCAGATATG	76	1	yes
GATCATGGCCCAGACCTGAG	378	82	yes
GATCATGGCAAAGGATGACC	111	15	yes
GATCATGGATGTGTGGGGAA	46	12	yes
GATCATGGACATGAAGGAAG	91	13	yes
GATCATGCTTTCTTCTCTAT	10	0	yes
GATCATGCTGTGTTCGTGAT	19	6	yes
GATCATGCTCCTGCAGCTGA	163	6	yes
GATCATGCTCCTGAGTGGCA	50	2	yes
GATCATGCTCATCTTCACTG	34	10	yes
GATCATTGGGGGAGGGTAGT	114	43	yes
GATCATGCTACGTTTTGTCT	65	3	yes
GATCATGCCTTCTGTAAAGC	2	2	yes
GATCATGCCTGGGGGAGCCC	61	59	yes
GATCACAGCTGTTTGCAAGG	5	5	yes
GATCACAGTGGCTATATCTC	204	56	yes
GATCACAGCTGTGATGGGAG	228	4	yes
GATCAGTCTCTGCAAGCTTA	55	4	yes
GATCACAGCTATGCCCTTTC	85	10	yes
GATCGTGTGTTGCCATTTTG	45	6	yes
GATCACAGCAGCCCAAGCTC	28	22	yes
GATCACAGCAGCCAAGGGAC	17	11	yes
GATCTGAAGGACCTGGAGGC	4	3	yes
GATCATGCCGTGCTACGCTC	86	13	yes
GATCATGCCCAAAACAACCA	77	5	yes
GATCATGCAGAAGAACGGTG	602	42	yes
GATCATGCACTGTATTCACA	63	18	yes
GATCATGATTCTCCCTCAGC	32	1	yes
GATCATGAGTGTCCCACTAC	102	34	yes
GATCATGAGTGACCACAGTT	127	16	yes
GATCATGAGGGAGTTCCGGT	373	85	yes
GATCATGAGGCTGTCTGCAG	21	20	yes
GATCATGACGCTGGTAGATG	2	2	yes
GATCATGACATTCCTCAGAT	20	4	yes
GATCACAGACCATGGTCTCA	49	47	yes
GATCAGCTCGTCTTTCGCCA	3	2	yes
GATCATGAACATCATCCAGG	66	36	yes
GATCATCTTTTCTCATTTCG	8	6	yes
GATCATCTTGTTGCGTTTCT	56	2	yes
GATCATCTGGTGCTGTGTCG	5	3	yes
GATCATCTGCTACCAATGTG	2	1	yes
GATCATCTGCCCTTTCTATC	32	24	yes
GATCATCTCTCACCACAGGC	36	35	yes
GATCATCTCCCTGATGAGAC	20	4	yes
GATCATCTCCCCCTTCAGTG	9	3	yes
GATCATCTCACAGGACAGGG	284	35	yes
GATCACACCACTCTCAACCA	24	0	yes
GATCGTTTCTAGTTCCATCC	8	6	yes
GATCACACATCTGGGCAGTG	9	7	yes
GATCAGCCTGGCTCCAGGGA	46	1	yes
GATCACACAACCCACCTCAG	5	4	yes
GATCATCTACGACAGAAAGT	48	13	yes
GATCATCGTGTCGGGATGAT	2	2	yes
GATCATCGTCAGTGACGTTT	56	1	yes
GATCATCGGCATGGCATACG	932	65	yes
GATCATCGGAAGGATAGATG	23	17	yes
GATCATCGAGTTGTGGATGG	34	5	yes
GATCATCCTTGTGTTGTGAA	194	13	yes
GATCATCCTTCAAAGGGGAT	15	11	yes
GATCATCCGCAAAGTTGTGA	88	5	yes
GATCATCCAGGGCTGCCCCT	20	9	yes
GATCATCCACCTGCTCACTG	991	634	yes
GATCATCCACAAACTTCCAG	5	4	yes
GATCATCCAAGTGTTTGAGC	12	12	yes
GATCATCATTCGTGTGCAGA	41	8	yes
GATCTCCAAGGACTCAGGCA	7	7	yes
GATCATCATGGAGCTGGTGA	4	4	yes
GATCATCATGCTTCCAGATG	143	14	yes
GATCACGTACAGCTGACCAG	3	2	yes
GATCACAAGATGGCGTTATC	47	4	yes
GATCAGGTCATCGCCTCCTT	1316	139	yes
GATCAGGTAACAGGCAGGCT	225	173	yes
GATCAGGGTTAAGGAGGAGC	186	4	yes
GATCAGGGATATGAGGTTGC	26	20	yes
GATCAGGGAGCTTCGTGTGT	19	15	yes
GATCAGGGAAGCAGACATTG	551	309	yes
GATCAGGCGAGACATGTTCT	204	14	yes
GATCAGGCAGTGTTGCAGGC	30	9	yes
GATCAGGCACCCTTCCACCA	19	15	yes
GATCAGGCACAGGGACAGCC	4	3	yes
GATCAGGAGTTGTCACCCAG	5	3	yes
GATCAGGAAGCAAAGAAAGA	59	13	yes
GATCAGGAACCTGGCCTTCT	23	17	yes
GATCAGCTGTGGGCTCTGGG	222	22	yes
GATCATCATCTTGACAGCTT	31	5	yes
GATCATCAGTTAGAGTTCTG	37	9	yes
GATCATCAAGTGTCCTGGCG	98	20	yes
GATCGTGAGTGGGAAGCTGC	31	8	yes
GATCATAGGATTCTGATTTT	1	1	yes
GATCTCTCCCAAACGGTGAT	1	1	yes
GATCACAAACATAGCCAATG	30	23	yes
GATCTCTATGACACGCTGAC	2	1	yes
GATCAATGCCTCCAGCAAGG	25	1	yes
GATCAGCTCTGTAGCAGCAG	26	20	yes
GATCAGCTCTGGAGTCAGTC	8	4	yes
GATCAGCTCATGGAAGCGTG	4	3	yes
GATCAGCTATCCATGGACGA	8	6	yes
GATCAGCGTGCGCCTAGCGG	166	13	yes
GATCAGCGGTGGGAATGACG	734	563	yes
GATCAGCGCCGCTGGCTTCT	20	15	yes
GATCAGCCGAGACTACAGCA	1710	137	yes
GATCAGCCCTGGCAAGGAAG	128	28	yes
GATCAGCCCCATTGCGGTGC	244	7	yes
GATCAGCCCAAAATGAGCGA	13	2	yes
GATCAGCCATCCTGGATGGA	42	2	yes
GATCAGCCAAGCCAGACTTG	282	172	yes
GATCATAGCTGATGGCCTTC	82	30	yes
GATCATAGCTCTTTTCCTGA	4	4	yes
GATCATAGCTCTAGCAGAAC	5	5	yes
GATCATAGCTACTTTGTGCT	2	2	yes
GATCATAGCAAAGATGGACG	204	21	yes
GATCATAGATTGGGCTACAT	97	74	yes
GATCATAGATGACTTTGCCT	42	11	yes
GATCATAGAGGTGTGGCTTT	9	7	yes
GATCATACTGTTAGTCGGCT	10	0	yes
GATCATACGTAGTTGTGAAA	20	5	yes
GATCATACGCCCAGGGAGAG	44	34	yes
GATCATACCAAGAGGTGAGG	200	17	yes
GATCATAATGGACTGAACCT	6	1	yes
GATCATAACAGTTCTGTGAA	102	24	yes
GATCAATCAGAGGGATTACC	30	7	yes
GATCACTAAGACTTGAATCC	1	1	yes
GATCAAGTTGGGAGTGGCAG	2	1	yes
GATCAGCAGGTGGTTATCAA	101	13	yes
GATCAGCAGCCGGAGACGAC	202	61	yes
GATCAGCAGATGTTGGTGGC	23	7	yes
GATCAGCACTTGGTACATGG	24	34	yes
GATCAGCACTGGGGTCAACG	95	13	yes
GATCAGCACTCTCGGTATGC	147	22	yes
GATCAGCACGCTGACTCTTT	4	4	yes
GATCAGCACCACACTGGACT	47	10	yes
GATCAGCACAGCCTCCTTAG	31	24	yes
GATCGGTTTGTGGAGTTTCT	22	3	yes
GATCAGAGTTCGAGGCCAGC	19	15	yes
GATCAGAGTGTCACGGTAGG	4	3	yes
GATCAGAGGCGCATCGAATG	24	18	yes
GATCAGAGCCCTGTCGATGG	11	2	yes
GATCAGAGATGGGCTCTGTG	23	17	yes
GATCAGAGAGTTGACCGCAG	5	4	yes
GATCCTGCCAGTCCAAGAGT	7	7	yes
GATCAGAGAAACTCTGACAT	15	11	yes
GATCAGACTAACCCCGGAGT	143	10	yes
GATCAGACGAAAGACATTTG	11	8	yes
GATCAGACCCAGGCTCTTGC	12	3	yes
GATCAGACCATGGTACTGGC	112	2	yes
GATCATAAACAACAGTGTTA	7	6	yes
GATCAGTTTTTGGTGTCATT	1073	111	yes
GATCAGTTTTGGTCTTGATG	62	13	yes
GATCAGTTTTGGAGTGCAGC	5	4	yes
GATCAGTTTTGACCTCTTAT	92	6	yes
GATCAGTTTTCATGTCCTCT	9	7	yes
GATCAGTTTGTTTTCACTGT	77	27	yes
GATCAGTTTGCCAATCATCT	90	17	yes
GATCAGTTTGATTTGTTCTG	9	7	yes
GATCAGTTTCTGTGTAGTCT	31	14	yes
GATCAGTTTCATGTTTTTTC	3	2	yes
GATCAGTTTCAGCCAGGAGT	2	1	yes
GATCATTTAGCGACAAGCAT	6	3	yes
GATCAGTTTATCAGTCCGTT	49	30	yes
GATCAGTTGCCAAATGATTG	1	1	yes
GATCAGTTGAAACTTGGAAA	1899	199	yes
GATCAGTTCTGAGCCGAGGA	70	4	yes
GATCAGTTCCTGGTATACAG	19	15	yes
GATCAAGTGCTGTGACAGTG	35	6	yes
GATCCCCATCAACGCTGGAG	1	1	yes
GATCAAGGTGGCGGAGGACG	14	10	yes
GATCAAGGTCGGAAAGAAAT	1282	214	yes
GATCAGACAGTATCAGGGCT	41	5	yes
GATCAGACACATTTCGACAG	18	4	yes
GATCAGAATGAGGGACCTCC	246	47	yes
GATCAGAACCCGCAGACCAA	18	6	yes
GATCAGAACCCAGTCTGCTG	29	22	yes
GATCCTGTGCGGACTCTGGG	6	9	yes
GATCAGAAACCCGAGCTGAA	10	8	yes
GATCACTTTGACTTCATCCT	54	11	yes
GATCTGTGCAAAAGCAGTGA	917	94	yes
GATCACTGTGCGCCCCCTCC	43	11	yes
GATCACTGGCAAGCACGAAG	72	5	yes
GATCACTGCTGTAGGAAAGC	30	3	yes
GATCACTCTCCTCAACTATT	3	0	yes
GATCACTCGCCGAGGTGTGG	15	8	yes
GATCAGTTCCATGTTACACA	6	1	yes
GATCAGTTCAGTGTGCATCG	10	8	yes
GATCAGTTCAGACAACTGTG	35	1	yes
GATCAGTGTTTCTGCGAAGG	783	21	yes
GATCAGTGGAGCCCATCGCC	31	24	yes
GATCGGCGTGACTACCCCTT	54	5	yes
GATCAGTGCTGTTCTGGCAA	19	11	yes
GATCAGTGCTGTACTTCACT	5	3	yes
GATCAGTGCTCTGCTAACGC	457	230	yes
GATCAGTGCCTTTGTTGGCA	352	174	yes
GATCAGTGCATTTCAGAGTT	41	17	yes
GATCCCTGAGCCTGAATTAC	10	2	yes
GATCAGTGAGTGTGAGTGTG	61	9	yes
GATCACTCAGTAACTGCTGG	28	12	yes
GATCACTCAGGATTTGTTCC	5	5	yes
GATCACTAGCAAGGACTAAA	28	22	yes
GATCACTACTCCTTAGACGT	193	6	yes
GATCACGTTTGTGTTGTCTT	63	24	yes
GATCACGTTCTGATTGAGCT	45	26	yes
GATCACGTGTATGTGTCGTG	66	2	yes
GATCACGTGGGCTGCGTTTC	125	0	yes
GATCACGTGCCTGAGGTATG	22	3	yes
GATCACGTGACCACCCTTTC	99	12	yes
GATCACGGGAGCTGAGCAAC	31	24	yes
GATCACGGAGCTGGAGTTCG	33	25	yes
GATCACGGAGCCAAGGAAGA	83	20	yes
GATCACGCAGTCTTAGAAAT	163	23	yes
GATCACGACGACGCCCACGC	572	168	yes
GATCACCTGCCAGACTGTTA	39	0	yes
GATCACCTCCCAGATTCTGA	61	22	yes
GATCACCGTTCCCATCCCCG	21	6	yes
GATCACCAAGTGGAATGAAA	5	3	yes
GATCACCAAGGAATCCAAGG	87	20	yes
GATCACCAACTCACGTCATG	17	13	yes
GATCTAGCACTAATCCGGAA	4	3	yes
GATCACATGAGAGTCAGAGG	3	2	yes
GATCACAGTGGAATCTTCGG	44	13	yes
GATCACAGTGAGATTCTCAT	26	6	yes
GATCACAGGTCTGAGCAAAG	9	1	yes
GATCACAGAATCTCGTGCCT	129	1	yes
GATCATTTTCACCAGAGATT	31	12	yes
GATCTTGCAGGTGAATGGTA	14	6	yes
GATCAGAAGTTGAGACTTCC	15	11	yes
GATCACACTTGGGGAAGATG	26	6	yes
GATCACACTGGAACAGAACC	11	8	yes
GATCACACCTGTGGGGTCAA	111	75	yes
GATCACACCCAAAGCTGTCC	8	6	yes
GATCACACAGGGAGGCCTTG	733	71	yes
GATCACACACTACTGAGGGC	311	28	yes
GATCACAATCATGGGCACAG	20	8	yes
GATCACAACTGATGGCGGGT	367	89	yes
GATCTAAGCGGGACTATGAG	18	14	yes
GATCAATGTCGTCATCATCC	14	10	yes
GATCAATCACCAGCGCGAAG	138	33	yes
GATCACTGTGCGGATTGAGC	116	27	yes
GATCAACTCATGGAGCTGGC	163	31	yes
GATCAACGCCATGACCTACC	453	47	yes
GATCAACGATATTTCTCTGC	5	3	yes
GATCAACCCGTGTGCATTGC	12	1	yes
GATCAACCCCTACCAGCCAG	55	6	yes
GATCAACCAGGTGGCCTTGG	77	21	yes
GATCAACATCATTGCAGCAG	3	2	yes
GATCAACACTTTTCTCTCAG	10	8	yes
GATCCGAATCTGTGCCCAGC	236	13	yes
GATCCCCAGTTATGTGACTT	12	12	yes
GATCCTGGAACGGGTGGATG	10	5	yes
GATCAAATCCTGCGTCTTTT	19	5	yes
GATCAAAGAATTTGGTTCTG	46	35	yes
GATCCTCCTGGGCTTGAACT	15	15	yes
GATCAAACAGCTGTACCTCA	62	24	yes
GATCGACACATGTGTGGGGA	59	5	yes
GATCGACAATGCCCGCCTTG	5	4	yes
GATCCCTTTATGAACCTTGT	49	2	yes
GATCTGGTCCTGCTCCTACC	105	16	yes
GATCAAGAGGAGACCTGGCG	2	1	yes
GATCAGGCAGCTGTTGAGTT	6	1	yes
GATCAGCTCTTCCCATCCCT	45	8	yes
GATCTTGCAGGTGGAACATG	14	10	yes
GATCCAGAGGCCCTAGCCAG	84	10	yes
GATCCAGAGAGCTTCCTAAA	34	4	yes
GATCCAGAATGTGTGGCAAC	36	2	yes
GATCCCCAGCCTAGGTTGCC	6	6	yes
GATCAGACAGGAAAGGATGT	20	3	yes
GATCCTTTGGCTTGGGAAGT	40	6	yes
GATCCACCTTGTGGCCTGGC	121	3	yes
GATCTCATGGCACACATAGC	4	3	yes
GATCTCATCTGAATTCGGTG	66	11	yes
GATCCCTCCCATGTTGGGAG	6	7	yes
GATCCACCGTACCAGGAAGC	28	6	yes
GATCTCAGTTTTTGGTTACA	36	10	yes
GATCTCAGTCCCCGCCTGCA	143	38	yes
GATCCAGGTGTTTGGCCTGA	132	33	yes
GATCCAGGTCTAATTACAGG	22	1	yes
GATCCTGCCCCCACGCTGGG	8	6	yes
GATCCACCAAGGTAGAAAAC	69	9	yes
GATCCACACGGGCGAGAAGC	5	0	yes
GATCCACACAGGAGAGAAGC	141	9	yes
GATCCAGGACAGCCAGAGCT	16	3	yes
GATCTCACTGTGTCGCTCTG	5	4	yes
GATCCAGGACACAGCGTGGT	51	17	yes
GATCTCACTGGACTTGGTGT	95	7	yes
GATCCAGGAAGCAAACTTCC	8	6	yes
GATCTCACTGGAAGCCTGGC	36	2	yes
GATCCCGTGTAGCCTTCGTT	1	1	yes
GATCCAGGAACCGAAGAATG	5	1	yes
GATCTCACTAACCTGCCACC	50	8	yes
GATCCAGCTGCAGAAGCCAG	20	5	yes
GATCTCACGGCCTGCGGGGT	45	0	yes
GATCTCACGGCCAGACAGAC	458	16	yes
GATCTCACGCCTCTGTGCAT	19	19	yes
GATCAAGCCTAGCCAGGACC	26	2	yes
GATCCCCCGAGCCTTGCCCG	25	15	yes
GATCCAAGTTATTGGCACAC	5	5	yes
GATCCAAGGGCCCTGTATGT	21	14	yes
GATCCAAGGAGCTGGGGAGG	4	5	yes
GATCAGATGGGCGGGGAAAA	15	12	yes
GATCCAGCATCTTGCCTTCC	15	2	yes
GATCTCAAGCGCTTTGCTCT	6	5	yes
GATCTCAAAGTGGCTGATGC	26	2	yes
GATCTCAAAGGGAAACTGAC	57	9	yes
GATCTCAAAGGAACTTCTCC	8	6	yes
GATCTCAAAGCCATTGATAG	19	15	yes
GATCCAACTCTGTAAAGGCT	88	8	yes
GATCCAACTCAGTTAGGCTT	10	2	yes
GATCCAACGCAGCACCGTCT	78	16	yes
GATCCAACCCCCTCTCCTGA	26	4	yes
GATCAGAGCCGCAAGGACGG	5	5	yes
GATCGAGCTGCTGCTGCTGA	2	2	yes
GATCGAGCCCCTCCGAGCCG	4	1	yes
GATCGAGCCAAGAGCTGTAA	20	15	yes
GATCGAGCAGGCCCGGCTGC	151	24	yes
GATCCAAAGGACATCGATAT	3	2	yes
GATCCAGAGAAGGCTCAGTG	3	2	yes
GATCCAAAGACGCTAGATGT	11	8	yes
GATCTATTCTCCCACTGGAC	5	3	yes
GATCCAGACCCTTCCCAGAA	134	5	yes
GATCTATGTCATGGCCACGC	521	134	yes
GATCTATGAGACAGAACTGG	164	44	yes
GATCCAGGTGACCATGGCAT	6	3	yes
GATCGAAGCCTGCCGGGGTA	2	1	yes
GATCCAGAAACCGCAGTCAT	35	1	yes
GATCTAGCCTTATGCCCGGG	4	4	yes
GATCTACTTGTGTGTGTGTG	101	18	yes
GATCTACTCCTTCAGAGCCT	148	6	yes
GATCCACGGGGTGACTTCCA	1	1	yes
GATCTACGGTTCCCACGCAT	143	38	yes
GATCTACCAGGTGGACACCC	60	6	yes
GATCTACAGGACCCGCCCCT	5	4	yes
GATCTACACACTCCCTTTTT	70	20	yes
GATCCACCAGCGTGTGCATG	22	11	yes
GATCCAGGTTTTACTGGCGC	79	21	yes
GATCAGTACCTAGCGCCCAC	28	22	yes
GATCATTCTGAAGTACATTG	7	6	yes
GATCATTCCAAGTTTCACGT	66	14	yes
GATCTAAATGCCCAAGTTGA	44	34	yes
GATCCACACAATGGAGACCT	85	13	yes
GATCTAAATCTTTCCTCAGC	12	9	yes
GATCTAAAGTTACTCTGCTT	5	3	yes
GATCTAAAGTGCCTCTTTGT	45	34	yes
GATCTAAACTGTGGTGTGAA	25	7	yes
GATCCAGAGGAGAAACTAAG	50	2	yes
GATCAAGGTCGGGAGTACGA	7	6	yes
GATCGTTGGATACTCACAGA	104	32	yes
GATCGTGTTGGGACTTTGAC	3	2	yes
GATCGTGTTCAAGAACCCCC	1	1	yes
GATCAGCTCCCAGGTTACCC	15	8	yes
GATCGTGTGGAGTGAAAGGC	47	14	yes
GATCGTGTCCGGCATGAAGT	963	103	yes
GATCCAAGGGGAGAGTCAAG	32	6	yes
GATCGTGGTGCAAGGAGAGC	202	73	yes
GATCGTGGTCCAGAGGAGCA	39	5	yes
GATCCAAGGCGGCGACCCGA	368	8	yes
GATCGTGGGATACAGCAGCA	19	15	yes
GATCGTGGGAGTGGCAAGCG	50	7	yes
GATCGTGGGAACCATTGTCA	31	24	yes
GATCGTGGCTAGTGAGATAG	19	5	yes
GATCCAAGGACTGCGGTGCA	15	5	yes
GATCGTGGATGCTCTGGATG	20	1	yes
GATCCAAGAGGCTGTTTTCG	4	4	yes
GATCGTGAGGATGGAGAAGG	13	10	yes
GATCGTGACGGCACTGACGT	5	2	yes
GATCGTGAAGCCGCTGAATC	717	5	yes
GATCGTCTCCGTGCTGGTGA	24	2	yes
GATCGTCGTGCAGGCCACAG	25	19	yes
GATCATCCCCTGCACACAGT	580	24	yes
GATCGGACACTGGTGGGTCC	39	12	yes
GATCGTCAGGGCGTCGCTTG	22	17	yes
GATCGTCACCACAGTGGGAA	15	4	yes
GATCGTCAAGTGGTCAGATG	28	2	yes
GATCGTATCCCCAGGCGTGG	98	9	yes
GATCGTACGGCTGTAACAGG	13	2	yes
GATCCAACCATGACCAGGTG	54	5	yes
GATCGTAAGTTCTGGGACGC	6	5	yes
GATCGGTGTCGAGCACGGAC	31	2	yes
GATCCGTGACATTTTATTTG	6	5	yes
GATCGTACAGCCGGAAATGC	1	1	yes
GATCGTGGTCATCCATGAGG	15	8	yes
GATCAAAGGCAAGGGCGGTG	15	12	yes
GATCAAGCAGCAGCACGGGA	19	27	yes
GATCTGCTGCTGTTCTTTGG	665	42	yes
GATCCAGTTTGTCCTCTTAT	5	1	yes
GATCAGTCTTTTCAGTATTT	62	7	yes
GATCAGTCTTGGTTGCTTAG	573	73	yes
GATCAGTCTGAATTGAACAT	5	2	yes
GATCAGTCTATGAGTCAATA	170	10	yes
GATCAGTCGTAAAGGACTCA	24	6	yes
GATCAGTCCTCTAGCATTTC	25	19	yes
GATCAGTCCTACAAAGTTCC	169	11	yes
GATCAGTCCCTTCCCCCAAC	29	2	yes
GATCAGTCCAGTTTTGGCTG	44	22	yes
GATCAGTCATCAAAGAACAC	15	11	yes
GATCAGTCACCACTGGCACT	6271	750	yes
GATCAGTCACAGGCAAACTC	48	25	yes
GATCAGTATTGATTTGTCTG	18	14	yes
GATCGCTTTAGCTTGCCTAC	6	3	yes
GATCCAGGCTCAGTACCCAG	22	13	yes
GATCAGTAGGAAGCACAGGT	21	16	yes
GATCAGTACTGCAGTTCCTG	116	1	yes
GATCAGTACTACTGTGGTGT	245	12	yes
GATCAGTAAGGATTCCTGTA	5	4	yes
GATCAGTAAGGAAGTTCTTG	3	2	yes
GATCAGGTTTGGACTCCTTC	101	13	yes
GATCAGGTTTGCACCAAGGT	41	13	yes
GATCAGGTTCTGCCACATCT	2	1	yes
GATCAGGTGTTTGGATGGCA	4	4	yes
GATCAGGTGTTCAAAGTCAC	3	2	yes
GATCAGGTGTCAGTTTTCTA	96	23	yes
GATCAGGTGGAGACTGGAGT	20	9	yes
GATCTGCGATGAACTGGGAG	202	16	yes
GATCGCATTTCATGTGTGTG	4	1	yes
GATCAGGTCAGAGATGCGGT	246	37	yes
GATCAGGTAGAGAGAGCTTG	11	11	yes
GATCAGGGTGGAATGTGCCT	77	17	yes
GATCAGGGTCCTCCTTCCCT	42	6	yes
GATCAGGGGGAAGGGGTCAG	99	20	yes
GATCAGGGCGTGGTAGAGAA	15	1	yes
GATCAGGGCCGTGTGGATGC	68	21	yes
GATCAGGGCCGAGTGATGAG	72	8	yes
GATCAGGGCCAGGGGAGGTC	502	161	yes
GATCAGGGCCAAGGCATCCC	107	16	yes
GATCAGGGCAGAGATGGAAG	172	19	yes
GATCAGGGCAAGAGGATTGT	106	0	yes
GATCAGGGCAAAGTGGCTTT	107	6	yes
GATCAGGGACTCTTCGGTGT	38	29	yes
GATCGAGAGAAGGAGCGGCA	15	6	yes
GATCAGGCTGAGCTGAATGT	185	20	yes
GATCAGGCTACTACAAAGTT	765	27	yes
GATCCAAACACACACTAGGA	2	2	yes
GATCAGGCGACAGTGAAGAT	6	6	yes
GATCAGGCCTGAACCCGTCC	311	44	yes
GATCAGGCCCACAGCCGAGT	36	6	yes
GATCAGGCCATCAAGTCACA	68	24	yes
GATCAGGCCATACGTAGCCT	203	1	yes
GATCAGGCCAAACACTTGGG	592	2	yes
GATCAGGCACTTGAGTTTCA	3	2	yes
GATCAGGATTCAGATGTAGA	1	1	yes
GATCAGGATGGGACAGTTCC	62	36	yes
GATCAGGAGTTTAAGTGGTT	15	14	yes
GATCAGGAGTTCCAGGACAG	21	8	yes
GATCAGGAGTTACTATCCAG	26	16	yes
GATCAGGAGTCCTTTGAGTG	2	1	yes
GATCAGGAGGGTCAGCTGTG	182	11	yes
GATCAGGAGGCAGTGTGTGG	108	83	yes
GATCAGGAGCCCATTGGTGA	43	7	yes
GATCTTTCTCAAGAGCAGTG	2	1	yes
GATCAGGACTTGGTGGAAGC	158	3	yes
GATCAGGACTCCTGTGACTC	4	3	yes
GATCAGGACGGAACTCTGTG	1	1	yes
GATCAGGACCTCATTTCACG	14	10	yes
GATCAGGACAGCAAAGACAG	11885	1931	yes
GATCAGGACAAAGAAATACC	78	40	yes
GATCAGGAATGTGTGCAGCA	176	39	yes
GATCAGGAAGATGGTAGCCT	139	23	yes
GATCAGGAAGATGACTGGCA	38	29	yes
GATCAGGAAGATGAACACTT	3	2	yes
GATCAGGAAGAAAAGGCCAG	40	31	yes
GATCAGGAACTCCAGTTCAT	2	1	yes
GATCAGGAAAGTTGTGGAAG	16	13	yes
GATCAGGAAAGAAATGGAGC	44	34	yes
GATCAGCGTATGTGTAAGGA	36	8	yes
GATCAGCGGTGGGAATGACA	2685	158	yes
GATCAGCGCTATTTCCTGAG	102	16	yes
GATCAGCGCCTCCAGTTCCT	6155	64	yes
GATCAGCGATTTATTAGTAG	34	33	yes
GATCAGCCTTTTCTGTCTTG	107	31	yes
GATCAGCCTGGGCCACCTTG	170	90	yes
GATCAGCCTGCTCCTGGGGC	138	17	yes
GATCAGCCTCCATCCGCTCA	11	16	yes
GATCAGCCGTTCCTCTGGTG	37	21	yes
GATCAGCCGCTCAAGATTCT	432	86	yes
GATCAGCCCTTGAGGCAGCC	5	8	yes
GATCAGCCCTCCCCTGTGTC	324	106	yes
GATCAGCCCTAATCCTCTGG	12374	213	yes
GATCAGCCCGACTGTCTGCT	42	12	yes
GATCAGCCCATCGCAGCTTG	5	5	yes
GATCAGCCCATCCACTCTTT	90	1	yes
GATCAGCCCAGCCCATGTGA	153	28	yes
GATCAGCCCACTCAGCCTAA	19	11	yes
GATCAGCCATTTCTTGGGGT	7	0	yes
GATCTCTGACCTCCTCCCCA	217	38	yes
GATCAGCCAGTGATACCACA	11	0	yes
GATCAGCCAGTGAAGCCCCT	14	4	yes
GATCAGCCAGTCAGCATTCG	57	12	yes
GATCCTCCAGCTGCTACGCC	57	3	yes
GATCCTCAGCTGAGGAACTG	96	24	yes
GATCCAAGAGAAAGGCATAC	15	0	yes
GATCACTCCACCTACACGGA	484	134	yes
GATCAGCCACAAGATTTCAT	172	58	yes
GATCAGCCAAGGGTTCAGAG	355	69	yes
GATCAGCATTCTTGAGCTGG	144	5	yes
GATCAGCATGGTTGTTCTTC	54	4	yes
GATCAGCATAGCACATGAGT	4	3	yes
GATCAGCAGTGTCGGCCATT	110	4	yes
GATCAGCAGTGCCTTGTGTT	108	10	yes
GATCAGCAGGAACCCCACCT	28	0	yes
GATCAGCAGCTTCACATCTT	34	10	yes
GATCAGCAGCCTACGACCTT	136	4	yes
GATCAGCAGAGTGGTTATGG	37	6	yes
GATCAGCACTCTGCCTCCAA	5	5	yes
GATCAGCACTCAACCATTCT	341	39	yes
GATCAGCACTAAGACTGCTA	52	1	yes
GATCAGCACCTTGAAGAAGT	46	7	yes
GATCAGCACAGGGTCAACTA	9	8	yes
GATCAGCAAGTGACATTGAT	102	4	yes
GATCAGCAAGTCAGGAGTCA	219	3	yes
GATCAGCAAGCAGGAGTGCG	522	339	yes
GATCAGCAAAGGGGCTAATC	6	5	yes
GATCAGATTTGTCCACAAGG	27	21	yes
GATCAGATTTGGTCTATCGG	1	1	yes
GATCAGATTTCACTGAATAC	1	1	yes
GATCAGATTGTCTCTGTTCT	4	3	yes
GATCAGATGGACAATGCCAA	28	22	yes
GATCTGTGCTACTGGCCCCC	22	17	yes
GATCAGATGAGGGTGTGAGA	5	1	yes
GATCAGAGTTCTTTTGTACC	14	1	yes
GATCAGAGTGTGGAAACTAA	5	4	yes
GATCAGAGTGACCTACCTCG	27	21	yes
GATCAGAGTCGCCCTCCCAT	39	2	yes
GATCAGAGTCCACCTTTACC	9	7	yes
GATCAGAGTATTCCTGCCAG	8	0	yes
GATCAGAGGTTAGGACGTGA	71	20	yes
GATCAGAGGCTGTGACTCAA	6	5	yes
GATCAGAGGCTCCCAACTGG	334	59	yes
GATCAGAGGATGTGCCCTTG	18	14	yes
GATCAGAGGAGACTTCCTCG	14	1	yes
GATCAGAGCTCCAGGCTTGG	132	13	yes
GATCAGAGCCGAACCTACTT	36	15	yes
GATCAGAGCCAAGAAACGCC	109	84	yes
GATCAGAGAGTGTCAACTTA	47	10	yes
GATCAGAGAGAGAGAGTTTC	35	27	yes
GATCAGAGACAAGTTCATTA	21	16	yes
GATCAGACTGGTGAGAAAGC	61	9	yes
GATCAGACCTGTGGCTGAGT	172	24	yes
GATCAGACCGTTGGGTGGAC	2	1	yes
GATCAGACCCAAAGAAAAGT	118	7	yes
GATCAGACACTGACTGGTGA	7	2	yes
GATCAGACACTCCCTCACCA	11	2	yes
GATCCAGCATACTTTATCAG	20	3	yes
GATCAGAATGAACTTGCCAA	14	2	yes
GATCGGCCTTTTTGGCGATT	6	5	yes
GATCTCGTCAGGGCACTGCG	36	8	yes
GATCGGTTCCTCTTTATGTC	5	3	yes
GATCATTAGAGATGTCGGAC	10	8	yes
GATCAGCTCCTCTCGTCTGA	46	7	yes
GATCCAAGGAAGAGCCCATG	30	1	yes
GATCGGCAGCGGCTGCTGGC	23	17	yes
GATCACAGGCTACCTGTTAA	3	2	yes
GATCCTGAGCTGCACAGGAC	54	17	yes
GATCTCTCCCTCATATAACT	11	8	yes
GATCCGTCGCCACTGGGGAG	7807	1760	yes
GATCAGTAGTTGCATAGGGA	29	22	yes
GATCTTGTCAACTTCACCAA	5	3	yes
GATCCCTTCCCCACCTAGCT	22	9	yes
GATCCAGTCTGAGAAAAGCA	17	1	yes
GATCAGAAGATGAATCAGTA	3	2	yes
GATCGAAAGAGGACCCTTTG	1	1	yes
GATCAGTAGAGCTCGAGGGA	2	1	yes
GATCTGCAGCACGTAGACAG	5	3	yes
GATCAGGGTATAACTCAGTG	3	2	yes
GATCTCTGCCCTGGCACTAT	24	5	yes
GATCTGGCCATCCCAGGGGG	44	17	yes
GATCCCCAACAATGTCAAGA	38	15	yes
GATCCGCCACGACTGGAGCG	1	1	yes
GATCTTCTCCAACCGGCAGT	16	1	yes
GATCGTAAACTACTTGAGCT	38	29	yes
GATCACTAGAGCACTCCCAG	12	9	yes
GATCATACTCATCCCCTCCT	3	2	yes
GATCATTCTGGTTTCAGAAC	3	2	yes
GATCATCTTCTCTGTGTAAC	14	8	yes
GATCCAAGCCTGCTGGTGAA	4	4	yes
GATCTATCGAATCATCCGAG	2	1	yes
GATCCTTGAGAGGCAAGACG	33	3	yes
GATCAGACCCACAGTGTCAA	1	1	yes
GATCTGCTGAAGTTTATTCG	2	1	yes
GATCAGGTGGAGTTGAAGGA	34	0	yes
GATCCTGGGTAGCATTTTAG	2	2	yes
GATCGGGCTGCCTGGCGTGG	122	1	yes
GATCGGGAACAGAAAGGGCG	85	11	yes
GATCGGCGTGTGGGCCAGGC	147	36	yes
GATCGGCGCTTTCAGACTAA	2	2	yes
GATCGGATGGCCACCGGCCT	40	31	yes
GATCGCTGTTTAGGATGGCG	110	57	yes
GATCGCTGTGGCCGAAACTT	116	20	yes
GATCGCTGGGGAGTCGGGTC	382	36	yes
GATCCAAAGAGCAGGGATGG	350	13	yes
GATCCAAACTAAAGGCAGAG	7	0	yes
GATCACAGTGTACCCCACAC	9	7	yes
GATCCTGTCAACTTCAAGTT	49	6	yes
GATCTTCAGTGGGTTTCTCG	49	38	yes
GATCGCTGAGCGGTGTGCAT	37	29	yes
GATCGCTCTCATTGCCCTTT	30	7	yes
GATCATTGGGGAACGGCAGC	20	15	yes
GATCGCTACCAAGCAGTTCT	207	20	yes
GATCGCCTTCTCCACCAATT	117	59	yes
GATCCTCAGGGCCTGAGCCT	90	10	yes
GATCATGTTTGGCAAGCGGC	12	12	yes
GATCGCCTGCGCACATTACC	89	26	yes
GATCGCCTCCTCCCTCTCTT	37	4	yes
GATCATGTGCCTTCCACTTC	15	3	yes
GATCTGTTTCACCATGGTTA	88	10	yes
GATCTGTGATAAGGAGGATA	33	3	yes
GATCTGTGGTGTGGATGTTC	13	10	yes
GATCTGGTGCTGCGCGGATG	142	33	yes
GATCTGTGCAGGCCCTGGCT	3	2	yes
GATCACACTGTGAATCCTGA	3	0	yes
GATCACGCTGCGCGACCTGA	6	1	yes
GATCGCCCTGTCCAACAAGC	5	2	yes
GATCATGTCTTCCCCTCTTT	19	3	yes
GATCATCTTTCTGAGGGCTG	110	4	yes
GATCGCCACCTACCGCACCC	3468	638	yes
GATCATCTGGGAGGGGATGC	62	34	yes
GATCTGGCTGTGCGACAGAA	39	16	yes
GATCTGGCCCAAAAGTCCTG	26	20	yes
GATCCCGCCACCAGCTGTTT	73	10	yes
GATCATCTGCTTCAGCATAT	2	1	yes
GATCGCATGCGCCCCATCTG	253	2	yes
GATCGCATGAAGAAACCATG	226	25	yes
GATCGCAGTAGCCAGCGCAG	458	32	yes
GATCGCAGAGTCCGCCAACT	79	5	yes
GATCATCTCCTTCCTCACCA	4	1	yes
GATCGCAGAGACATCAAGCG	11	2	yes
GATCATCGAGCCCACCAGTC	8	6	yes
GATCTGGACCTGTGCTGAAG	110	85	yes
GATCGACGAGAACTGGTATG	27	7	yes
GATCCTTTTGCAGTCCAGAA	27	7	yes
GATCTGCTCCCTGCTGCAGG	253	2	yes
GATCTGCCTTTGTAGAAATC	64	7	yes
GATCCTTTTCCACTCCCAGG	6	6	yes
GATCCTTTGCTCCTAGTGGA	6	3	yes
GATCCTTTCTCTTGTTTTTG	95	21	yes
GATCCTTTCTACTATGATTG	5	3	yes
GATCCTTTCCTTGGACTCAC	7	0	yes
GATCCTTGTTGTGCCTCTTC	50	1	yes
GATCCTTGTCCACCCCTCCC	106	5	yes
GATCCTTGTAAGAGCCAACT	2	1	yes
GATCCTTGGGGTAAGCAGAA	60	0	yes
GATCCTTGAGGTCACGTTGC	189	16	yes
GATCCTTCTTGTGGAACAAC	20	1	yes
GATCATATAGTTTCCAGGAG	2	1	yes
GATCCTTCTCTGCTAGTTTA	2	1	yes
GATCCTCCCGCACCAAGTAG	222	17	yes
GATCTGCTTCGGAATTGGTG	4	3	yes
GATCGACCATACAGTAGAAC	11	6	yes
GATCCTGTGATGGTAGGAGT	4	4	yes
GATCCAGGTGGTGCTGGTGG	87	5	yes
GATCACCCTGCACCCCGTCA	25	19	yes
GATCCCAGACTCACCCACGT	16	3	yes
GATCCTTCTACCCACATACT	4	4	yes
GATCCTTCCTGCGGGCGGTG	30	6	yes
GATCATAAGGGAAGCAGAGC	5	3	yes
GATCCTTCAGTCCTCTTAGT	46	8	yes
GATCAGTTTGCCTTCATTCA	46	11	yes
GATCCTTACTTGGTGCAGGT	42	12	yes
GATCCTTACCCTGTCCCTGT	73	14	yes
GATCCTTAATCAGCGCACTG	10	8	yes
GATCCTGTTTGTTGACTTTG	7	6	yes
GATCAGTGTGTCTGTCTATG	81	12	yes
GATCCTGTTCCGAGCAAGCT	166	7	yes
GATCCTGTTAGTGAGCAGGG	46	3	yes
GATCAGTGCCTGGCGCCAGA	546	130	yes
GATCCGTCTTCTGGCCTTTG	3	2	yes
GATCCTGTGTGCGTTGATGA	25	3	yes
GATCAGTGAGCTCTGCAAAC	28	4	yes
GATCAGTCAGCCGCTGCCCG	29	4	yes
GATCAGTATTTTTGACTGTG	16	13	yes
GATCCTGTCTCAAGCACACC	1	1	yes
GATCCTGTCCCAGGGGCTAG	210	64	yes
GATCAGGTCTCTCCAACTCA	2	2	yes
GATCCTGTCACTGGGGAGGC	478	54	yes
GATCCTGTAAAGGCAGGGCA	47	49	yes
GATCCTGGTTGGGGGCAAGG	237	41	yes
GATCCTGGTGTTTCCACATG	15	11	yes
GATCCTGGTGGTTCACCTCA	103	18	yes
GATCCTGGTGGGGCTGTTCC	8	2	yes
GATCAGGCAGCAGAATCAGA	13	10	yes
GATCCTGGTCCCCAGCACCT	32	4	yes
GATCCTGGTAGCTCACCAAG	88	19	yes
GATCCTGGGTCCCTCGTAAG	102	1	yes
GATCCTGGGGACCCAGAATG	55	12	yes
GATCCTGGGAGCGAGGAAAC	44	7	yes
GATCGCTGCAGAGCAGAGCA	19	18	yes
GATCCTGGCGCTGGCTGTCC	27	7	yes
GATCCACGCACATTCTCACC	4	4	yes
GATCCTGGAGTTTTCTACAG	11	1	yes
GATCCTGGAGGAACCTTCGC	17	1	yes
GATCCTGGAGAACACTGGTT	42	11	yes
GATCCTGGACGAGGCCACCA	144	38	yes
GATCCTGGACCGCCACAATT	26	18	yes
GATCCTGGAATTGGCTGGTA	5	3	yes
GATCCACGGGAACGACAAAT	5	3	yes
GATCCTGGAAATGGACAAAG	9	1	yes
GATCCTGCTGTAGCTGCGCC	54	11	yes
GATCCTGCTGACACGGTGCG	191	48	yes
GATCCTGCTCCGGCTCCTGC	12	3	yes
GATCCTGCTCCAGGAGATTG	37	6	yes
GATCCTGCTAAGCACTGAGG	300	6	yes
GATCCTGCGGGCTGAGGGCC	40	5	yes
GATCCTGCCTCAGAGCCATG	5	4	yes
GATCCTGCCCTGGGGTGAGG	197	19	yes
GATCGCCAAGTTCAAAGCTG	12	2	yes
GATCAGGATGTGGAGGAGGA	6	5	yes
GATCCATTCGCAACTTGGCT	5	0	yes
GATCCCAACAATGCAGCCAT	205	1	yes
GATCACCATTTCCGACTCTG	19	18	yes
GATCACCAGAAAAGCAACTG	182	36	yes
GATCAAGGTGGGAGGGAAGA	35	12	yes
GATCAAGGCTTCCTGGAGGA	1	1	yes
GATCTCTCAGACACTGACCT	1	1	yes
GATCAGAAGTTCAGGGTTAT	30	1	yes
GATCAGAAGTTCAGGGTCAA	50	8	yes
GATCAGAAGTTCAAGGTAAT	2041	102	yes
GATCAGAAGTTCAAGGCCAT	12	9	yes
GATCAGAAGTTCAAGGCCAG	53	19	yes
GATCAGAAGTGCCTCCTTGT	4	3	yes
GATCAGAAGTAGCCAAGTAG	5	4	yes
GATCAGAAGGAGATACTCTG	36	5	yes
GATCAGAAGCTGGAGGGTGT	36	28	yes
GATCAGAAGCCACAGGCAGG	8	6	yes
GATCAGAAGAGAGCGGACTA	5	3	yes
GATCAGAACTGGGTGCCAGC	49	2	yes
GATCAGAACTGGACAGCTCC	77	33	yes
GATCAGAACCCAGCCGAGTG	135	29	yes
GATCAGAACCAAAGGCAGGG	22	3	yes
GATCAGAACTAGCTAGTGCC	4	3	yes
GATCTTGCTGCGATTCCGCC	3	2	yes
GATCAGAACATCTCTGGCTA	3	2	yes
GATCAGAACAGACAATAGGT	12	9	yes
GATCAGAACAACAGACAGTG	167	48	yes
GATCAGAAATGAGGTGTAAC	78	12	yes
GATCAGAAAGGAAGGGATGG	38	3	yes
GATCAGAAAGGAAATGAGAG	3	2	yes
GATCAGAAACTGTCCTCTGA	10	8	yes
GATCAGAAACATGCCCAAGT	206	4	yes
GATCAGAAACAACTGTGTCT	97	24	yes
GATCAGAAAAGTCTCGACTA	22	17	yes
GATCACTTTTGTATTTGTTG	4	4	yes
GATCACTTTGCCAAATAAAT	10	10	yes
GATCACTTTCTAGGTTCCTA	67	6	yes
GATCACTTGTTTGTGGTGAG	430	1	yes
GATCACTTGTCAGTGTTCAG	41	31	yes
GATCACTTGGCTTTTCTGGG	16	5	yes
GATCACTTGGCGGTGACTTT	131	14	yes
GATCACTTGCTGAAATGAAT	5	1	yes
GATCACTTGATTTCTTGTGC	29	10	yes
GATCACTTGAGTTCTGGTAG	32	6	yes
GATCACTTCTCTGGTCTCCA	27	21	yes
GATCACTTCGGCCTGTACAC	88	27	yes
GATCACTTCGCCCTTTTTTG	51	2	yes
GATCACTTCCCAGGGCCTGT	58	11	yes
GATCACTTACTGCCTAATGC	60	4	yes
GATCACTGTTTTTCTGTTTG	2	0	yes
GATCACTGTGTTGGACACTC	510	53	yes
GATCACTGTGTACACATTGG	81	26	yes
GATCACTGTCTGGAACCACA	15	6	yes
GATCACTGTCTCAGGCCTTT	20	3	yes
GATCACTGTCCCCCTGGGAA	14	8	yes
GATCACTGTATGTTTGAGAG	1	1	yes
GATCGACCACATCCTGGATG	101	65	yes
GATCGGGAGCGAGAGCGAGA	22	17	yes
GATCACTGGTTCAGCGTTCA	388	59	yes
GATCACTGGTGTTTCCCATT	40	11	yes
GATCACTGGTGGCATCGCTG	6	5	yes
GATCACTGGTGGAGAAAAGA	25	19	yes
GATCACTGGTCTGTGACCTA	1	1	yes
GATCACTGGGTGTGTTTCAG	110	85	yes
GATCACTGGGAACAAACGGC	361	123	yes
GATCACTGGCTGAGTAGATG	111	32	yes
GATCACTGGCACCAAAGAAG	17	13	yes
GATCACTGGAAACGATTGCT	103	7	yes
GATCACTGCTCAAGCCTGGG	72	3	yes
GATCACTGCGTTAATCTTGG	118	30	yes
GATCACTGCGAAGTTTCGTT	80	33	yes
GATCACTGCCCCTGTGGCTC	2	1	yes
GATCACTGCAGGGGGTGCCA	722	70	yes
GATCACTGCAGGCGCAGCGG	990	45	yes
GATCACTGCAACCTTGTGCT	91	6	yes
GATCACTGATTCAGAGCTCA	84	16	yes
GATCACTGATGGCCAGAATG	61	3	yes
GATCACTGACCTTGGAGCTT	54	19	yes
GATCACTCTGGCCGCTCTTC	880	27	yes
GATCACTCTGGCCAAGTAAG	100	13	yes
GATCACTCTGGAGTTCAGCG	891	82	yes
GATCACTCTCTGCATCGCTG	14	11	yes
GATCACTCGGAAATTCAGGC	51	49	yes
GATCACTCCTTTTGAGGAAA	283	54	yes
GATCACTCCCTGCCTGAGCC	311	4	yes
GATCACTCCAAGTTGACATT	2	3	yes
GATCACTCAGTGAACAATCC	5	4	yes
GATCACTCAGCAGCCAGGAC	301	2	yes
GATCACTATGTCCAGGCTTC	55	2	yes
GATCACTAGTGAGAGCTGAA	13	10	yes
GATCACTAGTGACTGTTGGG	78	33	yes
GATCACTAGGTCATTTTGTT	8	6	yes
GATCACTAGCTTCGAGGAGG	264	14	yes
GATCTGTTGGAACCAGGGCC	18	14	yes
GATCACTACCCATCCTTAGC	12	2	yes
GATCACTACCATGAAAACGC	41	5	yes
GATCACTAATGTGGAGCAAG	10	8	yes
GATCACTAACATTCCCCGTA	26	5	yes
GATCACTAACAGTTTGCATA	30	11	yes
GATCACGGTTTTCTCTGTAA	166	9	yes
GATCACGGTTCAGATTCGTT	17	2	yes
GATCACGGTGAACCCCCAGT	228	48	yes
GATCACGGTCCCGTGACCGC	57	5	yes
GATCACGGTATTTGACCGTG	25	9	yes
GATCACGGGAGAAGTACAAG	1	1	yes
GATCACGGCTTCTCAGCCGA	30	1	yes
GATCACGGCAGTGGATTGGG	44	5	yes
GATCACGCGTCCAGATGTGC	65	20	yes
GATCCTGTGGACCGGGCCTT	1	1	yes
GATCACGACCGATACAGTGA	44	5	yes
GATCACGAAGGAGGAGCTGG	3	2	yes
GATCACGAAGATGTTGGGCG	34	26	yes
GATCACCTTTGTCTGATAGC	49	5	yes
GATCACCTTTCTGCAGATGG	6	6	yes
GATCACCTTGCTGGCATCAG	136	12	yes
GATCACCTTCCTGTCTCATC	83	3	yes
GATCACCTGTTTCGCTGTGG	2120	82	yes
GATCACCTGTAAATGGCCAC	56	43	yes
GATCACCTGGGCCAGTCCAG	24	18	yes
GATCACCTGGGACTCTAAGC	14	1	yes
GATCACCTGCTCTTTTCCTC	30	23	yes
GATCACCTCTTAGGGATGGT	9	2	yes
GATCACCTCTGGGCCTAATG	90	7	yes
GATCACCTCTGCCAGCTCTC	49	4	yes
GATCACCTCTCATCCATGTG	1	1	yes
GATCACCTCAACGTGGGTGT	160	31	yes
GATCACCTAGGAGAGCCACT	35	14	yes
GATCTGTGTGGCGAAGAGCA	1	1	yes
GATCACCGTTTCAAGGCCCA	96	30	yes
GATCACCGTGTTTTCGTGGT	14	2	yes
GATCACCGGGGATGAATTCT	19	1	yes
GATCACCGGGAGGGAGACAG	42	8	yes
GATCACCGCTCACCTTTCCA	27	9	yes
GATCTTTTGTCATGACTCAC	16	5	yes
GATCACCGACCGCATCGAGA	3727	500	yes
GATCACCGAACTAGACACAG	60	15	yes
GATCACCCTCAGGTGCAGGT	197	37	yes
GATCACCCCCTTCCCTCTGT	342	55	yes
GATCACCCCACAGTGAGGCG	111	42	yes
GATCACCCCAAAGCCTTCAA	342	7	yes
GATCACCCATTCTTGTGATA	33	25	yes
GATCACCCAGAAGTGGCTCT	464	93	yes
GATCACCCACATTGGGTGAG	16	13	yes
GATCACCATTTCCGACTGTG	3793	9	yes
GATCACCATTCCGGTTACTT	156	1	yes
GATCACCATCTAGTGAGTCG	220	4	yes
GATCTGGGAGGGGAGCACCC	15	11	yes
GATCACCAGTTGGTGCTGTT	6	5	yes
GATCACCAGGGGCTGATGGG	246	99	yes
GATCACCAGGATTGGTGCAC	22	22	yes
GATCACCAGGAAGAAAGAGT	5	3	yes
GATCACCAGGAACTTCTATG	3	2	yes
GATCACCAGCCTGAAGCTGA	68	6	yes
GATCACCAGCAAACAGCTTT	280	74	yes
GATCACCACCAGGACGCTGA	176	28	yes
GATCACCAAGGTTGATGCAC	566	177	yes
GATCTGGTCTGCTCAAGGCA	3	2	yes
GATCTGGTCCGGCAAGACTC	46	35	yes
GATCCGGGCTCTAGACAGCG	29	0	yes
GATCACCAACACCAGGCCGC	21	20	yes
GATCACCAAAGGGGACTTTG	65	25	yes
GATCACATTTGCTTTGTGTT	4	1	yes
GATCACATGTAGTGGGGAGG	101	25	yes
GATCACATGGCTGGATGTGA	34	23	yes
GATCACATGAACGTCTCCTG	5	4	yes
GATCACATGAAATCTTGGAA	6	9	yes
GATCACATCTATGAGAAGTT	4	4	yes
GATCAGGGCTTTGGAGTACA	12	2	yes
GATCTGAAGAGGGGTGAGCT	26	20	yes
GATCACATCAAAGGATGATG	209	15	yes
GATCACATATTCCAAAAGTT	19	5	yes
GATCACATACGCAGGAGTGG	54	22	yes
GATCACAGTTGCTACTGCCT	9	9	yes
GATCACAGTTCCAGGAACAG	253	20	yes
GATCACAGTGCGTGCCTGGC	114	29	yes
GATCACAGTGAATCATTCCA	4	1	yes
GATCACAGTCTTCCATTTCA	5	2	yes
GATCACAGTCCTTCCTCTGG	210	27	yes
GATCACAGTATTGTCTCAGA	39	10	yes
GATCACAGTACAATAGCTCA	29	7	yes
GATCACAGGTGTGCATACCA	9	8	yes
GATCACAGGTGCTCTTGCTG	29385	1739	yes
GATCACAGGGATGCGGCGTC	95	29	yes
GATCACAGGCAGTCCAGGGG	178	18	yes
GATCACAGGACTCTTTCCCT	100	4	yes
GATCACAGGAAGAGACCAAA	1	1	yes
GATCACAGCTTAGAGAATGT	2	2	yes
GATCACAGCTCAGTTCCTAT	31	7	yes
GATCACAGCGTTCGTGCCCA	86	26	yes
GATCACAGCGGAGTTAGCTT	46	0	yes
GATCTTGTTGTGAGTGTTTG	25	24	yes
GATCTGGCACCCCGCAAATG	9	7	yes
GATCTGGAAGTGTGGGAACG	213	25	yes
GATCCCGTTGAAACTGCTGC	213	2	yes
GATCATCCAGAGGAAATTAA	6	5	yes
GATCCACGTTGAGGTGCATG	83	9	yes
GATCGTCGCATGGCTCTCCC	50	20	yes
GATCTTGACACGAAACTGCC	9	7	yes
GATCGGAAATCAGTGTACCG	12	9	yes
GATCTGCTGCTGGTCTTTCT	6	6	yes
GATCTAAGTTCAGTTCCCAG	3	2	yes
GATCTCAAAGACGGAATTAG	26	20	yes
GATCCCCTTCTACCTACTCC	138	2	yes
GATCACTGTGTGGTCTCTCC	826	534	yes
GATCATCTCCGACTTTTCAT	3	2	yes
GATCTCTTTAGTCCCAATCC	46	35	yes
GATCGTGCCCTGTACGAGCA	6	1	yes
GATCTCTGCGGCGCTGTAAC	1	1	yes
GATCTCTGCACAATGTGAAC	98	5	yes
GATCAAGCCGAACCCAAAGC	5	0	yes
GATCACCTGTCCACTGCCTC	1	1	yes
GATCCATCTGTGTAGTTTCT	87	18	yes
GATCTCCAGTGTATTCCAAC	39	15	yes
GATCTCATGTCAGGTTCCTG	11	8	yes
GATCTCACCATGTAGCCCTA	3	2	yes
GATCTATCAAAACTCCTCAA	149	2	yes
GATCGTTTGTGGCCACCAAT	85	11	yes
GATCCAGTTTTGTTTGGACC	37	9	yes
GATCGTGGGATATCCGGAAT	187	17	yes
GATCGTGGAGCAGGTGGTGT	5	4	yes
GATCGGTTCTGCCACGTGCT	18	4	yes
GATCGGTGGAGCTCGGGGCG	18	4	yes
GATCGGAATGAAGGGGGGGA	3	2	yes
GATCGCTGTGAAGATGGACT	71	10	yes
GATCGCTGGTCCAGTCAGCA	105	20	yes
GATCAAAAGGTCAAGGTCGT	9	1	yes
GATCAAAAGCGTCCAGATTA	26	20	yes
GATCGCTCAGGAGAGTAGAC	32	24	yes
GATCGCCCCTCGGCAGGATG	5	5	yes
GATCCTGATTGCCTGCCCCG	59	61	yes
GATCCTGATGCAAGGCTGGC	94	4	yes
GATCCTGAGTGAGTGTGAGG	143	19	yes
GATCCTGAGTCAGAGAGCTC	14	1	yes
GATCCTGAGGCTACGGGGAC	136	29	yes
GATCCTGAGGCCTGTGAGAA	5	4	yes
GATCCTGAGGAGGGGTTTGA	7	6	yes
GATCCTGAGGACAGGAGAGG	475	43	yes
GATCCTGAGCCACAGAGCTG	161	1	yes
GATCCTGAGCAGGTTGGGGA	4	3	yes
GATCCTGAGAGTGTCACTGT	12	11	yes
GATCCTGAGACACAAAAGGT	31	0	yes
GATCAGATACCTGCCGTTGG	5	3	yes
GATCCTGAGAAAATCAGGGC	204	24	yes
GATCGATGCTTCTGCTCCAC	16	13	yes
GATCCTGACTTCTAGCTGTG	649	21	yes
GATCGAGTGGACCGCGACAA	4	3	yes
GATCCTGACCGAGCGTGGCT	62	12	yes
GATCGAGCTGCGCTGTGGCC	4	3	yes
GATCCTTTTGTTGGACGAGG	90	20	yes
GATCCAGGCTCGGGAGTGCC	27	1	yes
GATCCTGACCAGGGGGAGTC	66	64	yes
GATCCTGAATTGCTGGAGAG	11	2	yes
GATCCTGAAGTCTGCAGACC	281	35	yes
GATCCCGGGGCTGTAACTGT	136	24	yes
GATCCTGAAGATGTGGACAC	112	14	yes
GATCCTGAAGATGAGGTTCC	4	3	yes
GATCCTGAACCCACCCCCGT	44	15	yes
GATCCTGAACACTCCTGGGG	6	5	yes
GATCCTGAAACGACAGTGGT	347	7	yes
GATCCTCTTGTCTGCTTCGC	831	199	yes
GATCCAGGACCTGGTAGCAA	141	6	yes
GATCCAGGAAGTTGGTGAAC	336	29	yes
GATCCTCTTCTCCGCGTGCC	107	8	yes
GATCCTTCCCCCTCAGCTCC	23	9	yes
GATCCTCTTCCACGAGACAC	3760	58	yes
GATCCTCTGGCCCACCTGTC	9	7	yes
GATCCTCTGGCACGCCTGGC	65	63	yes
GATCCTGGATTCCCATCTCC	26	10	yes
GATCCTGGACAAGATTCTCG	55	2	yes
GATCCTGCTGTGCCAGAAGA	55	3	yes
GATCCTGCTGGGCAGCGTGT	1	1	yes
GATCCTGCAGGGCCGGGTTG	7	4	yes
GATCCTGCAGAGGCTAGAGG	132	39	yes
GATCGGCCTGCGGAAGAAGG	21	16	yes
GATCACTTTCCTCCCACGTG	68	4	yes
GATCCTCTGAAAAACCAAGA	40	39	yes
GATCCTCTCGACCTGCTTCG	14	14	yes
GATCCTCTCCAAGGAGGAGC	36	0	yes
GATCACTGTGGCCCCACCAA	32	24	yes
GATCCTCGTTCCTTGTCCTA	11	12	yes
GATCCTCGGGGTGCCAGCCA	148	6	yes
GATCACTGAGGATGGCTGAC	77	3	yes
GATCCAGCAGGTCCAGCAGC	1	1	yes
GATCCTCCTCGTGTTCTCCA	21	2	yes
GATCCTAGGAAACAGTTCCT	19	1	yes
GATCCAGCAGCGCAGGCAGG	19	1	yes
GATCACGTTCTGCTTGGAAG	1	1	yes
GATCCTCCTGCCCGTGGGGG	59	9	yes
GATCACGTGACCACAGCCCC	120	28	yes
GATCCTCCTCCAAGTCTGAC	6	3	yes
GATCACGACGTTGGCTTTCC	10	0	yes
GATCCTCCCGTATGCCAACC	92	8	yes
GATCCTCCCCTGGCCTCAGT	118	35	yes
GATCCTCCCCTGCCCTACAC	276	17	yes
GATCCTCCCCGCTCGCTCAC	139	24	yes
GATCCTCCCCCTCTGTCTTT	68	6	yes
GATCCTCCCAGACCCTCTGA	187	31	yes
GATCCTCCATTATTCCTTAG	10	8	yes
GATCCTCCAGTCCCAATGAG	14	10	yes
GATCCTTAGTGTGCTCACGG	1	1	yes
GATCCGAAGCGGGAGGTATG	5	1	yes
GATCCGAACTTGACGCCGAC	23	3	yes
GATCCGAACACAGTTGACTT	80	1	yes
GATCCCTGTCCAGCGGTGTG	8	6	yes
GATCCCTGGAACCCACACTG	12	1	yes
GATCCCTGCTGCTCTCGAAG	3	0	yes
GATCCTCATCATCGCGGGTA	173	132	yes
GATCCTCATCAGTGTGGCCA	77	20	yes
GATCCTCAGGGACACCACCT	9	9	yes
GATCCTCAGGAGTCAGTATT	56	16	yes
GATCCTCAGCCTCCCAGAGC	1219	85	yes
GATCCTCACTGTGAAAGACA	10	3	yes
GATCCTCACTGAGAAGGAAC	44	2	yes
GATCACAGTTCCTTATTGTG	36	28	yes
GATCCTCACACCCTGTTCCC	35	36	yes
GATCACAGTCAATGACCTAC	9	7	yes
GATCCTATCTCGCCCAGTGA	139	17	yes
GATCCTAGTGCAGGAGGGGG	12	1	yes
GATCCTAGTCCTTGCCCCGT	98	17	yes
GATCACACTTACCAGTCAGC	797	82	yes
GATCCTAGCCAGATTACTAG	5	3	yes
GATCCTAGCAGCGGCGGTGG	116	11	yes
GATCCTAGAGCACTTGAGGA	12	1	yes
GATCCTAGAGACAGGCCATC	34	8	yes
GATCCTAGACTCTCCTTGTT	47	22	yes
GATCCTAGAAGTGGTCCTTG	12	9	yes
GATCATTCAACTTCATGTTG	1	1	yes
GATCCTACTTTTGACAACTC	3	2	yes
GATCCTACTTTCAGCTGCTC	26	20	yes
GATCCTACTATTAGTCCACA	5	0	yes
GATCCTACGCAGGGGGGACT	302	49	yes
GATCCTACCTGCTCATCTGG	54	8	yes
GATCAATTTGCCACCGTGGT	32	4	yes
GATCAATTTCAGGGCTTTTT	1	1	yes
GATCCTAAGGCCTCACGTAG	1	1	yes
GATCCTAAGCAAAGGGACTC	218	34	yes
GATCCTAACTTGGAAACTGT	12	3	yes
GATCCTAACCACCCAGCCAT	12	11	yes
GATCCTAACACTTCTACAGA	2	2	yes
GATCCTAAATGTGTGGAAGA	6	5	yes
GATCCATGTCCCCCTCTAAC	15	6	yes
GATCATGTGTGTAGCCAGAA	62	10	yes
GATCAATGAAGAACCGGACG	5	3	yes
GATCCTAAAGACTTCCAACT	27	11	yes
GATCCTAAAGACTCCCCAGG	51	5	yes
GATCCGTTTCTCTCTGCCTT	128	4	yes
GATCAAGTTTCCATCCACAG	12	9	yes
GATCCGTGTGAGGTGTGCTG	191	34	yes
GATCCGTGTGAAACTGAATG	20	21	yes
GATCAAGTCTTGTCATAGCT	273	9	yes
GATCCGTGTCATTCACACAC	38	23	yes
GATCCGTGCCCTGTAAAGTG	39	14	yes
GATCCGTCTGCCCTTTGCCT	5	7	yes
GATCAAGAAACGACAGAGAG	22	17	yes
GATCCGTCGTTACCAGAAAT	15	7	yes
GATCGGGCGGGCTGTGTGGG	26	6	yes
GATCCGTCGGTGCCTGCTGG	1445	287	yes
GATCCGTCCATGTCTGCCAC	38	3	yes
GATCCGGTCCCAGCCCCCGA	105	54	yes
GATCCACATTAACCGTGTCT	2	3	yes
GATCGCTTGCTCACCTCCCT	270	28	yes
GATCCGGGCTGCACATCAGC	6	6	yes
GATCCGGGATGTCGAAGAAC	52	1	yes
GATCCGGGACAGGACGGTCT	448	18	yes
GATCCGGCTTCCCAAGAGTA	12	13	yes
GATCAACCTGGAGTTGTATG	22	9	yes
GATCTTTCTTTGGTCAGGAA	37	3	yes
GATCTGGAAGTGAAAGCTCC	1	1	yes
GATCCGCTGGGAGCTCACAC	346	43	yes
GATCGCACTTTGCACATCGA	1	1	yes
GATCCGCGGGGCTCAGTGTG	366	78	yes
GATCCGCGGGCGTAAACGCT	89	26	yes
GATCCGCGAGTACACGGCAG	65	6	yes
GATCCGCGAGTACACGGACA	26	16	yes
GATCCGCGAGCCTTTGGCGA	36	4	yes
GATCCGCCTGTCTCTGTCTC	5	3	yes
GATCCGCCTCTTCCTGGTCA	227	10	yes
GATCCGCCTCTCACCAGCCA	77	40	yes
GATCCGCCGTTCTCTGGAAC	12	9	yes
GATCCGCCAGGACCGAGAAC	16	13	yes
GATCCGCAGTTACATCAATG	137	12	yes
GATCCGCAGTGTCTTGGATG	83	34	yes
GATCCGCAGGCGCAAGGCCC	5272	183	yes
GATCCGCAGCCGCCTAACTG	565	36	yes
GATCCCCGCGCAGAAGTAGG	295	6	yes
GATCTGCTCTGTGGTGAACG	220	14	yes
GATCTGTCACGATTCTGTGT	3	2	yes
GATCTGGTGTCTGGAATCCT	14	2	yes
GATCTGGGCTTCCTGGGTGA	93	6	yes
GATCTGGGCTGTCACTACGA	36	3	yes
GATCTGGCTTCCTGCTGCTG	2	1	yes
GATCTGGACAGCAAACTCGT	44	10	yes
GATCTGCCCAGGGAAAGGGC	4	3	yes
GATCCTTCTGTCTCAGCCTT	5	4	yes
GATCAGACAGAGGTCAGAGG	16	9	yes
GATCATTCACTGTGACACCC	21	12	yes
GATCTATGAAAGACGCTGAC	7	0	yes
GATCGTATTTTGTTGGTGAA	5	4	yes
GATCGCTGCATTTTGGCAAT	3	2	yes
GATCGCCCCGACTTCCTGAC	1	1	yes
GATCGAGAGCGTGGATGACT	24	24	yes
GATCGACCGCATGGTCAGCC	20	5	yes
GATCCTTCTTGCTCATAAGC	70	5	yes
GATCCTGTCCCACAAAGGAA	148	21	yes
GATCCTGGCCACTGTTTTTG	14	1	yes
GATCCTGACACCTACACTCA	4	4	yes
GATCCTCCCCACGTAACCCA	38	13	yes
GATCCTGATGCTGCCAAAGC	1013	104	yes
GATCTGAGGGTGTCGTGGGC	41	3	yes
GATCCCGAAGTCTGTGACGC	294	66	yes
GATCCCGAACTGTTCAAACA	3	2	yes
GATCCCATCCACCATTCTGC	28	14	yes
GATCCCAACGAACCCACATA	127	6	yes
GATCGAGCGCTGCTTCCCTA	23	17	yes
GATCTCAGCTTTCAGCAGCT	15	11	yes
GATCCAGGTGTCAGAGCGAG	4449	55	yes
GATCTGACGGCCATAGGCAC	70	20	yes
GATCCAGTGTGGAGAGAAAT	5	5	yes
GATCCAGGAGTAAGTTAGAG	44	0	yes
GATCCAGAGTGGAGAGTGTT	25	12	yes
GATCGGCCGGAGCCCTTCCC	116	7	yes
GATCCCTGTGGAGATGCGCA	11	7	yes
GATCCACGCCGCTCACGTAA	8	10	yes
GATCCAAGTTCAATTCCCAG	29	0	yes
GATCCAAGCACTGACACTGG	106	15	yes
GATCATGGTCCTCACTGTAG	5	0	yes
GATCTCCCACGTCTGGCCCA	116	69	yes
GATCCCCGGTTCTGCAGCCC	24	8	yes
GATCCATCGGTCGTCAAGCC	5	0	yes
GATCATATCCACCCTCCCAC	3	2	yes
GATCCATTTCCGGGTTGGTA	41	5	yes
GATCTCATTGGACCTTCAGC	48	37	yes
GATCAGTGCTACCATGGACC	8	6	yes
GATCAGCTGGGAGACCATAA	10	8	yes
GATCTCATTTCAGAAGAACG	44	6	yes
GATCTATGGCAGAAGTCCAG	32	24	yes
GATCTATGGCACTGGCTTGG	37	29	yes
GATCCTCTACACATCTGCTT	8	0	yes
GATCCCTCAGAAGAGATTGA	24	8	yes
GATCCCGGCTAGTCGGACCC	17	13	yes
GATCCACTCCAAGTCGCACA	31	8	yes
GATCACTACAACCATGTTAG	26	8	yes
GATCCACTCCCTGTACCGCC	57	2	yes
GATCCCAAGTACTGCCTGAA	659	176	yes
GATCCCCAAATTGCTGGAAC	11	2	yes
GATCCCATCTGGCATCTGTC	34	10	yes
GATCCCATAAGCGTGCCCCC	20	1	yes
GATCCCAGGTTTGGATGTAT	6	1	yes
GATCCCAGCGGAGTGGAACA	90	13	yes
GATCCCAACTACAAGCAGCA	32	20	yes
GATCCCAACGAGATTTGTGT	31	5	yes
GATCAATGCTACCGCCAAGG	260	19	yes
GATCCATGCTAGAAGCCCAG	3	2	yes
GATCAAGAAAGATGAACAGG	34	26	yes
GATCCATGGCACCAAACCAC	634	89	yes
GATCCAGTTCCAGGATAGCC	52	16	yes
GATCCAGTGGGAAGCGCGGA	5	3	yes
GATCCAGGTTCCATTCCCAG	147	22	yes
GATCCGGTCCCAAGACCGAT	4	4	yes
GATCAACAACAGGGCATCGG	139	86	yes
GATCCAACTTGTGCAAGCCT	27	4	yes
GATCCACTAACTGGGCAAAC	22	23	yes
GATCCACCACCACATCCCAG	48	37	yes
GATCCTGACTATGTCAGAAT	72	7	yes
GATCCTGAACATGAAGTAGG	11	1	yes
GATCCCTGTGGATGGAGGTC	5	4	yes
GATCCACACGTGTGTGAACA	11	6	yes
GATCATTGTGGAAGTGTTTG	47	6	yes
GATCATAGCTGCAAACCAGG	6	1	yes
GATCCCTCCAATCCGGAAGT	26	10	yes
GATCAGCTATGCTAACCTTT	10	0	yes
GATCCGCTCCGGGAACAGCG	9	7	yes
GATCAGTCCTTAAAGGGAAC	15	0	yes
GATCTCAGGCTGAGCAAAAT	20	15	yes
GATCCGCACCAAGGTCATGG	1	1	yes
GATCCGCAAATACGGGCTGA	142	20	yes
GATCAAAAAGCGGAGAACAA	25	5	yes
GATCAAAAACAAGGGGCTGT	6	5	yes
GATCCGAGGGAGGCATACCG	7	8	yes
GATCCGAGGCACCAGCTACC	114	29	yes
GATCCGAGCCCCAGCGGGAA	287	89	yes
GATCCGAGATATACGCAGGA	210	26	yes
GATCCGAGAGACCAGCCAGA	521	127	yes
GATCCGAGACCTGGCAGAGC	525	132	yes
GATCCGAGAATTCCAGGACT	50	6	yes
GATCCGACTGTGCCCGGATG	45	0	yes
GATCAGGGCCAGCTGTTGCT	44	17	yes
GATCAGGGATAACCAGTGAA	36	27	yes
GATCCGACTGACCAATGTGG	7	2	yes
GATCCGACTCCAGTGCGGAC	1	1	yes
GATCCGACGCACCAGCATCG	46	19	yes
GATCAGGACTTGAATTTCAT	1	1	yes
GATCCAGCCCTTGCCTAGAG	4	1	yes
GATCCCAGCAAATAAACCAG	15	11	yes
GATCAGTACCTGGGAAGTAC	6	3	yes
GATCCAGCCGGAACCTGTGG	19	2	yes
GATCCGAATCCCTGCAATCA	12	9	yes
GATCCGAAGGGCGGCCGCTG	224	22	yes
GATCAACCACCCAGACCACA	5	4	yes
GATCCGAAGAAACTGGCTGC	4	3	yes
GATCCGAACCACTGCCAGAG	25	19	yes
GATCCCTTCTGGTGCACACT	26	19	yes
GATCCCTTCTGGGACTCCCC	137	7	yes
GATCCCTTCTAAGTGCCAGT	42	6	yes
GATCCCTTCCCTTCCTTGTG	42	14	yes
GATCCCTTCCCTGATGTTGG	22	2	yes
GATCCCTTATCGAAGTGTCT	12	3	yes
GATCCCTGTTGCAGGGATTA	19	15	yes
GATCAGCTTTGAAGTTTCTG	38	25	yes
GATCTTTAACAAGCCCGAGT	40	31	yes
GATCCCTGTGGACAACAAGG	22	7	yes
GATCCCTGTCAAGTGGACGG	1	1	yes
GATCAGCTGTCCCCGAAGCA	767	23	yes
GATCCCTGGTTGCTCCCTCT	64	19	yes
GATCCCTGGTGCTGCAGTGG	36	14	yes
GATCCCTGGACACTTACATT	67	8	yes
GATCAGCCTGCCGGCCAAGC	26	8	yes
GATCAGCAGAAACTGCTCAC	4	3	yes
GATCCACATGTCACGGAGGT	62	2	yes
GATCCACACCACTGGACCCA	3	4	yes
GATCCAATGAGGCCCCACAA	12	1	yes
GATCCCTGCTTCCAGCTTCG	127	16	yes
GATCCCTGCTGGGTACTTGA	337	118	yes
GATCCCTGATGCAAGCTGGC	139	22	yes
GATCCCTGAGCTCCGAGCAG	23	17	yes
GATCCCTGAGCTCATTCCCA	64	29	yes
GATCCCTGAGAAAATAAGCT	1	1	yes
GATCCCTCTCTTGCTGTAGA	6	6	yes
GATCCCTCTCCACAGGGTCT	71	24	yes
GATCCCTCTCACAGGCTTCG	9	1	yes
GATCCCTCCCAGAAACCTGT	7	10	yes
GATCCCTCACTGTGGTAGGA	96	8	yes
GATCAGAGCCAACTCCCTCG	26	20	yes
GATCCCTCAACACTGAGTCC	9	9	yes
GATCTGTGTGCAAAGATTTG	6	5	yes
GATCAGACTTTCCAGCCCAG	1	1	yes
GATCCCTAACCCTGGGCTGG	185	2	yes
GATCCCGTTGAGAAGGTCAT	4	4	yes
GATCCCGTGTATGTTATGAC	73	6	yes
GATCCATCTGCCCATGTCAG	23	1	yes
GATCACTTTGTGCAAATCTC	5	4	yes
GATCACTGGGAACAAAACGG	4	1	yes
GATCACTGACAAGAAATAGG	20	15	yes
GATCCAGGGGCCTGGTGACC	2	1	yes
GATCCAGCTCAGATAGACTG	2	1	yes
GATCCCGTATGCTTTCCACC	10	2	yes
GATCATTGCTCAGGGAGATT	1	1	yes
GATCCCGGTGTATCATGGCA	80	35	yes
GATCCCGGTGGTGACCGTGA	101	31	yes
GATCCCGGCTCCTTCCTCCA	1	1	yes
GATCCCGGCAAGAAGAGCAC	71	10	yes
GATCCCGCCAATTACAGAGA	199	2	yes
GATCCCGCAGTGGCAAGGTC	247	69	yes
GATCCCGACACGGACTCTGA	4	4	yes
GATCCCGAATTTTCCTAAGG	148	9	yes
GATCCCCTTACAGCTGGCAT	61	2	yes
GATCCCCTGACCCTTTGTGT	30	3	yes
GATCCCCTCCCCTGGTGAAC	61	6	yes
GATCACCAACAGCATGCAAT	28	6	yes
GATCACATTGGGAGTGTGAG	3	4	yes
GATCCCCTCCCATAGGTAGC	6	6	yes
GATCCCCTCAGGTTGAGGGA	26	17	yes
GATCCCCTACAGTTTCTTCA	13	10	yes
GATCCCCGGAGTTTGCTGGC	5	2	yes
GATCCCCGCTGTGGCAGCCA	11	1	yes
GATCCCCCTTTTCAGCCCTG	122	34	yes
GATCCCCCTTACAAACACCA	3	2	yes
GATCCCCCTCTGGGAGAGCC	50	22	yes
GATCCCCCTAAATCCAGGAA	9	3	yes
GATCCCCCCTCTGGAAGGCG	29	0	yes
GATCCCCCCGGAGGACTACG	10	0	yes
GATCCCCCCAGATGCCGTTG	68	6	yes
GATCCCCCAGTTGTCACCCT	85	10	yes
GATCCCCATTGCTCCCCAGT	47	49	yes
GATCCCCATCTCCATCAACA	126	2	yes
GATCCCCAGGGCCTCAATGA	7	7	yes
GATCCCCAGGATTCGGAGAA	115	11	yes
GATCCCCAGCCGTGGCACTG	22	23	yes
GATCCCCAGCCACAGAATGG	311	30	yes
GATCCCCAGAAAGGTGGTCG	370	49	yes
GATCACACTGCCCAGAGGAA	5	4	yes
GATCATCCGCATTGTACAGG	18	14	yes
GATCACAACGCTGATGTACA	21	7	yes
GATCCCCAAGACCAAGTTCT	6	4	yes
GATCCCATCCCCTTGCCACA	6	6	yes
GATCCCATCCAGCCCTCCAG	756	49	yes
GATCCCATCATGCCCTGAGC	53	22	yes
GATCCCATAGCAAGAGAGGG	78	9	yes
GATCCCATAACACAGACCTT	1	1	yes
GATCTCAAAGTAACACTGTG	134	39	yes
GATCATAGACTCCAGGGCTG	29	10	yes
GATCCCAGTAAAGATGCTGC	9	5	yes
GATCCCAGGGCTGACCATCA	16	9	yes
GATCCCAGGGCCTGTCTCCC	55	16	yes
GATCAGTCGAAGGGACCCCC	26	2	yes
GATCCCAGGAGAGTCTGCCC	10	0	yes
GATCCCAGCCACTTTGAGTA	10	2	yes
GATCCCAGCATGGTCAGCGC	373	19	yes
GATCCCAGCAGCAGCATCGT	37	6	yes
GATCCCAGCACCTCTCTACA	1	1	yes
GATCCCAGCAATGAGCTTCC	29	24	yes
GATCCCAGAGTGTAGTAATT	5	2	yes
GATCCCAGAGACATCAGGCA	29	14	yes
GATCCCAGAAGGTCGATGTA	5	1	yes
GATCAGAGGTCCGGAGTGGG	3	2	yes
GATCAGTCACTCACAGAGGC	100	21	yes
GATCAAGACTCCACACCATT	8	2	yes
GATCCCCACAAGAGGGAACA	15	3	yes
GATCCCACCCTCACCCCACC	54	9	yes
GATCCCACCCAGTAGCCTAA	72	5	yes
GATCCCACATTACCTCTGCC	116	3	yes
GATCCCACAGGTCTTTCATG	31	8	yes
GATCCCAATCGCCCGCGTGG	1	1	yes
GATCCCAAGTCTGGGGCTAG	2	3	yes
GATCCCAAGGGCCTCGAATG	424	1	yes
GATCCCAAGGCCTATGTCTG	495	128	yes
GATCCCAAGCTCATCATATG	497	3	yes
GATCCCAAGAATCTGGAGAA	4	4	yes
GATCCCAACCTTGGCCCTGA	98	45	yes
GATCCCAACCCTGAGAACTT	96	14	yes
GATCCCAAAGCCTCTGTTGC	25	19	yes
GATCCCAAAGCACAATCTCC	273	30	yes
GATCCCAAACAGGCGCACGA	39	14	yes
GATCTAAAGAAAAGGCTGGA	83	26	yes
GATCCAAGACAAGCAACAGA	4583	132	yes
GATCCATTGGTGGAGTATTC	136	4	yes
GATCCATTGCCTGGACTGAG	44	2	yes
GATCCATGTGTACCCATAAT	38	19	yes
GATCCATGTCCCACAGTAAC	15	16	yes
GATCCATGTAACTGTTCCAG	29	22	yes
GATCAAGAAGGCTGAGATGG	3	2	yes
GATCCATGGATTAGCTGTAG	15	12	yes
GATCCATGCTGTGCGCTACC	186	38	yes
GATCCATGCGTTCTCTGCCA	7	6	yes
GATCCATGCCAACCACCAGG	104	21	yes
GATCCATGAGCCTACAGAGG	101	3	yes
GATCCATCTCTTCCGGACAT	6	1	yes
GATCCATCTCTCTGCCTTAT	4	5	yes
GATCCATCCTGTAGTCTGAT	2	3	yes
GATCCATCCTAGGGTCTGTG	144	42	yes
GATCCATCCGTAAGCCCCGG	46	30	yes
GATCCATCCCCAGTGCCCCT	215	26	yes
GATCAGGGCATTGGTCACTG	934	243	yes
GATCGTTGAATCAAATGGTG	48	3	yes
GATCGTGTGTTCTTCGCTGA	42	4	yes
GATCCATCCCACTTTGTCTT	1	1	yes
GATCCATCCATTTGATAGCC	7	3	yes
GATCCAGTTTTGACAGTGAC	403	24	yes
GATCCAGTTGTGCCTCCCGG	15	8	yes
GATCCAGTGTGCAGAGGAGA	13	4	yes
GATCCAGTGTCCTGAGCAAG	6	1	yes
GATCCAGTGGTTGGAAGAAA	17	3	yes
GATCCAGTCGAGAAGGACGC	61	6	yes
GATCCAGGTTTCTGGAGGGA	6	1	yes
GATCCAGGTGCTGTGGACTT	98	3	yes
GATCCAGGTGAAGAACGAGG	517	4	yes
GATCCAGGTCGGTCACCAGG	46	2	yes
GATCCAGGTAGGATTCACTC	88	3	yes
GATCCAGGTACAGACTGCAG	22	7	yes
GATCCAGGGTCCTGCATCGG	259	100	yes
GATCCAGGGGCTGCAGCAGT	132	1	yes
GATCGGCAACATCCCTGCCT	1	1	yes
GATCTCTACGGCCCTGCCAG	13	10	yes
GATCCTGGAGAACCTAAGAC	24	15	yes
GATCGGACGCTCCCCCTCTG	11	8	yes
GATCTTCAAGTGAACAAGTC	147	89	yes
GATCCGCTCGGGTGGCACCG	5	5	yes
GATCATCCACAGCGGCAAAT	15	12	yes
GATCAGGCTCTGTGCCACTG	277	0	yes
GATCAGCAGGGGAATGAGGA	39	8	yes
GATCTCTCAGCTTTCTGCTC	8	6	yes
GATCAGATGCCTGGTTGCTC	27	21	yes
GATCAGAGTACTAACCAGTT	16	16	yes
GATCAGACAGGGTGGTGGTT	38	1	yes
GATCAGACACTCTGAGCTTG	2	1	yes
GATCAGACACACAAGCCCAG	13	10	yes
GATCCTGAAGAAATCATATG	7	7	yes
GATCACCCAAGTCCTGCATT	28	6	yes
GATCACAGAGGACCTAGGAG	14	10	yes
GATCACAGAATGGACAGGAA	43	17	yes
GATCCTCTCTCTAGGGCAGC	16	16	yes
GATCAACCAGGTTTGGCTTT	58	17	yes
GATCAACAGCAGCCTGAGGA	26	20	yes
GATCCTTTCCTGTGGCTACT	98	33	yes
GATCCCGGTCCAGACCGGAT	57	14	yes
GATCCCCCTCAGAAGGAACG	2	1	yes
GATCTTGTTTTGAACTCAGA	22	22	yes
GATCCTGGGCGGCATGGGGT	14	8	yes
GATCTTGGAGTACCCAGGTG	24	18	yes
GATCTTCCCCTGATGGCACT	7	6	yes
GATCTTCCCCGAGGGTCGGC	209	2	yes
GATCCTGATGGAGATGGGCG	5	5	yes
GATCCATCTTGTGTCCCTCT	16	2	yes
GATCTCTTCCCAGCCGTGGA	24	10	yes
GATCATATGCTAAGACTGGC	1	1	yes
GATCTCAGAGATGCGCCAGA	30	23	yes
GATCTGTTTGGCCAGGCAGC	9	7	yes
GATCTGTGACAAGAACCTGG	34	26	yes
GATCTGTATGTGATGAGAAG	41	31	yes
GATCCTTGTCAGTCTTGGCT	59	8	yes
GATCTGTAGAAATGACCTGT	2	1	yes
GATCCCCACGGCTGGTCTGA	15	15	yes
GATCTGGTGCCCTGCTGCTT	142	137	yes
GATCTGGGGTAGATTCTGAT	157	20	yes
GATCTGGGCCTCTTTCCACG	7	3	yes
GATCTGGGATTGGCTCAAGA	160	59	yes
GATCTGGCTCTGCCTGCTGC	34	0	yes
GATCCAGTTCTAAGCAGATT	419	65	yes
GATCACGTGACCGAGTAGTC	1	1	yes
GATCTGCTGACTACAGCACG	21	2	yes
GATCTGCTCAGGGTCTACAG	81	4	yes
GATCTGCCTCATTCAAGATT	5	4	yes
GATCACAAAGTTTGAGAATT	108	154	yes
GATCTATTCTCCGTGGCTGT	1	1	yes
GATCTCTTGAAGTTCAAGAC	1	1	yes
GATCGTGAAAGGGAACGGGA	132	1	yes
GATCCAAACATGAAAGCTGG	64	1	yes
GATCTTTGCCGGCAAGCAGT	26	37	yes
GATCTTTGCAGCCTAGGCTG	12	9	yes
GATCCAGCTGCTCACGCTGA	174	14	yes
GATCTGCATGGCTCAAGAGC	13	10	yes
GATCCCCCAGGGTGAAGCAC	30	3	yes
GATCGCTGCCTCAAGAAGGT	3	2	yes
GATCACAGCAGAGGGAGCAG	15	9	yes
GATCCAGCAGGAAGAGGCCA	17	18	yes
GATCCAGAGGGGACTGATAA	21	0	yes
GATCAGTCCCGGAAGAGAGC	34	8	yes
GATCAAGCTACAGATATGGG	15	11	yes
GATCAAGGCAATCTGTCATG	219	122	yes
GATCTTTCGGACTCTGGGGA	17	1	yes
GATCAAGCCCCCAATTCTTC	44	14	yes
GATCAAATGTGGCCTTCGCT	376	38	yes
GATCATGTGATATGGCCTGA	19	18	yes
GATCACAGTGGCTTGGTGCA	2	1	yes
GATCTTGTTGCAGAATTGCA	28	22	yes
GATCATTTTACTTTGGAAAC	10	8	yes
GATCAAAAGGTGTGCACCAC	17	13	yes
GATCATATTGCCCCGTCAAA	35	27	yes
GATCTTACTCACCAGGAGGA	14	10	yes
GATCCTGGCCCAGCAGAAGA	24	23	yes
GATCAACGTCTCAGCCAATT	30	7	yes
GATCTTCACATGTGCACAGT	11	8	yes
GATCTGTTGGGTGTGGCTTC	25	19	yes
GATCTGTTGGACCAGACGCA	5	4	yes
GATCTGTTGGAACTGTGAGG	35	21	yes
GATCTGTTGAGCTTTAAAAT	35	3	yes
GATCTGTTCAGAGCCTGAGC	44	34	yes
GATCTGTGGATAATGTAGGC	4	3	yes
GATCTGTGATTTCATTTCTT	3	2	yes
GATCTGTCTGTTTACTATCT	1	1	yes
GATCAGAGAGAAGGCGGTAA	12	9	yes
GATCTGTCCTGTGACACAGA	26	0	yes
GATCTGTCAGGGCCTGTCTC	34	6	yes
GATCTGCCTTGCTCTTCCAC	35	3	yes
GATCTGACTTTCCAGAGCTG	59	45	yes
GATCCTGCTATGGTGGATGT	2	1	yes
GATCGAGGCCCAAAGGACGG	17	13	yes
GATCACTTAGCTGCCTGTCT	5	4	yes
GATCTGGGCCTGGAGAGACT	187	36	yes
GATCTGGCTACGTCTCCAGG	34	12	yes
GATCTGGCGCACTGGGCAGC	20	15	yes
GATCTTTTGCTAATGCAGTT	109	6	yes
GATCCTTTTGGTTTGGACAA	11	12	yes
GATCTGCAGATGCTGTCCTC	94	34	yes
GATCCTTTAATGCAGTTCCT	6	1	yes
GATCTGGAACTAACCTCCCC	129	99	yes
GATCTGGAAAATGAGTGTTT	35	27	yes
GATCTGCTTCCTCCTCCAGG	5	3	yes
GATCTGCTGAGGTGGAGAAT	30	4	yes
GATCAAACTCTGGGCCTCCT	96	11	yes
GATCAAACTAATCAGGCATT	1	1	yes
GATCTGCGAACATATGCATT	1	1	yes
GATCTGCGAAATACTAGCAC	20	19	yes
GATCTGCCTGTGGCAAGTCA	57	9	yes
GATCACTTCTGAGGCTCCGT	155	31	yes
GATCACTTCATCTCCCTTCA	68	20	yes
GATCCAGGGCTCCATCCTGA	179	14	yes
GATCCAGGCGCTGCCCAAGC	40	39	yes
GATCCAGGATTCCTAGAGCA	253	20	yes
GATCCAGGAGTATGAGAAGC	7	6	yes
GATCCAGGAGGAACTGAACC	11	8	yes
GATCCAGGAGCACCTGCCTG	17	3	yes
GATCCAGGACTACAAGCATC	100	14	yes
GATCCAGGACAACGCCACGG	39	3	yes
GATCCAGCTTCAGGGCCAAT	1	1	yes
GATCCAGCTGCAGATGGAGC	26	18	yes
GATCCAGCTCATACCCCTGC	612	42	yes
GATCCAGCCCTCCTTTGCCT	15	15	yes
GATCCAGCCACTGTATTTGC	5	3	yes
GATCCAGCAGGAGTTGGAGC	3	4	yes
GATCCTATTAACCGGGTGGG	12	0	yes
GATCTGCCCGCCTGGCGCGA	39	30	yes
GATCTGCCCAGCTCTGCCTC	79	19	yes
GATCTGAGCCCCCAGCTCCA	148	19	yes
GATCTGGTACCGCAGGTAGA	12	9	yes
GATCTACCAGCCTTGGCTCA	170	54	yes
GATCCAGCAGAGGAAGAGGC	39	5	yes
GATCCAGATGTGCTCAACCA	16	1	yes
GATCCAGATAGTGAGATAGC	9	8	yes
GATCCAGAGTCGGTCAGCTC	86	7	yes
GATCCAGAGTCCCCGTATTC	65	10	yes
GATCCAGAGGCCACAGCAAG	68	14	yes
GATCCAGAGGCAACGTGGGG	35	34	yes
GATCCAGACCTATGCTGAGT	9	3	yes
GATCCAGACCAATCCAGTGT	293	14	yes
GATCCAGACAGCACCCACTG	4	3	yes
GATCCAGACAGCAATCCTTA	45	2	yes
GATCTGGCGTCCTCTTCTGG	48	31	yes
GATCCAGAAGCTCCAATTTT	150	11	yes