#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCTCTGTGCAGTTCAAAA	13	11	yes
GATCCTCTCCGATGGGGAAC	2	2	yes
GATCATAGTGGACGTTGTTA	4	1	yes
GATCATAGGACCACTTTTCA	4	4	yes
GATCATACCCTAGCCGGGCA	88	30	yes
GATCACCGCACACCACCCCT	5	5	yes
GATCAGTGTGTGCCAAGGAG	332	11	yes
GATCAAGAGTTCTGTTTCTC	2	2	yes
GATCAAGAGTCTCAAACCCA	55	9	yes
GATCAGTGGGTGGACTGCGA	15	4	yes
GATCAGTCAGTGACAACCAA	94	0	yes
GATCACCCCAAAGCTCGTTA	46	10	yes
GATCAGTAGAGCTTGGACCC	185	116	yes
GATCAGTACACGGTGTATGT	13	11	yes
GATCAAGACGCTCATTGCCA	18	3	yes
GATCAAGACGCAGGTCGAGG	496	78	yes
GATCAGGCTCTTTGTTTGTG	18	7	yes
GATCAGGCGTGAGCTTCAGA	43	5	yes
GATCTGGCCACTTTGTGTTT	36	3	yes
GATCTGGCCAACGGCAACAT	63	9	yes
GATCTGGCAGTCATAGCTTG	322	0	yes
GATCTGGCACTAACAGAACC	11	4	yes
GATCTGGCACCCTCTCCTGG	11	12	yes
GATCTGGCAACTGTGCGGGG	34	1	yes
GATCTGGCAAAAACTACGGG	225	4	yes
GATCTGGATTTGGTTGAGAT	29	1	yes
GATCTGGATGGAGTGCCTTT	52	1	yes
GATCTGGAGTTGGCTTGTGC	4	4	yes
GATCTGGAGTCTGGTGTGGC	689	80	yes
GATCTGGAGTCTCTTAAAGC	145	6	yes
GATCTGGAGTCCGCTTACAA	288	12	yes
GATCTGGAGTATGGTCTGCT	3	1	yes
GATCTGGAGGGAGGGGCGGG	21	20	yes
GATCTGGAGGATTCCAGCGA	55	1	yes
GATCTGGAGGACCTCGTACC	7	7	yes
GATCTGGAGCTCGCCCCCAG	38	34	yes
GATCTGGAGCGTATGGGTCT	30	28	yes
GATCTGGAGCCAGGCAGACT	4	3	yes
GATCTGGAGAGTTTGTTCAG	8	7	yes
GATCTGGACTTTGCTCAACC	11	10	yes
GATCTGGACTGGTGTTTCTT	86	28	yes
GATCTGGACTCTCACCTAGG	7	1	yes
GATCTGGACTCACCTGGGAG	344	100	yes
GATCTGGACTCAAGGGGCAT	330	26	yes
GATCTGGACGATTCTGAGCC	216	14	yes
GATCCTCCTTGGCTACAGTG	22	4	yes
GATCCTTAACTTCCTCCCTG	2	2	yes
GATCCTGTGTTTGAATGACA	23	2	yes
GATCAGGCCCACTCCAGGAG	350	20	yes
GATCTCTCCTTTTCAGGTGG	36	33	yes
GATCAGGATGACCGAAGGAG	6	6	yes
GATCAGGAAGACACGGACTC	16	10	yes
GATCAGCCTACGCTCACATT	204	41	yes
GATCAAGAATGGACCAAGAT	57	11	yes
GATCAAGAAGTCGTCATTCA	9	0	yes
GATCACCAAGTGGTACCTGG	13	11	yes
GATCAGCCAGGTCTACACAC	12	11	yes
GATCAGACTGTTGCTTTCGC	119	18	yes
GATCTCCAGAGCCAAAAAAA	3	2	yes
GATCAGCACCAAGTGACTTG	59	7	yes
GATCAAGAACACTGTCTCTC	11	2	yes
GATCAGAGCTGGAGGGAGCA	2	2	yes
GATCAGAGACTCTGGGGATT	1	1	yes
GATCAGAGACATTGAGAGGC	6	6	yes
GATCAACTCCTTGAGACACT	4	3	yes
GATCAACTCCCGTACTAGAA	26	24	yes
GATCTGGACCTAATAAAACA	2	2	yes
GATCACTACTGACTTGTTGG	3	2	yes
GATCTGCTTTTTGAAATGAA	3	2	yes
GATCTGCTTTGTGCTTGGCT	69	5	yes
GATCTGCTTTGCTGTCGGTG	4	3	yes
GATCTGCTTTCTCAGGACTC	131	5	yes
GATCTGCTTTCCCTTTGTAA	40	7	yes
GATCAGCCCATCTACTTGGC	1	1	yes
GATCTGCTTGTGTTGTGTTG	114	18	yes
GATCTGCTTGGCTGCCATTA	66	1	yes
GATCTGCTTGCCCCAAACAA	795	31	yes
GATCTGCTTCTACCTCCCTA	14	6	yes
GATCTCGGTCATCCAGTTGA	4	4	yes
GATCTCGGACGCTCAGTGGG	195	71	yes
GATCTCGCTTTCAGTCTGCT	1	1	yes
GATCTCGCTGGTTCGCACCT	222	23	yes
GATCTCGCTGCATTTACATA	45	14	yes
GATCTCGATTCTACAGTGGT	12	11	yes
GATCTCGAGCACTCTCGTCC	22	3	yes
GATCAGAAGTTCAAGCTCAT	11	2	yes
GATCAGAACCTTGCCGAAAC	26	10	yes
GATCAACGTGATGGACGCAC	80	10	yes
GATCTCCAAGGACAAGAGGA	14	7	yes
GATCTCCTTCCAGGCCCAGG	11	10	yes
GATCACTGTTTGTGCCTCTG	586	49	yes
GATCACTGTGTCCCAGGCTG	83	6	yes
GATCACAATGAAGTCCTGGG	2	2	yes
GATCACTGACATCTATACCC	6	5	yes
GATCAGAATGGCGGAGGCGG	109	74	yes
GATCACAAGTGGAAAGCAAT	27	25	yes
GATCACTCTTCCCGCTGCTG	155	10	yes
GATCACTCTGGTCGTGTGGG	102	16	yes
GATCACTATGTCCAGGCCAA	15	7	yes
GATCACGAAGAAGGCAGCCT	30	9	yes
GATCACCTGTGGAGTTGTCA	98	29	yes
GATCACCTGACTCCTAACCG	5	1	yes
GATCTGTTGGCCCATGCATG	5	1	yes
GATCTCCTCTCTTCCCACGG	4	1	yes
GATCTCCTCTCCAGGGAGCT	38	13	yes
GATCTCCCTTCCCCGGGGAA	54	10	yes
GATCTCCCTGTGCCGGTGCC	96	26	yes
GATCTCCCTGCCCAGTCAGA	28	25	yes
GATCACATGGGTCGAGGGTT	85	21	yes
GATCAACAGCTCGCTAGTGG	119	80	yes
GATCACAGGGGAACTAATTC	4	0	yes
GATCACAGAGTGGGAATCTC	198	40	yes
GATCTTGAAGAAGATGAGGC	42	39	yes
GATCAACACTCCCCACGATG	4	3	yes
GATCACACTGTCTGAGGCGT	130	12	yes
GATCACACTCTGGCCCCCAA	53	11	yes
GATCACACTCACCCCATCCT	17	4	yes
GATCACACGCAGAATGAAGT	8	3	yes
GATCACACCAGAGTCCAGGT	6	5	yes
GATCAACACCGTGCTCAGTG	5	1	yes
GATCAACAAGAAACTCAACA	61	24	yes
GATCTCATCGAAACAAAGCT	38	12	yes
GATCAAATTGCTTGCTTGAG	10	0	yes
GATCTCAGTGGGTCACATAA	15	14	yes
GATCAAGGCTGCCTGGCTCT	8	7	yes
GATCTCAGTCGGATGCACCC	9	8	yes
GATCAAGGCCGTTCAGATGT	4	3	yes
GATCAAGGACATCCATGTGC	165	17	yes
GATCTCAGGTCTTCAAGCAA	37	34	yes
GATCTCAGGTCACGGCTTTG	7	7	yes
GATCAAATCCGACGACGAGG	82	12	yes
GATCAAGAGCAGTGCTGCTC	71	22	yes
GATCTGCATGCAGGTCACGC	3	3	yes
GATCAAATCCATCCAGGCTG	7	6	yes
GATCAACTTGGCTATGATAA	2	2	yes
GATCAAATATGTGCCCTATG	192	29	yes
GATCTCAGCCCTACGATACA	3	2	yes
GATCAAAGTTCCCAGAAATG	2	2	yes
GATCTCAGCACTGCAGGACT	1	1	yes
GATCGCTGCCAACATCCAGG	21	3	yes
GATCTCAGAGGCTCGGTATC	118	47	yes
GATCAACAACCTCAACCGCC	4	3	yes
GATCAAACCGCAAAAAAAAA	18	17	yes
GATCTCACGATGAGCTATGA	34	0	yes
GATCAAACCCAGGGCTTTGT	67	0	yes
GATCAAAGGGTCAAGAGTCC	4	3	yes
GATCAAAACACGCGAGTCTG	51	0	yes
GATCACTTTATTTGCTAGGG	157	21	yes
GATCAAAGGAAATGGAGCCA	139	42	yes
GATCAAACTACGGCACAGCA	28	26	yes
GATCGCATTGATGTGCAGCA	1	1	yes
GATCAAAGCCAACGCCCTCT	2	2	yes
GATCAAAGCACTGGCGGGCT	18	7	yes
GATCAAAGACTGCGACACCA	46	11	yes
GATCAAAGACGGTCCCCAGA	29	26	yes
GATCGAGGATGTGAGGAAGT	1	1	yes
GATCAAAGAAGGCTGTTGAC	32	5	yes
GATCTTTTTCTCCATCTCTT	30	10	yes
GATCAAACGTGGCTGAGCGC	733	25	yes
GATCGGTCAGTGTCCCATAC	2	2	yes
GATCAAACGCCCTGGCAGAA	2	2	yes
GATCCCTATTGAGAAGGCAG	9	10	yes
GATCATCTTGTGAAAACCCA	206	6	yes
GATCTTTTCCACCTTCAGAG	48	5	yes
GATCAAACCCGTGGAAGAGG	317	20	yes
GATCATAGGAGAAGTGGCCA	1	1	yes
GATCAAACAGGCTGTCAAGA	45	10	yes
GATCTTTTACTTCGTGGCTG	212	58	yes
GATCTCAACTGTAAGAGTTG	1	1	yes
GATCAAAATGGAAGTCCTCA	19	17	yes
GATCTTTGTGGTGTGGGCCA	140	60	yes
GATCTTTCTGGCAAGGAAAC	2165	84	yes
GATCCATTGACAGAGACAAC	13	2	yes
GATCATCCAGAACACAGCCT	603	100	yes
GATCTGCTCCAAGAAATGTC	26	0	yes
GATCCAGAAACACAAAAAGG	3	2	yes
GATCCTGGCTGTCGTTTCAC	6	3	yes
GATCACAGTGCCCTCGCTCA	8	7	yes
GATCCACTTCCGTGTTGATA	3	1	yes
GATCCTGATGCTGCCACGGA	3	1	yes
GATCCGGAGCCAGGTGGTGC	8	7	yes
GATCTGCGCTTCCAGAGTGC	2826	403	yes
GATCCGCTCTGTGGAGACAG	3	2	yes
GATCCGCTCGACAAGACAGG	5	5	yes
GATCCACTCAGCCGTGGTTT	44	7	yes
GATCATGCCTGTAATCCTAG	4	5	yes
GATCCTGAGCTTTGACAAGA	11	10	yes
GATCCTGAGCCAGATGTCAT	37	10	yes
GATCCTGAGATGCAGCTCAT	19	8	yes
GATCCTGAGAGCCTCATCCT	60	8	yes
GATCCTGAGAGAAAACAGCA	11	12	yes
GATCCTGACTTTGCCAGCTG	42	3	yes
GATCCTGACTTTAATCAAAG	4	3	yes
GATCCTGACTCTGACACTAC	291	31	yes
GATCCTGACCTGGGCTTCCT	58	6	yes
GATCCTGACCACATGAACAA	365	79	yes
GATCCTGACCAATGACAATA	38	7	yes
GATCCTGACATAAACCCTTG	9	3	yes
GATCCTGACAGTGCACCTAA	172	5	yes
GATCCTGACAGAGCCTTGGT	108	21	yes
GATCCTGAATGACGTTCAGG	317	44	yes
GATCCTGAAGTGGCCTCAGC	103	28	yes
GATCCTGAAGGTCATCCGCA	148	24	yes
GATCCGTGGCAAAGGGAACC	6	1	yes
GATCCGCATCGAGGACTCAG	3	3	yes
GATCCGCATCCTCAACCCAT	97	28	yes
GATCCGCACCGGGTGGGGAA	41	4	yes
GATCCTGAAGAACTTTGTCA	17	1	yes
GATCCTGAACGAGAGCCTGC	4	1	yes
GATCCTGAAAGCCAAGTTAG	82	19	yes
GATCCTGAAACTGACTCGCT	8	5	yes
GATCCTGAAAATTCTTTGCA	4	4	yes
GATCCTCTTTGTAACTTGTG	2	2	yes
GATCCTCTTTGCCAACCCCA	223	16	yes
GATCCTCTTTGCACAGAAGA	78	15	yes
GATCCTCTTTCACGCTTCTT	8	7	yes
GATCCTCTTGTTCCACGATG	16	3	yes
GATCCTCTTGTCCACTCCAC	6	6	yes
GATCCTCTTGCTGCAGCTTC	57	12	yes
GATCCTCTTGCTGAAGAAAA	12	11	yes
GATCCTCTTGCGGGACAGTC	61	19	yes
GATCCTCTTGATTCCTTCTG	38	7	yes
GATCCTCTTGATGCAGAGAG	52	6	yes
GATCCTCTTCTTCCTCGTGA	89	12	yes
GATCCTCTTCTTCAGCACAC	453	31	yes
GATCCTCTTCTGCTGTTCTG	10	4	yes
GATCCTCTTCCTGCTCCAGC	196	2	yes
GATCCTCTTCCCATCCATCC	52	5	yes
GATCCTCTTCATCTTGGGCA	94	27	yes
GATCCTCTTCAGCCCTGTGA	11	5	yes
GATCCTCTGTTGGGGCCTCG	65	16	yes
GATCCTCTGTGTCCTTATTT	10	1	yes
GATCCTCTGTGGACTCATCT	36	1	yes
GATCCTCTGTGCCTCACTCC	206	3	yes
GATCCTCTGGAATGACATTG	4	4	yes
GATCCTCTGCTTTAAGTCCT	5	0	yes
GATCCTCTGAGGCAGTATTG	81	24	yes
GATCCACCCCTTAAGAACCA	232	78	yes
GATCCACCACCTAGAATCTA	86	18	yes
GATCCGACAGGTCAGAAGCA	5	5	yes
GATCCTCTGAATGTTTTCCC	30	5	yes
GATCCTCTCTTGTGCTACCT	2	2	yes
GATCCTCTCTGGAGCCACAG	16	3	yes
GATCCTCTCTGAACCTCCTG	169	6	yes
GATCCTCTCTCGGTGTGGTT	2	2	yes
GATCCTCTCCTTCTGACCTC	3	1	yes
GATCCTCTCATTCAGTCTTC	15	8	yes
GATCCTCTCAGCTGGATGCT	3	2	yes
GATCCTCTAGGGGTTATGGG	125	20	yes
GATCCTCTAAGACACTCATC	80	3	yes
GATCCTCGTGCCTGTCTCCC	139	9	yes
GATCCTCGGGCAAGCCAAGA	663	54	yes
GATCCTCGGGAGACCACTGG	102	24	yes
GATCCTCGGGAATTTTTACC	51	25	yes
GATCCTCGGAGGCTACCGAG	17	1	yes
GATCCTCGCCTGTTGGAGGA	42	5	yes
GATCCTCGCAGCTTCTATGA	236	44	yes
GATCCTCGAGTGAGGACGAC	11	6	yes
GATCCTCGACAGGAAGCCAC	21	6	yes
GATCCTCCTTTTCTTGGCGG	2	2	yes
GATCCTCCTTGTCAAGTACA	1562	197	yes
GATCCTCCTGTGTCTTCCTC	7	7	yes
GATCCTCCTGTGAAGTGCCA	24	5	yes
GATCCTCCTGCGTGCTGACA	164	4	yes
GATCCCTTGGAACTAGATTT	1	1	yes
GATCTGAGCTGAATTTGAAG	75	5	yes
GATCCTCCTGCCCCTCCAAT	87	8	yes
GATCCTCCTGCCCCGACAAG	136	3	yes
GATCCTCCTGAGTGCTGGGA	81	10	yes
GATCCTCCTCCTGTGTTTCT	58	0	yes
GATCCTCCGTGAGTATGCCT	97	3	yes
GATCCTCCCCTTTACGGACA	156	13	yes
GATCCTCCCCCTCTCCCACC	21	19	yes
GATCCTCCCCAGGGATGGGG	162	2	yes
GATCCTCCCACAGGGACACT	54	1	yes
GATCCTCCCAAGTGAATGAC	110	13	yes
GATCCTCCAGTCAGTCTATT	8	3	yes
GATCCTCCAGGACAAGGGGT	78	14	yes
GATCCTCCAGCAGAGTGGAC	5	1	yes
GATCCTCCAGCACCAGGCAT	66	0	yes
GATCCTCATCTTCATTCCTT	23	4	yes
GATCCTCATATGAGGACCAT	13	11	yes
GATCCTCAGTTACTCGCTGC	28	12	yes
GATCCTCAGTGGGTAAGTGC	13	0	yes
GATCCTCAGTGCTACTTGCG	40	1	yes
GATCCTCAGGAGTTGCAATG	226	61	yes
GATCCTCAGGAAACAGTCTC	57	11	yes
GATCCTCAGCTGGCTGGAGC	74	4	yes
GATCCTCAGCTGCCCTGCCT	493	39	yes
GATCCTCAGATTAGATGTTT	2	2	yes
GATCCTCAGAGACGTGCTCG	184	22	yes
GATCCTCACCATCCACGTTT	40	5	yes
GATCCTCACCAGCCGCGGGC	910	38	yes
GATCTCACACACACACATAT	25	9	yes
GATCCTCAAGCGCCTCAACC	222	16	yes
GATCCAGTGCCTGTGTAGAA	63	13	yes
GATCCAAGGCACGTTCATAA	2	2	yes
GATCCCTGCTCTGCAATGAG	335	36	yes
GATCCAATCAATCTCCCCGA	25	0	yes
GATCCTCAACTCCTCCAAGG	22	1	yes
GATCCTCAACATCCGCCTGC	283	24	yes
GATCCTCAACAAGATGCTAT	68	8	yes
GATCCTCAAATCAGGCAACC	18	3	yes
GATCCTCAAACAGACATTGT	29	1	yes
GATCCTATTCCAGCCAAATG	136	4	yes
GATCCTATTCAGTGGCACAA	30	8	yes
GATCCTATTAGCCAAACTTT	11	4	yes
GATCCTATGTGTTGGCCATT	162	15	yes
GATCCTATGTGGCTCTAAAA	25	6	yes
GATCCTATGGTGATTCCAGT	4	1	yes
GATCCTATGGCATATGCAAG	15	4	yes
GATCCTTGGATTCTGACCTG	12	4	yes
GATCCTATCTCCCGGTTGGG	66	19	yes
GATCCTATCATTGCTGGTGG	104	4	yes
GATCCTATCACCAGCACTGA	30	0	yes
GATCCTACTTTGGGAACATG	1	1	yes
GATCCTACTGTGGATGACAC	1079	54	yes
GATCCTACTGATGAAGTGCC	95	10	yes
GATCCAAGACACCAGCCCAA	2	2	yes
GATCCAGGTTTTGTGGTCTT	1	1	yes
GATCCAGGTGTTACCTGATG	3	3	yes
GATCCCTCTGCTGCTGCTTC	11	4	yes
GATCATAGTGTAGGTCCCAC	13	4	yes
GATCCCTCTCCCAGGAACAA	161	26	yes
GATCCAAGCTGTCAAGAAGG	1026	129	yes
GATCCAAGCTCCATTGTACC	98	23	yes
GATCCAAGCAGCCTTCAGGG	2	2	yes
GATCCTACGGAGCAAGTCTA	84	5	yes
GATCCTACCTTCTGCTTTCG	145	26	yes
GATCCCCTTCCCCCGGGACT	2	2	yes
GATCCTACCTGAGTGGCAGC	791	57	yes
GATCCTACCATCCCTTTGAT	43	16	yes
GATCCTACCACAGAGCCTTA	120	27	yes
GATCCTACATCCATTCGGCT	43	5	yes
GATCCTACAGTGGCTGGCAA	430	25	yes
GATCCTACAGTCACTTCACA	143	6	yes
GATCCTACACTCCTGGCAGT	3	1	yes
GATCCTACACATGGAGGCTG	127	34	yes
GATCCTACACAGCTAATCCA	1	1	yes
GATCCTACACACCTACCAGA	129	40	yes
GATCCTACACACAGTGGTGA	34	14	yes
GATCCTACAAGCCTGTCCGT	50	9	yes
GATCCTACAACTCAGAAGAC	8	7	yes
GATCCTACAAAGGTCTTGAA	4	3	yes
GATCCTAATGGACAACAAAG	14	7	yes
GATCCTAAGCAGATTCTGGG	78	16	yes
GATCCTAACTGTGGAACCTC	8	1	yes
GATCCTAACTCTGACCTTTC	39	9	yes
GATCCTAACTAAGCACATGA	19	17	yes
GATCCTAACCTAAGATGCCT	149	9	yes
GATCCTAACCCTGAACCCCA	46	5	yes
GATCCTAACCCAGTGGACTC	136	18	yes
GATCAGGGTCTGATTGACAC	18	3	yes
GATCCAACTTGCCCCAAGAA	40	9	yes
GATCCCGTGTCCTGCAGACG	213	4	yes
GATCCCGTCTCAGCCACGTC	4	3	yes
GATCCAACACCGGCGGCCAG	11	2	yes
GATCAAGGGGTCCAATCCAG	27	25	yes
GATCCTGTCCGAGAGGCGCG	64	15	yes
GATCCTGTACAGAAACTCTT	4	4	yes
GATCCTAAATTTGACCCAGG	198	29	yes
GATCCTAAATGGCAGCCTTT	10	5	yes
GATCCTAAAGGCCGGTCACA	863	78	yes
GATCCTAAAGAAAGATTACG	6	4	yes
GATCCTAAACTCTGTTGCCA	33	7	yes
GATCCTAAACTCCAAGGGGA	84	3	yes
GATCCTAAAACTGAGGAAAG	57	2	yes
GATCCTAAAACCAAGGGAAT	16	8	yes
GATCCGTTTGGCCTCTCAAT	84	13	yes
GATCCGTTGGAAGGTTTACC	90	2	yes
GATCCGTTGCCTCCTTAAAG	77	10	yes
GATCCGTTGCCAGTTACCTG	344	29	yes
GATCCGTTCCTAGGGTACCT	202	17	yes
GATCCGTGTGTGTGTGGGAG	441	67	yes
GATCCCAGGCTTCTGGGGAC	26	5	yes
GATCCGTGTGAAGGTCCCAT	171	12	yes
GATCCGTGTGAAACTGGATG	1656	138	yes
GATCCGTGTATGTCTAAACA	12	13	yes
GATCCGTGGCTGCAGCAGAA	38	4	yes
GATCCGTGGAGAAACTTGCC	84	77	yes
GATCAGTACCGCCTTACCCC	4	4	yes
GATCCAAAGGAGCTACTTAG	7	0	yes
GATCCAAAGCTGCTGCAGAA	1	1	yes
GATCCAAAGAAGGGATTTTG	4	1	yes
GATCCCGAGCTTCAAATCCC	117	8	yes
GATCCGTGCTGAGCGTCGGC	363	40	yes
GATCCGTGCTGAATTGGTTT	37	20	yes
GATCCGTGCATCTCATTGGC	89	7	yes
GATCCGTCTGTGGGGGCCTC	9	8	yes
GATCCGTCGCCTGGAGGTGG	124	5	yes
GATCCGTCCGAGATGGCAGA	6	6	yes
GATCCGTCATCTCCAGGACA	56	4	yes
GATCCGTCAGGCTTGCTCGT	50	7	yes
GATCCGTCAAGCTAACTGGA	35	4	yes
GATCCGTATCAGGTTCATGT	11	10	yes
GATCCGTAGTCTGAGTGATG	57	2	yes
GATCCGTACCCTGGTGCTGA	187	10	yes
GATCCGGTTCTGGGACAGCA	103	1	yes
GATCCGGTGCCTGCCTTGCC	17	16	yes
GATCCGGTCCCAAGACCGCT	814	118	yes
GATCCGGTCCAAGGCTCTTG	246	73	yes
GATCCGGGTGTCCAGTGACA	617	82	yes
GATCCGGGTGATGCGAATCG	44	1	yes
GATCCGGGGGAAATTGGGAT	53	7	yes
GATCCGGGGCACACATTCTC	47	9	yes
GATCCGGGCAAAGCCTGCTC	186	9	yes
GATCCGGGAGGTGTGCGGCT	1844	243	yes
GATCCGGCTGTGCCAGGTGT	31	0	yes
GATCCGGCTGGGCCTGGCTC	143	45	yes
GATCCCCTTCTACGTGACCA	1	1	yes
GATCCAAAATGTTCCATGGA	7	2	yes
GATCCCCTGGTCTCTCCCGT	10	5	yes
GATCCCCTGGGCTTTAATAA	27	1	yes
GATCCAAAAAGCAGTTCAAC	34	4	yes
GATCTCCATACTTCTATGGC	2	2	yes
GATCCCCGTGTACTACCATG	11	0	yes
GATCCGGCAGAAGGATGAGG	200	16	yes
GATCCGGACTCACCTGGGAG	325	121	yes
GATCCGGAAGAAGATGATGG	25	1	yes
GATCCGCTTGGCAGCCATTC	780	64	yes
GATCCGCTTACAGAGACTTT	38	35	yes
GATCCGCTGTCAGGAGCTGA	13	3	yes
GATCCTATTCTGTCACATTA	5	5	yes
GATCCGCTGCTGGAAGAACC	48	5	yes
GATCCGCTGCAACCCGGTGC	14	1	yes
GATCCGCTCTGTGGTCGCCT	296	54	yes
GATCCGCTCTGAGGTTCTGT	86	22	yes
GATCCGCTCTCTGCATCTGT	7	2	yes
GATCCGCTCCTGGCGACTCC	227	10	yes
GATCCGCTCAGAGCCCAGCA	108	3	yes
GATCCGCTCACGCCCAGCAG	216	5	yes
GATCCGCCTTCTACTCGGAA	19	1	yes
GATCCGCCGCTAAGACCTGG	92	13	yes
GATCCGCCCTGTGAGTCACC	25	4	yes
GATCCGCCCGCTCACACAGG	15	14	yes
GATCCGCCCACACCCACGTG	1809	179	yes
GATCCGCCAAGTTATTCAGG	9	3	yes
GATCCGCCAAAAAAATGCAC	60	37	yes
GATCCGCATGATGGGAGGAG	6	2	yes
GATCCGCATCCGCAAGCCCT	158	38	yes
GATCCGCAGGTCAGATGACA	9	1	yes
GATCCGCAGCTTTTCCAGCA	115	13	yes
GATCCGCAATTATGAAGAAC	4	3	yes
GATCCGCAAGGTGCTGGACG	492	26	yes
GATCCGCAAGGACTTCTTAT	23	8	yes
GATCATTTCGGGCCAGTAGG	205	27	yes
GATCAACCCCCAGAACAAGG	5	1	yes
GATCCCCGCCCGTGGACTGC	13	6	yes
GATCCAGACAGCCATCAAGG	148	24	yes
GATCCCCGAAGTCTCTCTCC	14	1	yes
GATCCCCCCGGAGTGTTCAG	26	6	yes
GATCCAGAAGTCATGGCAAA	44	16	yes
GATCTATGGGGCAGGGTTGG	12	11	yes
GATCCCCAGGGTTTGCTGCT	3	1	yes
GATCTTGTGACAGTGTGTGT	6	5	yes
GATCCCCAGGACACTTTGCT	6	1	yes
GATCCGCAACTGTCCGGAAG	63	7	yes
GATCCGATTTCTGATTTTGC	97	15	yes
GATCCGATGGGCCAGCCTTT	72	66	yes
GATCCGATGCTTTAACAGCC	24	22	yes
GATCTGCCCGTGTGAAAAAA	10	3	yes
GATCCGATGAGGAAGATGAC	226	17	yes
GATCCGAGTGAAAGCCGGAG	98	12	yes
GATCCGAGGCTAGAGGGAGC	22	3	yes
GATCCGAGGCAGCCAATACA	65	6	yes
GATCCGAGGCAGATTTTCTT	34	5	yes
GATCCGAGCGACTGTCACCA	188	14	yes
GATCCGAGCCTCACTACCTG	14	7	yes
GATCCGAGCAGCCACATTCC	13	11	yes
GATCCGACAGGAGGGTGTAA	411	56	yes
GATCCGAATTGCAGAGCTGT	29	26	yes
GATCCGAACTTCACCCTAAT	41	9	yes
GATCTGCAAGGCCTAATTAC	46	10	yes
GATCTGCTTGGTGATACCAC	5	1	yes
GATCCCCAAAGCCCCTAGAG	5	0	yes
GATCACGCTGCCCCCGACTC	27	7	yes
GATCTTCTCCTTTGAGGGAA	10	5	yes
GATCCTGTGCCCCCTCCCAA	4	4	yes
GATCTGAAACACCGTCTTCA	4	3	yes
GATCCCGCAGATTCAGAAAG	6	6	yes
GATCCTTTTGTAACTCCCTG	1	1	yes
GATCGAATGTTTGACATGGG	3	2	yes
GATCTGCTTCCTGAAGAGTG	74	3	yes
GATCTGCTTCCCATTGTGGT	190	53	yes
GATCTGCTTCCCAACTGTTA	32	4	yes
GATCTGCTTCCATCCATCTC	25	0	yes
GATCCCCCTCAAGAAAGAAC	18	5	yes
GATCTGCTTATCCCATTTAG	3	2	yes
GATCGAGCGGCAGCGGCTGG	136	21	yes
GATCTGCTGTTCCTCACGAA	59	14	yes
GATCTGCTGTGGCACAGGGC	57	9	yes
GATCTGCTGTCTACTACCTA	4	1	yes
GATCTGCTGTAGCATCAAGC	5	6	yes
GATCTGCTGGTCATTAAGGG	292	37	yes
GATCTGCTGGCAGTAGTAGT	71	20	yes
GATCTGCTGGAAGATAATCT	41	16	yes
GATCTGCTGCTGACAGGGGA	3	3	yes
GATCTGCTGCTAGGTATGTC	9	10	yes
GATCTGCTGCCTGCTCCCAC	25	9	yes
GATCTGCTGCCTCTACCCCC	4	4	yes
GATCTGCTGCCAGGTTTTGC	53	2	yes
GATCTGCTGCAGGGTTCTGT	509	77	yes
GATCTGCTGCAGCTAAAGTA	158	28	yes
GATCTGCTGATGATGGAACA	4	3	yes
GATCTGCTGATATTCCGGGC	16	1	yes
GATCTGCTCTTGCTAATAAC	22	7	yes
GATCTGCTCTGATGGTATGT	19	8	yes
GATCTCAATAACTTCAGCAC	5	3	yes
GATCCTTCCCACTTCCCTAG	4	0	yes
GATCTGCTCTCAAAAATTCC	7	7	yes
GATCTGCTCTAACCAGGCGT	19	4	yes
GATCTGCTCCTTCTGTCCCA	263	72	yes
GATCTGCTCCTTAACGTTTT	42	19	yes
GATCTGCTCCTGGAGGTGGT	34	10	yes
GATCTGCTCCTGAGTGCTGT	4	4	yes
GATCTGCTCCCAAGTTATCT	39	16	yes
GATCTGCTCCAACTACAGGA	35	6	yes
GATCTGCTCAGTGACTTGTG	22	4	yes
GATCTGCTCACTCTATTACT	51	9	yes
GATCTGCTCAACAACTCCTT	4	4	yes
GATCTGCTATGTACTCCAGG	149	16	yes
GATCTGCTATCTCACCTGGC	24	3	yes
GATCTGCTAGCAGAACTTGT	14	9	yes
GATCTGCTAGAGCTGTAATA	148	33	yes
GATCTGCTAGACCAAAACAG	12	13	yes
GATCTGCTACTGGAGATGTT	184	13	yes
GATCTGCGTATGGCGGCCAT	2315	63	yes
GATCTGCGTACACCTGCGTC	4	4	yes
GATCTGCGGTGACTTGATGT	2272	220	yes
GATCTGCGCTATAGAAAAAA	16	3	yes
GATCTGCGCCTGCCTTGTCT	130	7	yes
GATCTGCGCCTGAGCCAAAG	800	63	yes
GATCTGCGAAGCCAGGCTTC	5	5	yes
GATCTGCCTTGGATTTCCTC	25	8	yes
GATCTGCCTGTTACCTCTTC	9	1	yes
GATCTGCCTGTCACTGTGGC	33	1	yes
GATCCCAGTGTCCTTGGAGC	4	3	yes
GATCTGCCTGAACGTGTGTA	38	14	yes
GATCTGCCTCAGGAAAAATA	46	12	yes
GATCCCAACATGAAATACGA	19	10	yes
GATCTGCCGCAGTAAGCGAG	2	2	yes
GATCTGCCCTTTCTGGGTGA	203	1	yes
GATCTGCCCTTGCACCCGGC	70	3	yes
GATCTGCCCGAAGCCATGAG	205	12	yes
GATCTGCCCCATGGTGTTTT	39	8	yes
GATCTGCCCAATCCTTCCTC	36	7	yes
GATCTGCCATTCCCATCTGT	17	4	yes
GATCTGCCATGGAGGAATCT	38	16	yes
GATCTGCCAGTTTTGGTGCC	80	7	yes
GATCCTGGTGCGGCTTTGGA	45	0	yes
GATCTGCCAGTCCGAGGTTC	156	23	yes
GATCTGCCAGGACAAGCTGG	168	32	yes
GATCTGCCACTTGTTTTAAT	4	4	yes
GATCTGCCACTGCTTCTCTA	44	14	yes
GATCTGCCACAGCAAGAGTG	142	11	yes
GATCTGCCACACAGTAGACT	12	11	yes
GATCTGCCAATGGTGCCGTT	13	1	yes
GATCTGATTGCCTTCATGGA	76	7	yes
GATCTGATTCTCTCTTCTGG	23	0	yes
GATCTGATGTTCTCTTCTGG	15	2	yes
GATCTGATGTGGTAATCAGC	7	7	yes
GATCTGATGTCCACTTCTGG	26	6	yes
GATCCTGGTACAAACAGTGG	1	1	yes
GATCTGATGTCAGTCGTGGT	122	20	yes
GATCTGATGTATGCCAAGCG	699	55	yes
GATCTGATGGTGGGGTGGCA	48	8	yes
GATCTGATGGTCCACTCTGC	73	25	yes
GATCTGATGGGTTTCTGGCT	180	49	yes
GATCCTGGCAGGATGCAGTG	16	6	yes
GATCTGATGCCTTCTGGTGT	21	4	yes
GATCTGATGCCTGTTAAGCA	10	2	yes
GATCTGATGCCCTTTTGTGG	65	4	yes
GATCTGATGCACTCGGGAGA	114	104	yes
GATCTGATGACTCCATATTT	18	7	yes
GATCTGATGAATAAAGGAGG	26	24	yes
GATCTCAAAACCAAAACCAC	100	47	yes
GATCGATACCGGCTGAAGCT	21	4	yes
GATCTATCGGCCTCTGCCTC	169	12	yes
GATCTATCCTAGCCGGGAGG	893	64	yes
GATCTATCCCAGAGTTCTAT	2	2	yes
GATCAGTCTCCATCAGACTT	147	3	yes
GATCAGACAAGCACGAAAGG	7	6	yes
GATCTGAGTTCTGTGCCAGC	15	14	yes
GATCAGTCAGAACAGCGAGT	5	1	yes
GATCAAATCCAGGGTTTTGT	12	3	yes
GATCTGAGTGGGTGGGGGGT	115	35	yes
GATCTGAGTCTGCTACACTG	4	3	yes
GATCTGAGTCCTCACACTGG	25	23	yes
GATCTGAGGTCCTGTTAGGG	1	1	yes
GATCTGAGGGTGATTTCTCT	5	5	yes
GATCTGAGGAGCAGATGATG	19	18	yes
GATCTGAGGACAGTTTTCAT	4	4	yes
GATCTGAGCTGCCCTCTGCT	20	18	yes
GATCTGAGCCTCCACCTGTG	124	10	yes
GATCTCAAAACCTTGCACAG	32	12	yes
GATCTATGACCCAGTTCACA	32	6	yes
GATCTTTGCCAAAATGTGTG	8	3	yes
GATCTTTGATTTTGCCCTGA	145	36	yes
GATCTTTGAGGTGCTAAGTT	6	2	yes
GATCTATGGATTTTGAGGAG	81	19	yes
GATCTTTCTGATAACGCAGA	15	8	yes
GATCTTTCTCTTCCCAGTTC	12	4	yes
GATCTTTCTACATCCCTGGG	32	29	yes
GATCTTTCGGAGGAGATGTC	137	28	yes
GATCTGAGCCCCACTGTTCC	16	1	yes
GATCTGAGCCCAGATGGAAG	15	4	yes
GATCTGAGCATAGCGTCAGA	10	5	yes
GATCTGAGCATAGAAGAAGG	8	7	yes
GATCTGAGCAGGTGAAAAGT	80	7	yes
GATCTGAGCACAGCCAGCTA	13	11	yes
GATCTGAGAGGAAGGTGGCT	13	12	yes
GATCTGAGAGCCGTGGTGCC	125	44	yes
GATCTGAGAGAGGAAACCTT	60	18	yes
GATCTGAGACCCTCCCTGAT	43	40	yes
GATCTGAGAAGATGTGGATG	24	22	yes
GATCTGACTGTTCCTGCAGG	29	5	yes
GATCTGACTGTACCCTGCCG	75	0	yes
GATCTGACTGCTACCCCTGT	6	6	yes
GATCTGACCTGTCCCAGCAA	8	2	yes
GATCTGACCTGGCTCCGTCC	40	37	yes
GATCTGACCTCGGAGTGTGC	132	6	yes
GATCTGACCGCTTTGGCCAA	10	9	yes
GATCTGACCGAGAACTGAAC	17	16	yes
GATCTGACCCTCCAGACTTT	10	3	yes
GATCTGACCAACAAGACCAC	45	1	yes
GATCTACCGTGCAGGGACTG	130	70	yes
GATCTACCGTAATGGCTCCA	14	16	yes
GATCTACCACCCTAACATCG	204	29	yes
GATCTTTCCAGAAGGTCTTC	8	5	yes
GATCTACACATGGGGCAACC	455	49	yes
GATCTAGTGACTGAGGCACT	10	4	yes
GATCACTGACTGCCCCAAAC	124	23	yes
GATCTAGCTTCCTGGGAGAC	59	5	yes
GATCTAGCAGCCATGTAGTA	3	2	yes
GATCTTTACAAGTCTGGCAC	14	7	yes
GATCTTGTTTGTGTCTCTGC	2	2	yes
GATCTTGTTGCCAATGGTAC	37	33	yes
GATCTTGTTGAGTCTGAGGC	18	6	yes
GATCTGAATTTCTTCCTCTT	44	2	yes
GATCTGAATTTCACAAGAAG	2	2	yes
GATCTGAATGTCCGAGAGAG	250	15	yes
GATCTGAATGCTGCCGAGTC	190	129	yes
GATCTGAATGCTGCAATGAA	17	2	yes
GATCTGAATGCTCTGGGGGC	221	10	yes
GATCTGAATCCACTGTGGCT	16	4	yes
GATCTGAAGTCTGAATGGCA	46	3	yes
GATCTGAAGCTGCTGATGAA	256	25	yes
GATCTGAACTCCAGAGAACA	271	11	yes
GATCTGAACCTGCCTGGAAA	6	1	yes
GATCTGAACACCCAGCGAGG	51	12	yes
GATCTGAACACAGTCCTTAT	1	1	yes
GATCTCTTTTTTCAACCACC	3	2	yes
GATCTCTTTTGCCAAGAAGT	43	5	yes
GATCTCTTTGTGTTCAAGAC	13	6	yes
GATCTGTACTCTCCAGCTGT	2	2	yes
GATCTAATTGCAGTGGTTAA	14	2	yes
GATCTACGCACGCATCAGCA	213	26	yes
GATCTTGTGGGTAGGAGGTG	7	7	yes
GATCTTGTGCCAGGTGGACT	4	4	yes
GATCTACCGTGCACACCCAG	6	5	yes
GATCTACCCTGACTCAGGTT	6	3	yes
GATCTTGTCCAGAGCTTCCT	22	25	yes
GATCTTGTATTCTCTGGCTT	308	8	yes
GATCTTGTACAAACCGGTTT	122	3	yes
GATCTTGGTTTTGAGTTCTT	4	4	yes
GATCTACAGCAAAGAGAAGC	17	2	yes
GATCTTGGTCACAGAAAAAA	14	13	yes
GATCTTGGGTTGTGGGAAAT	2	2	yes
GATCTCTTTGTCCTCCCAAT	16	3	yes
GATCTCTTTGGGCTGGGCCT	17	16	yes
GATCTCTTTGCTTTGAAACT	55	3	yes
GATCTCTTTCTTGTTCCCCC	183	20	yes
GATCTCTTTCTGAGACCTTT	57	5	yes
GATCTCTTTCCTGGACATTT	12	1	yes
GATCTCTTGAATGACAGACA	38	20	yes
GATCTCTTCTTCCGCCCTAT	82	0	yes
GATCTCTTCTCGCGCTCTCC	27	10	yes
GATCTCTTCCATGTTACAAG	6	2	yes
GATCTCTTCAGCTCTGCCAA	7	6	yes
GATCTCTTCAGAAGGGCACT	56	15	yes
GATCTCTTCACTGTTTTTCT	73	21	yes
GATCTTGGGGTCCTTCTCAA	142	53	yes
GATCTTGGGGGAGAGAGGGA	13	12	yes
GATCTTGGGGAGTTTGACTG	12	5	yes
GATCTTGGGCCAAACTGGGA	19	17	yes
GATCTTGGGACTCTACTGTG	8	7	yes
GATCTTGGCTCTGTGGAATG	211	39	yes
GATCTTGCTTTGTGACTTTT	12	3	yes
GATCTCTTATCGTTTCTCAG	5	2	yes
GATCCTGCTTAGAAGTCACG	6	1	yes
GATCTCTTAGACCCCTGCTT	27	1	yes
GATCCTCATGAGCTGAAAAA	1	1	yes
GATCTCTGTGTTCAGGCTCT	31	5	yes
GATCTCTGTGTGTGTGTGTG	21	24	yes
GATCTCTGTGGGCCTTTGGG	89	4	yes
GATCTCTGTGGAGGAAATGG	49	5	yes
GATCTCTGTGCTTTCTTCCT	3	2	yes
GATCTCTGTGCTGGCGCCTG	63	20	yes
GATCTCTGTGCGCCTTCCTG	45	0	yes
GATCTCTGTGAGCCTAGGAG	10	9	yes
GATCACTTGGCCCAGGAGAG	16	5	yes
GATCTAACTCCTGTTGCTCT	45	0	yes
GATCTTGCTTCAGCCAACGC	274	49	yes
GATCACGTCTTAGCAGTATC	2	2	yes
GATCTTGCTCCAGCTCACCC	9	8	yes
GATCTTGCGTGTTCTGTCCG	60	3	yes
GATCACGATGGCTATGGCGC	16	1	yes
GATCTTGCCCCTGCCAGTGG	89	45	yes
GATCACCTTTTTTGACGAGT	30	5	yes
GATCTTGCATCCGCCAGCCA	225	29	yes
GATCTTGCAGGACGTTCTCT	37	4	yes
GATCTTGCAACAAACTCAGA	13	11	yes
GATCACGTCTATGACCGGCT	4	4	yes
GATCGAAAGTTACTACCACA	32	4	yes
GATCGTCTGCTGTGAAACGT	187	7	yes
GATCGTCGGCAACGACATGT	6	6	yes
GATCGTCCCCAAAATTGCCT	30	2	yes
GATCGTCCAGAGTCACTCAA	6	5	yes
GATCGTCAGTGCAGGAGCAT	5	0	yes
GATCGTACGGGGCTGGAAAC	136	1	yes
GATCACATGAGCCTCCAAAT	11	2	yes
GATCTTGACCTTATCCAGTC	36	3	yes
GATCGGTGGGACCCGGGCGA	282	72	yes
GATCTTGACAGGCTGGACCT	13	12	yes
GATCGTGGTGGAAGACAAAG	7	7	yes
GATCGTGGGCTTCAGCACCC	258	4	yes
GATCTTGAAGAACTGCACTA	17	4	yes
GATCGTGGATGAGTTTACTC	6	5	yes
GATCTTGAAAACCTGTCAGT	35	18	yes
GATCTCCAGTGTCAGTGCAT	3	2	yes
GATCGTGACCAGCACCTACA	37	8	yes
GATCCACATGGGACCAGCTG	2	2	yes
GATCGGTCTGAGATGACTCC	34	4	yes
GATCACACTGAAGATGCCTC	33	3	yes
GATCGGCTTTGAGAGAGGGT	35	1	yes
GATCACCGGTTTCCGACTGA	5	6	yes
GATCAAAGTCAGATGCTATA	8	1	yes
GATCTTCTCTCCACGTGGGA	6	6	yes
GATCTTCTCCCTGGGTTACT	42	1	yes
GATCTTCGTGGAGTTCACCT	85	10	yes
GATCTTCGTCCCCGACCATC	5	5	yes
GATCTTCGGCCCCAAAAAAA	33	30	yes
GATCTTCGAGGAGGGCGAGT	141	36	yes
GATCTTCGAGACTTTGTTAG	25	0	yes
GATCCTTCAGACCCGTCACA	46	10	yes
GATCTGACTGCCAAATAAAT	4	3	yes
GATCGGCAAGCTGGAAGGCT	30	28	yes
GATCGGAATCGGAAGGAGAC	9	2	yes
GATCAGTTGACAGTGGCAAT	854	52	yes
GATCTTTCTACCTCTCTGCC	12	11	yes
GATCTTCCTGCCTCTGCTTC	168	3	yes
GATCTTCCTCTAGTGTCCAA	3	3	yes
GATCTTCCTCATTTACCCTC	26	24	yes
GATCTTCCTACTTCCTCCTC	12	11	yes
GATCGGCTCTGAAGATTTCA	3	2	yes
GATCACCAGCCTTTTGCAAA	67	16	yes
GATCGGCGGGAAATGGCGGA	111	33	yes
GATCGGCGCCGTGAGATTCG	40	8	yes
GATCTTCCCAGTTATGGCCA	31	7	yes
GATCAGGTTCAGCGTCCTCT	9	5	yes
GATCGCTCATTGGAACAGCT	1291	34	yes
GATCCGCTGCCGCCCCCTGC	20	18	yes
GATCAACGGGGCCACGTGCA	13	15	yes
GATCGCCGCTGGCTAGTTCC	12	13	yes
GATCGGCAGCCAGAGTAGCT	157	25	yes
GATCGCCGAGCCAGCGCCGG	16	15	yes
GATCGCCCTTGCTGGTCTGC	26	8	yes
GATCGCCCTGCACCAGAACT	7	6	yes
GATCTTCCAGATTGTGTGCA	14	16	yes
GATCTTCCAAGTCTCTCATT	1	1	yes
GATCAACCAAGCCCTGGGAG	13	0	yes
GATCCTGGGGTCTGGTCAGC	4	4	yes
GATCTTCAGTTTGCTTTGTG	20	0	yes
GATCTTCAGTAGTCTCTCCT	96	13	yes
GATCTTCAGGTGGCCAAGTG	2	2	yes
GATCTGAAGCAATGTGACTG	13	10	yes
GATCTTCAGCTCTCAGAAGA	28	25	yes
GATCTTCAGCCTCTTGGGGA	38	1	yes
GATCTTCAGATTGGTTTCTG	1	1	yes
GATCTTCACTCACGTCCGGC	22	3	yes
GATCTTCACGTGCTGGACAC	2	2	yes
GATCGCCTGCTAGTGCGGGA	96	4	yes
GATCTTCACCGGAAGGTGCA	129	34	yes
GATCTTCACAGTGCATGGCT	3	1	yes
GATCCAGAGTGTGCCCTGCA	7	7	yes
GATCTTCACACACAGCAGAT	24	3	yes
GATCGCCGCCTGAATGTGTG	10	2	yes
GATCTTCAATGGACACATTG	230	56	yes
GATCTTCAACCGCCGCCTCC	3	2	yes
GATCTGCTGCCAGCATTAGC	4	3	yes
GATCTTAGCATTCTGTCAGA	1	1	yes
GATCAAACTTGAGGCCCTTC	35	12	yes
GATCTGTTGGTGCTGCTACT	29	9	yes
GATCAAAAGGGACTCGTGTA	87	40	yes
GATCTCTTTTCAGAAGTGTC	228	3	yes
GATCCCATGCATGGCAGCTT	5	1	yes
GATCTGCCTGACTTCCCTGA	46	20	yes
GATCAAGTAGATTTTTGTGG	1	1	yes
GATCTTTATCTGACCCTCAG	2	2	yes
GATCTGAGCCGGTCGAGCCC	131	15	yes
GATCAGGGATGCAGTACCAC	30	27	yes
GATCAAAGGTGGGATTTGTA	4	5	yes
GATCACGACCCCTTTGTGGG	2	2	yes
GATCATGTTCACAACGCAGG	38	7	yes
GATCTCTGTGCTGTAAACTA	8	3	yes
GATCGCCAGCCTCTGTGTGT	1	1	yes
GATCTACTCGAGTCAGAATG	1	1	yes
GATCCCAAGGGGGAGGGCTC	5	1	yes
GATCCCTTTTCCATTCTGGA	114	29	yes
GATCCCTTTGGGGTGTGGAA	278	9	yes
GATCCCTTTCTCTGGCCCAG	554	60	yes
GATCCCTTTCCACCTAAAAC	25	1	yes
GATCCCTTTACCCAATCGTC	5	2	yes
GATCCCTTGTGAGCCCTAGT	145	18	yes
GATCCCTTGTAGCCAGAGTT	182	40	yes
GATCCCTTGGGCAAGTATCA	40	15	yes
GATCCCTTGCTTGCCTCTTG	66	10	yes
GATCCCTTGCTTCAACCTCC	31	5	yes
GATCCCTTGCTACATCTCCT	16	3	yes
GATCCCTTGCCTCCTGAGTT	114	0	yes
GATCCCTTGCATTTGCAACA	122	20	yes
GATCCCTTGCAGTTCTGTGC	74	0	yes
GATCCCTTGCACACAGCCCA	523	57	yes
GATCCCTTCTTTTTTGGCAT	13	11	yes
GATCCCTTCTGCTCTACCTC	54	6	yes
GATCCCTTCCTTTGAAGTGA	21	19	yes
GATCCCTTCCTGCCCTCTTT	203	21	yes
GATCCCTTCCCCAGCGGTTC	142	3	yes
GATCCCTTCCAGCTGAGCCC	172	5	yes
GATCCCTTCCAAATCTGCTC	72	6	yes
GATCCCTTCATTGGGGACCC	2	2	yes
GATCCCTTAGGTGTAGGTCC	73	1	yes
GATCCCTTACTGTTGTGTCT	41	10	yes
GATCCCTGTTTGGACATCAG	4	3	yes
GATCCCTGTTCCCCTGAGAA	28	10	yes
GATCCCTGTGTTCTACATGG	15	4	yes
GATCCCTGTGGTCACTTAGC	111	19	yes
GATCCCTGTGGATTTTGAAA	17	2	yes
GATCCCTGTGAGTTCAAGGC	62	14	yes
GATCCCTGTCTCGGGAGGTC	53	9	yes
GATCCCTGTCTAGTCCCTGT	127	32	yes
GATCCCTGTCCTTTCTGTTT	6	2	yes
GATCCCTGTCCCCCTACCCC	14	13	yes
GATCCCATGGAGTCCAAGGT	11	5	yes
GATCCCATCCCTGGCTGCCT	3	3	yes
GATCTTGGACCGATTGAATG	2	2	yes
GATCTTGCTGCTGTAGGAAG	39	10	yes
GATCTTGCCCCTTGAAGTAA	2	2	yes
GATCATGGGTTGGGAGCTCA	329	33	yes
GATCATGGGGTACTCAATGC	13	1	yes
GATCATGGGCAAAAAGCCCG	80	17	yes
GATCACATGAAGGAAGCTCC	4	3	yes
GATCCAGCCCACTGTGGGTG	3	2	yes
GATCAGGAGCTGGAGAGGAA	193	51	yes
GATCCCTGTACACTATGTCT	8	0	yes
GATCCCTGGTTGCATCTTCG	13	5	yes
GATCCCTGGTGGCTGCCCTT	662	12	yes
GATCCCTGGGTGCCAGTTTT	300	5	yes
GATCCCTGGGGGCTGTGATG	125	9	yes
GATCCCTGGGGCTGCCTGTC	294	6	yes
GATCCCTGGGGCATGTTGTA	136	17	yes
GATCCCTGGGGAGCCTGCGG	32	8	yes
GATCCCTGGGAGGATATGAG	37	4	yes
GATCCCTGGGAACGAAGCTG	22	5	yes
GATCCCTGGCTCAGTGAACA	48	4	yes
GATCCCTGGCGTCCCTATCA	164	12	yes
GATCCCTGGCCCCTGTGCCA	97	15	yes
GATCCCTGGCCAGAAGTACA	83	2	yes
GATCCCTGGCACTGCTGCCT	62	17	yes
GATCCCTGGCACCCAGCATC	94	8	yes
GATCCCTGGAGTGACCAGAG	3014	246	yes
GATCCCTGGAGTCTCTGAAG	48	8	yes
GATCCCTGGACTGGAACAAA	21	20	yes
GATCCCTGGAAGCTGTGATG	122	2	yes
GATCCCTGGAAGCAGGGACA	320	39	yes
GATCCCTGGAACAGAGTTAT	35	7	yes
GATCCCTGCTTTTGTGGCCT	327	18	yes
GATCCCTGCTTCCTGCCCAG	60	6	yes
GATCCCTGCTGTTGGCAATA	17	16	yes
GATCCCTGCTGCGCATTCTG	4	0	yes
GATCCCTGCTCTTAGGTGCT	18	2	yes
GATCCCTGCTCTGGACCCTC	386	45	yes
GATCCCTGCTCCCCTCTGGG	168	44	yes
GATCCCTGCTCCAGGTCCTC	215	4	yes
GATCCCTGCTAATGGAAGAA	80	1	yes
GATCCCTGCTAAAACCATGT	2	2	yes
GATCCCTGCCTGTGGGGGGT	114	15	yes
GATCCCTGCCTGTCCTGAAA	43	12	yes
GATCCCTGCCTCGTCTGCCT	205	10	yes
GATCCCTGCCGAGGTGCTCA	349	44	yes
GATCCCAGGGACTCTGTTTT	74	2	yes
GATCATGGCGGTCAGCAGAA	25	0	yes
GATCATGGCCTGGTGCAGTA	6	1	yes
GATCATGGCAGTGGGAGACC	22	8	yes
GATCATGGCAGGGATACGCA	55	11	yes
GATCATGGCAGGCCTTTAAC	196	8	yes
GATCTTGATGCGGGTGGAAC	13	12	yes
GATCAAATCTTCCTGTGCTG	14	2	yes
GATCCCAGATTGCCAGCGTC	31	11	yes
GATCCCAGAGTGCTTGATGC	9	2	yes
GATCCCTGCCCTTTGGCCTG	27	1	yes
GATCCCTGCCACCTCATTGG	90	7	yes
GATCCCTGCATTTCCTCAAG	190	13	yes
GATCCCTGCATAGGACTGTT	7	1	yes
GATCCCTGCAGTACCATCTG	21	4	yes
GATCCCTGCAGGTCGCTCAG	230	5	yes
GATCCCTGCAGCTGGGCGAG	9	3	yes
GATCCCTGCAGCGCTGTTTG	271	25	yes
GATCCCTGCAGAGGCTTCCA	21	5	yes
GATCCCTGCAGAAGGGGGGT	62	8	yes
GATCCCTGCACAAGGTGTTT	114	25	yes
GATCCCTGCAACAGCAAGGG	59	11	yes
GATCCCTGAGTTTACCAGCG	107	6	yes
GATCCCTGAGTTCAAGGCTA	32	3	yes
GATCCCTGAGTTCAAGGCCA	38	7	yes
GATCCCTGAGTAAACTTCTT	14	12	yes
GATCCCTGAGGTCTCCTGCC	118	3	yes
GATCCCTGACATAGCAGGAC	23	2	yes
GATCCCTGAATCCCCTACTC	41	12	yes
GATCCCTCTTCTGGTGTGTC	22	7	yes
GATCCCTCTTACCTGCAACG	348	27	yes
GATCCCTCTGTACAGCATCC	14	3	yes
GATCCCTCTGGTGACTCCAC	214	20	yes
GATCCCTCTGGGTCATGTCT	187	8	yes
GATCCCTCTGAACTGTGGAG	3	2	yes
GATCCCTCTGAACCGCCGAG	7	6	yes
GATCCCTCTCTTCAATGATG	22	1	yes
GATCCCTCTCTCTGGGGAAT	21	0	yes
GATCCCTCTAAGCCCCCTCC	65	15	yes
GATCATGCCACAATGACAGA	2	2	yes
GATCCCACTTCTGCGTCTTA	123	28	yes
GATCATGCAACTGATGGAGA	16	6	yes
GATCCCACCTGTAACTGAGG	4	3	yes
GATCCCACCGCACGCTGAGC	7	7	yes
GATCAGCTGTCACTCCCGTC	4	4	yes
GATCCCTCGGTGACCACATT	206	29	yes
GATCCCTCGACGGCCAAGCC	13	12	yes
GATCCCTCCTTGTGAGCAGC	359	27	yes
GATCCCTCCTGTCACTGCAG	17	3	yes
GATCCCTCCTGGGCATTGCT	39	9	yes
GATCCCTCCTCAGGCATCTG	859	32	yes
GATCCCTCCCTTGGGCCTCC	5	5	yes
GATCCCTCCCTCCGAGGCCA	186	2	yes
GATCCCTCCCCTCCCTGGCT	105	7	yes
GATCCCTCCCCACCCTGCTC	124	35	yes
GATCCCTCCCAGAAACCTGC	2706	360	yes
GATCCCTCCAGCCTCTACTG	18	17	yes
GATCCCTCCAGACACCAAGG	425	35	yes
GATCCCTCCACAAGATTCTG	46	5	yes
GATCCCTCAGGGTGTGTGCC	34	8	yes
GATCCCTCAGGAACAGAGGG	170	26	yes
GATCCCTCACCTCCTTCATC	231	55	yes
GATCCCTATGCTGACCCCAA	49	2	yes
GATCCCTAGTGGCCCATCAT	21	7	yes
GATCCCTAGGGAGAAGGTGG	419	49	yes
GATCCCTAGCCCCATCCCAA	88	6	yes
GATCCCTAGCATTCTGTACT	832	86	yes
GATCCCTAGAGCCAGCACAT	178	27	yes
GATCCCTAGAAACTCTCTGG	18	2	yes
GATCCCTACTGCACCACCTT	200	3	yes
GATCCCTACTCGTTTCAACA	42	8	yes
GATCCCTACTATTGATTCTG	22	3	yes
GATCCCTACTACGTGCTGGA	1686	313	yes
GATCCCTACCTACAACCCTA	470	101	yes
GATCCCTACCCCACATGCTG	336	42	yes
GATCCCTACCCATGGGAATG	149	0	yes
GATCATGAGCTGGAGGCACC	23	11	yes
GATCATGAGAAAGCTCAGGT	46	8	yes
GATCTTCGGTGCCACCGGCA	67	2	yes
GATCATGACATTGTAGCCAG	16	1	yes
GATCATGACAGTCCCCCCAC	106	7	yes
GATCCCAAGTGGCACTGTTT	7	0	yes
GATCCCAAGACAAAGCACCG	23	9	yes
GATCATCACAGATTCAATGG	4	4	yes
GATCCCTACCCATGGACCCT	2981	221	yes
GATCCCTACCCATACAAAAA	1	1	yes
GATCCCTACCACCTGCCCGA	233	31	yes
GATCCCTAATGAGAGCAGAG	52	13	yes
GATCCCTAAAGGGTGTGCTA	13	3	yes
GATCCCTAAACTACCTCTTG	89	10	yes
GATCCCGTTTGTGAAGCCTG	4	4	yes
GATCCCGTGGACTGTTTGCT	68	22	yes
GATCCCGTCCAAGGAGCATC	783	75	yes
GATCCCGCGAGGCCCGGAAG	2059	118	yes
GATCCCGCCTGCCCAGCTGA	399	20	yes
GATCCCGCCGTTCCACCCTC	111	29	yes
GATCCCGCCCACCCAAAGCT	166	14	yes
GATCCCGCCAAAAGAATTAC	123	4	yes
GATCCCGCACATCCACAAGT	206	13	yes
GATCCCGAGATTGCCAGCCT	1054	111	yes
GATCATCTGCTAGGGTGTGG	7	1	yes
GATCCACAAACTTCCTGACA	65	8	yes
GATCTTCCCCCATCCTGAAC	18	16	yes
GATCATCTAGTACGGGTACT	58	1	yes
GATCCATTCGTGTGCATTCT	11	12	yes
GATCCCGACACCAAGGAGAT	1935	100	yes
GATCCCGAAAACCAGAACTT	12	1	yes
GATCCCCTTTTTGAACAGGT	133	17	yes
GATCCCCTTTCTTTACCTTC	50	4	yes
GATCCCCTTTACCTTCTGGG	1523	37	yes
GATCCCCTTGGTTGCTGGAT	60	3	yes
GATCCCCTTCTCAGGGTCTA	226	33	yes
GATCCCCTTCCTACCTCTAG	35	32	yes
GATCCCCTGTTGACTTACAA	37	4	yes
GATCCCCTGTATATGTTGAA	1	1	yes
GATCCCCTGGGTTGAGAGAT	27	6	yes
GATCCCCTGGGGCAAGCTGC	629	107	yes
GATCCCCTGGGAGGAGACAG	474	17	yes
GATCCCCTGGCAAGAAGGAA	3	2	yes
GATCCCCTGGATACATGGTC	50	6	yes
GATCCCCTGGATAAAAGCGT	10	9	yes
GATCCCCTGCTACACTGATG	51	0	yes
GATCCCCTGCCTCCACCTCC	132	46	yes
GATCCCCTGCCTCAGCTCCT	281	6	yes
GATCCCCTGCCCCCCAACCA	138	20	yes
GATCCCCTGCAACAGACATT	62	5	yes
GATCCCCTGAGATGGAATTA	16	4	yes
GATCCCCTCTTCCCAAATAA	63	9	yes
GATCCCCTCTGGGCCTCCGA	31	4	yes
GATCCCCTCTCCTGCCCACA	174	27	yes
GATCCCCTCGGACCCCCTTG	1664	15	yes
GATCCCCTCCTTTCTGCCTG	7	2	yes
GATCCCCTCCTCCAGGCAGT	238	18	yes
GATCCCCTCCCTTGCTTTCT	94	15	yes
GATCCCCTCCCTCTGATTTT	4	4	yes
GATCCCCTCCCAGGCTGTCC	18	0	yes
GATCCCCTCCCACAGAATAG	5063	408	yes
GATCCCCTCACATGTGCTAT	140	33	yes
GATCCCCTATGGGGAGGAGG	96	2	yes
GATCCCCTATGCAAGCTGTG	39	10	yes
GATCCCCGTTGTACCTGGTG	57	12	yes
GATCCCCGTGTGTTTGCAGG	67	4	yes
GATCCCCGTGCCCCTGCCTA	255	52	yes
GATCATCCTGAGAACAAGGG	1	1	yes
GATCATCCGGATGCCTGGTC	11	10	yes
GATCATCCCCTGGCAAAGGC	8	7	yes
GATCCATGGGCATCACAAAG	38	13	yes
GATCTTCACTGCAGATGTGG	137	17	yes
GATCCATCTGCCTTCTCCAG	13	11	yes
GATCATCACGTACAGGAACC	22	21	yes
GATCAAACTGAATGAAACAC	29	1	yes
GATCCCCGTCTGTGTCTGTG	103	10	yes
GATCCCCGGTGCTCTTCGTG	507	44	yes
GATCCCCGGGAAAGTGTAGT	9	0	yes
GATCCCCGCAGAATCAGGAA	23	2	yes
GATCCCCGCAAAGTGAGCGA	31	9	yes
GATCCCCCTTTGCTGCCTCC	4	1	yes
GATCCCCCTGATGGAGAGAA	31	1	yes
GATCCCCCTCCCTGCTCTCA	63	15	yes
GATCCCCCTCCCCCCAGTGG	574	268	yes
GATCCCCCCCTTTTTTTGTC	77	4	yes
GATCCCCCCCAGCACACTCT	89	1	yes
GATCCCCCCACCCCACCACC	763	145	yes
GATCCCCCCAACTGTGTGCC	5	5	yes
GATCCCCCAGGTCTCAGAGG	312	58	yes
GATCCCCCAGGGAAAGACTT	29	9	yes
GATCCCCCACCTCCTCGGCC	75	46	yes
GATCCCCCACCCCCACCCCC	30	33	yes
GATCCCCCACATCCTGGGGC	269	49	yes
GATCCCCATTTGCAGTAAGA	56	5	yes
GATCATCACCTGACCCACTT	4	3	yes
GATCCATCCACCTTCAATGT	53	19	yes
GATCATCAAACAACCTGTAG	4	4	yes
GATCATATGGGTGATTCAGT	8	7	yes
GATCCCCATGTTGAGCTCTG	379	1	yes
GATCCCCATCTGCAGTACAA	24	1	yes
GATCCCCATCTGACTCAGTA	17	6	yes
GATCCCCAGTTGTGTCAATG	23	3	yes
GATCCCCAGTCTTTAGTCCC	445	34	yes
GATCCCCAGTATGCAGTAAT	2	2	yes
GATCCCCAGGGGCTCCCGGT	309	10	yes
GATCCCCAGGAGATGAGGTC	10	1	yes
GATCCCCAGCTCCTTTCAAA	38	8	yes
GATCCCCAGCCTTGGATAGT	183	28	yes
GATCCCCAGCCCAATCTTTC	3	2	yes
GATCCCCAGCATTAGGCCAT	36	3	yes
GATCCCCAGCAGTAACACTT	105	29	yes
GATCCCCAGCACCACAAAAA	6	6	yes
GATCCCCAGCACAGGAAGGC	20	1	yes
GATCCCCAGAGTCCCCTGTG	218	6	yes
GATCCCCAGAGCCTTGGGGA	20	18	yes
GATCCCCAGAATCCCCAATA	25	2	yes
GATCCCCACTTTTGTGACTT	13	11	yes
GATCCCCACTGTGCCTTTTT	243	5	yes
GATCCCCACCAGCCACCCCC	825	145	yes
GATCCCCACAGCTGCGTATG	504	2	yes
GATCCCCAAGTCTGTGACAC	1334	63	yes
GATCCCCAAGAGTCCCCCAA	25	2	yes
GATCCCCAACCCCCCAAAAA	43	39	yes
GATCCCCAACAATGTGAAGA	510	10	yes
GATCCCCAAAGGGCAGGTCC	3	2	yes
GATCCCCAAAGCCTGGAGCC	457	44	yes
GATCCGAAATGGCACCTTAG	6	5	yes
GATCCAGTGTGGGGCAGCGC	36	11	yes
GATCATACCCACGTTGCCCA	14	4	yes
GATCTTAACATCTCCTTTGA	4	4	yes
GATCATAAGAGGCACGTGAT	72	4	yes
GATCAGTTTGTGCCCAACAG	22	5	yes
GATCAAAACAAGACCCAGCT	66	3	yes
GATCCCCAAAAGGGTTAAAA	4	3	yes
GATCCCATTTTTGACAGCAA	66	26	yes
GATCCCATTTCACAGGTGTA	5	0	yes
GATCCCATTGGAGCTCTGTT	21	2	yes
GATCCCATGTTCAAGCTGGT	79	14	yes
GATCCCATGTGTTTAGTAAT	4	2	yes
GATCCCATGTGTCTTTTTGC	43	7	yes
GATCCCATGTGTCTCCCCCA	263	13	yes
GATCCCATGTGCCACCATCA	106	14	yes
GATCCCATGTCCTGCTTTCT	51	9	yes
GATCCCATGCTTTGAAAAAT	3	1	yes
GATCCCATGCTAGCCTCTTG	264	8	yes
GATCCCATGCCTGGAATTTG	33	4	yes
GATCCCATGCAGAGCGGCCT	226	17	yes
GATCCCATGAATCATTTGCC	12	2	yes
GATCCCATGAAATCCCCAAA	39	2	yes
GATCCCATCTCCTGGAAGGA	70	12	yes
GATCAGGCTGGTTCACAAGC	4	0	yes
GATCCCATCAAAGCAAATAA	3	2	yes
GATCCCATATCCCTGTGAAA	110	3	yes
GATCCCATACCTGACATGAC	12	2	yes
GATCCCATACAATGCCGCCC	136	22	yes
GATCCCAGTTTGCTTCATGA	61	7	yes
GATCCAGTCACACCCCACCC	66	61	yes
GATCAGTTACTTACCCACTC	6	1	yes
GATCCAAACTTCTACAGCAA	22	4	yes
GATCCAGGTGTGAGATGATG	3	3	yes
GATCAGTGGGTGCCCGTGAT	14	1	yes
GATCCAGGGGGTGTGGCTGC	11	3	yes
GATCAGTGCTGGGAATACTG	4	2	yes
GATCAAGGCCACGGGGAGGA	92	14	yes
GATCCCAGTTCATAATGAAC	3	2	yes
GATCCCAGTTCAGTTCCCAG	3	3	yes
GATCCCAGTGTTGCTACGTG	922	159	yes
GATCCCAGTGTGAATCATGG	23	11	yes
GATCCCAGTGGTATTCCGCC	62	8	yes
GATCCCAGTGGATGAAGTGT	97	10	yes
GATCCCAGTGCTGTGGAAGT	20	5	yes
GATCCCAGTGCTGGTCAGTT	289	24	yes
GATCCCAGTGAGATGCTGGT	97	8	yes
GATCCCAGTGAAGGGTTTCT	38	14	yes
GATCCCAGTCTGAGTGATTA	20	1	yes
GATCCCAGTCCTCCTGGGCA	80	15	yes
GATCTAGGCCTTGTGGCTTG	2	0	yes
GATCCCAGGTGTCCCCATTT	199	2	yes
GATCCCAGGTGGAGCAACCC	263	20	yes
GATCCCAGGTCCCTCTGGGA	153	20	yes
GATCCCAGGGTTTTCTTGGT	4	2	yes
GATCCCAGGGGTCCTAGGGG	61	11	yes
GATCCCAGGGGCTCTTCTGC	121	5	yes
GATCCCAGGGAAAGTGCTAT	552	22	yes
GATCCCAGGCTCCACCAGCG	53	2	yes
GATCCCAGGCTAGCAAGCAA	321	13	yes
GATCCCAGGCGTCAAGCTCG	49	16	yes
GATCCCAGGCAAGGGATGGT	83	4	yes
GATCAGCAGCTAACCCAGCA	9	8	yes
GATCCCAGGAGTCAAGCTCT	208	16	yes
GATCCCAGGAGAGAGGCTTC	2	0	yes
GATCCCAGGAAGGACCATCA	44	7	yes
GATCCCAGGAAAGTTCTAAT	27	2	yes
GATCCCAGCTGGAGAAGCCC	35	5	yes
GATCCCAGCTATGATGTAGC	27	1	yes
GATCCCAGCGCTTAGCCACC	3	2	yes
GATCAGACCTTAATGCCACT	10	9	yes
GATCCTACTATGAGCAAAAA	40	1	yes
GATCCTCAGAGGAACAGGGC	4	3	yes
GATCCTAGAAGGACAGCTTT	68	9	yes
GATCGCGTCTGTTCCAAGGG	2	2	yes
GATCGAAGATGCCTCGGGCC	16	15	yes
GATCACACATGGCCTTTGGT	4	4	yes
GATCCTTTCGATGTTTGTTT	4	2	yes
GATCTCTGTCTTTCCCTGGT	274	37	yes
GATCTCTGTCACATCCGATG	136	50	yes
GATCTCTGTATGTTCGAGCC	32	30	yes
GATCTCTGTAAACAGTTTGG	44	40	yes
GATCTCTGGTTGCTTTCAAG	19	6	yes
GATCTCTGGTCCTTCCTCTG	2	2	yes
GATCAAGAGGTGAGGAGAGG	1	1	yes
GATCTCTGGGGCAGACGGTG	56	19	yes
GATCTCTGGGCAGTCATGGT	63	14	yes
GATCTCTGGCTCTTCATCCT	93	6	yes
GATCTCTGGCCTGTGGAGTA	296	36	yes
GATCTCTGGCCAGGCAAGTT	21	5	yes
GATCTCTGGATGGAAATGTA	17	6	yes
GATCTCTGGAGGTCCCGGTG	124	113	yes
GATCTCTGGAGCCTGAATTC	16	15	yes
GATCTCTGGAAGGTGAGCCT	136	36	yes
GATCTCTGGAAAATTGCCAT	30	14	yes
GATCTCTGCTGTGGGAAAGG	515	91	yes
GATCTCTGCTGTCGGTTTCT	19	10	yes
GATCTCTGCCCCAAATCCAA	44	7	yes
GATCTCTGCCCAAACCAGGC	571	41	yes
GATCTCTGCCACCCACCCAC	62	5	yes
GATCTCTGCATTCTTCATGG	1	1	yes
GATCTCTGCAGCTGGAGTCT	30	28	yes
GATCCGAGTGTCCCCTCTGC	15	7	yes
GATCACGTTCTCCAGGAACA	14	3	yes
GATCTCTGCAAGCAGTTGTC	38	8	yes
GATCTCTGCAAAATAGACTT	19	3	yes
GATCTCTGATGGCTGGGGAG	320	88	yes
GATCCTAACCCTGTCATGAC	41	7	yes
GATCAAAAGGTAAAGGCCAG	32	29	yes
GATCTCTGAGGAGGTGGCTC	119	12	yes
GATCTCTGAGCGTGTGGGTC	14	12	yes
GATCAAAACTCAAGGCGCTA	9	4	yes
GATCTCTGACTGTGACCTTC	6	5	yes
GATCTCTCTTGTTGGAAGGA	93	6	yes
GATCTCTCTTCCCAGAGGAA	648	3	yes
GATCTCTCTGGAACTATCTA	33	9	yes
GATCTCTCTGCTCATACCCT	59	20	yes
GATCTCTCTCCTTGGCCTTC	40	5	yes
GATCTCTCTCCTGAGCACTA	2	2	yes
GATCTCTCTCATTCAACTTT	27	1	yes
GATCTCTCTCATCGAGAGCA	60	4	yes
GATCTCTCTCAGTGTGTCTG	6	3	yes
GATCCTGGTCTTCGTCATCT	3	3	yes
GATCGCACAAAAGAAGCAAT	11	0	yes
GATCTCTCGTGTGCCTTTGG	99	30	yes
GATCTCTCGAGCAGCAGCAG	134	23	yes
GATCTCTCCCGTTCTCAGCA	14	5	yes
GATCTCTCCCCAGAGCAACG	292	23	yes
GATCTCTCCATATCAAGCGA	1141	100	yes
GATCTCTCCAAGCTCACAAG	11	10	yes
GATCTCTCAGGCCAGGATTT	157	19	yes
GATCTCTCACTGGACCAGCG	16	15	yes
GATCTCTCACAGACCTGGTC	9	2	yes
GATCTCTATCCTAACGTCCA	30	0	yes
GATCTCTAGCTGCTGTGTAT	14	1	yes
GATCCTTTTCAGACTGGCTT	4	4	yes
GATCAAGATAACGGTGGCTT	28	2	yes
GATCCGGGCCTGGATGTGTA	28	9	yes
GATCTCTAGAAAAGTCGTTT	2	2	yes
GATCTCTACTTTGGAGTCCT	122	41	yes
GATCTCTACTGGCAGGCCAT	437	87	yes
GATCTCTACTGCTGTTAGGT	53	4	yes
GATCTCTACTCCCAGGAGAT	129	6	yes
GATCTCTACCCTTCATGATT	6	3	yes
GATCTCTACCCAACTGTCCA	21	9	yes
GATCTCTACCACCCAGGTAG	277	7	yes
GATCTCTACAGTATTGTGCT	3	2	yes
GATCTCTAAACTGTGACACA	43	11	yes
GATCTCGTTCATTGGCAAAA	50	13	yes
GATCTCGTGCAACTGTTGTC	362	21	yes
GATCTCGGTGTCATCAGAGG	9	8	yes
GATCTCGGTCTGTGCCGGGG	144	16	yes
GATCTCGGGTGCGTGGCTGG	17	16	yes
GATCTCGGCCTCACAAATCC	56	5	yes
GATCTCGCCGTGTCCCTGGG	7	0	yes
GATCTCCTTTGTGAATGGTG	21	2	yes
GATCTCCTTTCCGGAAGCAA	182	7	yes
GATCTCCTTGGGGAGGTGGG	4	3	yes
GATCCATGAGAATGAGAAGC	19	2	yes
GATCCACCTGCCTCCTTTCC	4	4	yes
GATCTCCTTGGAGTCTCAAG	2045	192	yes
GATCTCCTTCCTTAGGTTAT	4	1	yes
GATCTCCTGTTGTCTGGGCT	21	8	yes
GATCTCCTGTTACTAATGCT	2	2	yes
GATCTCCTGTGAACACCACA	70	24	yes
GATCTCCTGTCTATGTGGGC	74	17	yes
GATCTCCTGGTCAGGAAGAA	28	11	yes
GATCTCCTGGGCTGTTTCTC	83	43	yes
GATCTCCTGGAAGCTAGCAG	178	56	yes
GATCTCCTCTTCGGGGTTCT	26	3	yes
GATCTCCTCTGATGCTGCAC	20	0	yes
GATCTCCTCGCTGGAAAAAG	144	17	yes
GATCTCCTCCTTGCTTTCCT	31	4	yes
GATCTCCTCCTTATTCCCCA	124	16	yes
GATCTCCTCAGAGAAGTCTG	57	14	yes
GATCTCCTCAACCAGTGTGT	6	1	yes
GATCTCCTATTTTGGTGTCA	56	28	yes
GATCGGGCCTGAAACCTTGG	26	24	yes
GATCTCCGTCCCTCAGCTCC	759	148	yes
GATCTCCGCGGCCCGAGTGC	21	3	yes
GATCGCAGAGAGGCGAGAGC	99	3	yes
GATCCCTGTCTCTGGCAGAT	5	5	yes
GATCTCCGCACTGTGTGTAC	180	22	yes
GATCTCCCTTTGTACTGTCT	4	3	yes
GATCTCCCTTTCCTGTAGAG	5	0	yes
GATCTCCCTTGGAATGTGTA	15	0	yes
GATCTCCCTGCCCCTGAGCC	26	24	yes
GATCTCCCTCTTGGAGGCCA	33	14	yes
GATCTCCCTCTGAACACCTG	12	11	yes
GATCTCCCTCTAAATATTTC	26	9	yes
GATCTCCCTCGTGCAGTGGC	78	8	yes
GATCTCCCGTGTTACCAATG	33	30	yes
GATCTCCCCTTTGTAGGACT	63	16	yes
GATCTCCCCTGGACCAAAGG	41	9	yes
GATCCACCGTACCTGAAGTC	1	1	yes
GATCTCCCAGGACGTTGAGA	16	2	yes
GATCAGAAAGTACCAGATTG	4	0	yes
GATCACTTTCAATTGAAGTC	9	2	yes
GATCCTTTCAACTCAAAAGC	23	6	yes
GATCCTTGGTTCATCAGGTA	4	5	yes
GATCTTATTGCCAAGTTCCT	10	11	yes
GATCTTATCTTGCCAGGCCG	47	11	yes
GATCTTAGGCAAGTTCTTGG	20	18	yes
GATCGCATACATCATGACTG	4	4	yes
GATCTTAGAGAAAGGCCAAC	280	92	yes
GATCTTAGACAGGCGATGTG	18	1	yes
GATCGCAGCACTGAAAACAA	15	6	yes
GATCTCCATGCTAGGTGTGT	13	2	yes
GATCTCCATCGTGCAGGGAT	135	8	yes
GATCTCCAGTCCAAGGCTTC	111	24	yes
GATCTCCAGTAACCTTTGTC	2	2	yes
GATCTCCAGGGACATCAGAA	35	4	yes
GATCTCCAGCTTCTCTGCCT	13	1	yes
GATCTCCAGCACAGCAGAGG	15	14	yes
GATCTCCAGAGTCGCTTGGA	30	15	yes
GATCTCCAGAGGAACACCAG	66	37	yes
GATCTCCAGACCGTTCCACT	13	3	yes
GATCTCCAGAATAGACCTGG	36	10	yes
GATCTCCAGAAATCTCCTGC	31	20	yes
GATCTCCACTTTCTACAACA	117	19	yes
GATCTCCACTCTCCCTCTGG	20	5	yes
GATCTCCACGGGTGCTTAGT	114	2	yes
GATCTCCACATCTCCAAGGA	22	5	yes
GATCTCCACAGGCCAGCCTT	56	4	yes
GATCTCCACACAACAGGTGA	209	1	yes
GATCTCCAATGTTGTGCTAA	15	14	yes
GATCTCCAACTTTGAAAGGC	29	26	yes
GATCTCCAAAGTCCTGGCCC	2	2	yes
GATCTCATTTCTAGTTTCCA	3	1	yes
GATCACAGCCAGTTCAAAGC	24	10	yes
GATCACAGCAGTAAATGTGA	127	5	yes
GATCACAGCAGCTGAGCTGT	165	7	yes
GATCACAGATTTAAGGGGAG	30	12	yes
GATCACAGATTGCTTCTCTG	15	6	yes
GATCACAGAGGGACACACTA	41	38	yes
GATCACAGACTTCGGCCTTG	1	1	yes
GATCACAGACTGTTGGCCCC	56	34	yes
GATCACAGACACCTGCACTG	140	44	yes
GATCACAGAAGTGAGCGGAT	60	17	yes
GATCCTTCTGCAGACACCGA	52	5	yes
GATCCTTCTGACTTGGCTTT	36	8	yes
GATCCTTCTCAGAAGAGTCT	63	22	yes
GATCACACTTCCCACAACCC	38	12	yes
GATCACAGGGAGCCTGTGTT	7	4	yes
GATCTTACCCGGGACAAAAT	16	7	yes
GATCACAGCAGAGATGGCCA	104	18	yes
GATCTCATTGTTCTTGGAGA	15	4	yes
GATCTCATTCTTTCATGGAT	14	5	yes
GATCTCATTCCGGATGAAGC	75	12	yes
GATCTCATTCCCGAGAGAGG	106	8	yes
GATCTCATGTGTGGGAACCA	41	4	yes
GATCTCATGTCTCTGGAGGA	44	5	yes
GATCTCATGGCATGCTCTGA	4	3	yes
GATCTCATCCTCTCACCTCC	8	3	yes
GATCTCATCCATTGAATTTG	36	8	yes
GATCTCATCCAGTCTGCTGT	20	7	yes
GATCTCATCAGACAGTAGAA	23	7	yes
GATCTCATCACAGGAGCATC	14	2	yes
GATCTCAGTTTTCATCAAGT	12	4	yes
GATCTCAGTTTCGCTGATGT	11	2	yes
GATCTCAGTTCTGTGTTTAC	71	9	yes
GATCTCAGTTCACGGGGTGG	145	132	yes
GATCTCAGTTCAACAGGCCC	17	16	yes
GATCTCAGTTCAACAGCTCC	78	71	yes
GATCTCAGTGTTGGGGGCAG	27	13	yes
GATCTCAGTGTGGAGAGCAT	7	7	yes
GATCTCAGTGGGGGTGGGAG	167	35	yes
GATCTCAGTGCTGGGGAGGT	160	6	yes
GATCACACTGATGGAGCTGT	28	8	yes
GATCACACTGAGCAACACCC	22	3	yes
GATCACACGGCAAAACAGTA	36	11	yes
GATCACACCTTGCTGTTCCC	10	2	yes
GATCACACCTGTCCCTACAC	1612	198	yes
GATCACACCTGCAGTTTGGG	40	5	yes
GATCACACCGTTTCTTCCTA	4	4	yes
GATCACACCGAGATTCTTTT	4	4	yes
GATCACACCGAGACCAGTGG	32	4	yes
GATCACACCCCTGGTCACCA	234	2	yes
GATCACACCATTGAGTTCCG	38	1	yes
GATCACACCAGTCCTGTGAG	109	14	yes
GATCACACCAAGCCCCAGGA	82	24	yes
GATCACACATTTGCAAGGGA	58	1	yes
GATCACACACTCAGTCCTTG	61	3	yes
GATCACACACGGCAACCGAC	182	12	yes
GATCACACAAGTGTGGGTTT	134	16	yes
GATCACACAAAACTGTCAGC	21	1	yes
GATCACAATCAGGAACTCAC	96	6	yes
GATCACAATACAACTTTATG	23	3	yes
GATCACAAGTTTGCATTCAG	24	2	yes
GATCACAAGTTTGAGACCAG	59	2	yes
GATCACAAGTTGTTTCCTGT	4	4	yes
GATCACAAGTTAAGGTCAGC	4	2	yes
GATCACAAGTGCAGCATTCT	17	2	yes
GATCACAAGGTTTACATCTG	6	1	yes
GATCCTTCATGTTGAGCCAG	167	32	yes
GATCACAAGGCTGAAAACAA	15	4	yes
GATCACAAGAGTTACTAGTT	16	2	yes
GATCTGTTGTTTGCGTTGAA	12	0	yes
GATCTGTTGGTGGTATAGGC	10	3	yes
GATCCTTGGAAGTGGTTCAG	18	7	yes
GATCTGCTCAATTATTTTTC	38	5	yes
GATCCTTGACTCTCAAGCCC	154	3	yes
GATCTGCGCGTGCTGTGTGG	13	1	yes
GATCCTTCTGTCGGCTTCCT	79	20	yes
GATCCTTCTGTCCTGGATTT	15	1	yes
GATCTGTTCAGCACACCTGA	72	6	yes
GATCTGTTACTTTGGCGAGG	648	7	yes
GATCTGTGTGTCATCAGATG	41	4	yes
GATCCTTCTCTGCCCTTCCC	4	1	yes
GATCTGTGTGGGACCAAGGC	63	1	yes
GATCTGTGTGGCTCCTCTGC	39	8	yes
GATCTGTGTGGATGTCCTGA	38	7	yes
GATCCTTCCTTTCCCTTGGC	257	34	yes
GATCCTTCCTTCTTCTCTTC	46	1	yes
GATCTCAGTAACTGTCGAGC	107	22	yes
GATCTCAGGTGTTTGGTCAT	5	5	yes
GATCTCAGGGTTCCCATGGT	4	3	yes
GATCTCAGGATTTGTTGGGG	49	45	yes
GATCTCAGCTTGCATAGCAT	374	48	yes
GATCTCAGCTGACTCCTTTT	20	7	yes
GATCTCAGCTCCACTGTGAA	32	6	yes
GATCTCAGCTATTCACAGAG	13	1	yes
GATCTCAGCTAAACTTTCAA	16	5	yes
GATCTCAGCGAAAGTGAAGA	18	0	yes
GATCTCAGCCCCTACTCCCA	67	62	yes
GATCTCAGCCATAGTCGTTG	105	25	yes
GATCTCAGCACTGTGGCTGT	258	31	yes
GATCTCAGCACCCTCATCCC	29	26	yes
GATCTCAGACAGCTCTGTGT	22	12	yes
GATCTCACTGTTTCATGCTG	33	5	yes
GATCTCACTGCCTCCCTCTC	373	2	yes
GATCTCACTCCAGGCTCATC	5	5	yes
GATCTCACTCAGCAACAAGT	22	5	yes
GATCTCACGGGCCGACCGAG	130	14	yes
GATCACAAGAGGCCCGTTTG	151	42	yes
GATCACAAGAGAGTTGCAAC	4	2	yes
GATCACAAGAAGTTAGTTTG	42	14	yes
GATCGGGGGGATGACCAGCT	193	42	yes
GATCACAACTTCTGAAACAC	17	11	yes
GATCACAACTGTAGGGAATA	153	27	yes
GATCACAACGGCTTGCGTGT	342	6	yes
GATCACAACCCTGATGGCAG	891	2	yes
GATCACAACCCCCAAGTCAG	267	8	yes
GATCACAACCCAGATGAAAT	3	3	yes
GATCACAAATACAGATTCTG	41	7	yes
GATCACAAAGTTTGAGAATG	743	55	yes
GATCACAAAGGTGGAATGTT	2	2	yes
GATCACAAACTTCTGCAAAA	5	4	yes
GATCACAAACATCACAGAAG	4	4	yes
GATCACAAAATGAGTCACTC	8	1	yes
GATCACAAAAGGCTGTTTTG	7	6	yes
GATCCTGTGCCTGGCCTTTG	89	14	yes
GATCAATGGGCAGCAGCAAT	55	15	yes
GATCAATGGCTTTGATGCAG	18	16	yes
GATCCTGTCCTGTGCCTTTT	1	1	yes
GATCACAAAAACTGAAGGTG	2	2	yes
GATCTGTGTCCCAGCGAAGC	338	33	yes
GATCTGTGTATACCCCACTC	65	16	yes
GATCTGTGGTCCCTGCCTCC	26	0	yes
GATCCTTACATCAACCTGGC	3	3	yes
GATCCCAGGTGGGAGGTTCC	1	1	yes
GATCTGTGGGGTGCCCAGAA	3	2	yes
GATCTGTGGGGAAGGGGGCT	42	17	yes
GATCTGTGGAGTTTTTCTCC	63	26	yes
GATCTGTGGACGACGAGAAC	197	75	yes
GATCCTGTGTGAGCAGATTG	35	6	yes
GATCCTGTGGCTAAGTAAGA	14	13	yes
GATCTGTGCGATGTTGTGGC	41	10	yes
GATCTGTGCCATCCCATACA	417	15	yes
GATCCTGTCTCCCGTGGACA	22	3	yes
GATCTCACCTTCAAGGTTCT	6	6	yes
GATCTCACCGTGAGGCCCCG	25	23	yes
GATCTCACCCCTGGGACATT	20	9	yes
GATCTCACACGAACTAGAAA	21	19	yes
GATCTCAACTGACTCCTCTT	448	53	yes
GATCTCAACAAGATGACCTT	17	0	yes
GATCTCAAACTCAGAGGTTT	30	6	yes
GATCTATTTTCTCACTTCTA	2	2	yes
GATCAATGCAGGCCATGAGG	16	15	yes
GATCAATGCAATGACGTGGG	205	28	yes
GATCAATGCAAAAATCACCG	31	28	yes
GATCAATGATGAGGACAAAC	1182	198	yes
GATCAATGAGGCCTTTGCAA	128	24	yes
GATCAAGTCCGGGAACTCTC	137	6	yes
GATCCTGGTAGGAGCACTTG	39	2	yes
GATCCTGGGTACTGCACAGT	1552	153	yes
GATCAATCCAGTTGGTTTTG	2	2	yes
GATCAATCCAGGAGTCTCTG	178	16	yes
GATCCTGGTGGGCACGGGGT	55	3	yes
GATCTGTGAGATGGGTGCCC	3	2	yes
GATCCTGGGGTTGGACCCCA	161	29	yes
GATCCTGGGAGTGGGCCCTG	26	1	yes
GATCCTGGGACATAATCACC	13	4	yes
GATCCTGGGAAGCCTCCTCA	60	12	yes
GATCTGTCTCAACAGTCTGG	29	5	yes
GATCAATATCACCCAAACCT	50	46	yes
GATCAATAGCTTGAGTCACT	3	2	yes
GATCAATACTCCTTTGGAAA	4	4	yes
GATCAATACCAGCAAAACAA	18	7	yes
GATCCTGCCCTTCCATCCTC	9	2	yes
GATCAATAAAGTGGGTTTTT	9	1	yes
GATCCTGCGGGTGGGAGGAA	111	13	yes
GATCAAGTTTGTGGTGTGTT	13	2	yes
GATCAAGTTTCAGGAAGGCT	149	12	yes
GATCAAGTTTCACATCCTTC	49	3	yes
GATCCTGCATATCTCAAAGA	56	12	yes
GATCCTGCAGCAGGAGTGCA	45	2	yes
GATCTGTCCTGATGAAGGCT	358	7	yes
GATCCTGCAAACTTCCCTGG	78	16	yes
GATCCTGATTTAGGAAGTGT	12	1	yes
GATCTGTCCATCTTGGAGTT	101	23	yes
GATCTGTCCAGGGTGCAACA	12	1	yes
GATCTGTCAGTGTTATGGAA	66	20	yes
GATCTGTCAGCTGTGCTCTC	34	18	yes
GATCTGTCAGCTCGCCAAGG	58	6	yes
GATCCTGCTCAGACCATACC	7	1	yes
GATCCTGCCAGCCAGACCAA	275	24	yes
GATCTGTAGGCGAGGGAATC	17	16	yes
GATCCTGCAGACACTCAGAG	30	10	yes
GATCTCGAGATAACTTGGAG	1	1	yes
GATCAAGTTGCCAGCATTTG	31	5	yes
GATCAAGTTGAAAGAGTGTG	38	35	yes
GATCAAGTTCAGTGCGCAGG	14	2	yes
GATCAAGTTACTGTGGAGAG	7	2	yes
GATCAAGTGTTTGCAGGACG	11	1	yes
GATCAAGTGTCGGATGGAAT	311	15	yes
GATCAAGTGTAAATGTGCTG	27	2	yes
GATCAAGTGGTCAAGGTACT	21	5	yes
GATCAAGTGGATTCGGCGGT	866	19	yes
GATCAAGTGCTTTGCCAAGT	34	4	yes
GATCAAGTGAGCTGTATCAG	25	4	yes
GATCAAGTGAGAGGACAGAG	23	2	yes
GATCAAGTCTTGTCAGTTTG	20	1	yes
GATCCTGAGTGGCTTGCTAG	17	8	yes
GATCAAGTCGTGCTTCTGGC	2828	136	yes
GATCAAGTCCTTTGTGAAAG	360	46	yes
GATCAAGTCCGAGGTCCCCC	41	14	yes
GATCCTGAGGGCTGCATACC	45	5	yes
GATCAAGTCATTTGCTAGTT	7	1	yes
GATCCTGAGGAGTCAAATAT	31	9	yes
GATCCTGAGGAAGGCCAGGC	12	3	yes
GATCCTTCACCAGCAGTTGC	15	2	yes
GATCAAGGTGTTGCCTGGTG	112	7	yes
GATCAAGGTCCTAAAATTTC	289	12	yes
GATCAAGGTCCAGGTGGAAG	11	1	yes
GATCTGTACCTGCGGCTCCA	131	9	yes
GATCCTGACACCATGCAAGC	1	1	yes
GATCTGGTTTTAAGTGCCTC	11	0	yes
GATCCTGAATGGGCAAGAGT	36	1	yes
GATCCTGCCCTGTTCCTGGC	2	2	yes
GATCCTGAAGCTCTGGCTGA	136	11	yes
GATCTGGTGGAACCTCCTCT	26	4	yes
GATCTGGTGCTGATAGGAAG	40	9	yes
GATCTGGTGATGTGTGAGAC	28	8	yes
GATCCTGACTCCTTGAAGCC	30	14	yes
GATCTGGTCACTGGTCAGAG	93	14	yes
GATCTGGTATGAACATCGGC	226	8	yes
GATCTGGGTTTGTCAACAGG	8	7	yes
GATCTGGGTTGTGAGGAGGT	89	11	yes
GATCAAGGTCCACTTAGTGG	34	8	yes
GATCAAATGGCTTGTTGTGA	11	5	yes
GATCAAGGTAGCGCATAAAG	6	6	yes
GATCAAGGGTTCCCTTCCAA	8	7	yes
GATCAAGGCTTTCCTCGGGC	9	3	yes
GATCAAGGCTCCCGGTTTTG	1388	134	yes
GATCAAGGCCTTTCTGTCCT	264	3	yes
GATCAAGGCCACTGTGTAAC	21	2	yes
GATCCTGAAAGACCGGGAAA	85	4	yes
GATCAAGGAGGTAGATATGG	479	61	yes
GATCAAGGAGGCTGTTGCTG	36	33	yes
GATCAAGGAGGAAGTGTTGT	31	28	yes
GATCAAGGAGAGAAGCAGGA	114	8	yes
GATCCTCTGGCAGATGTTTG	126	18	yes
GATCAAGCTTAGCAGTCAAG	67	4	yes
GATCAAGCGTCCACTCCTCA	4	3	yes
GATCAAGCGGGCTTTCCTTA	414	26	yes
GATCAAGCCTGTTAGCCCTG	18	3	yes
GATCCGTACCTGGAGCTCCA	1	1	yes
GATCTGGGTGGGACAGTCAC	50	11	yes
GATCCTGAAGAGACAGCCAA	11	3	yes
GATCCTGAACTCCCCAGAGA	13	12	yes
GATCCTCCTTCTGCCTTCCC	6	6	yes
GATCTGGGGCTTTTTGTGTG	94	0	yes
GATCCCTTTGGTGCCCCTGA	227	10	yes
GATCTGGGCTGAGCTTGGTT	14	1	yes
GATCTCGCAGGAGAGGAGAG	1	1	yes
GATCTGGGCACCGAGGCTGG	185	3	yes
GATCTGGGCACCCACTGCCT	10	9	yes
GATCCTCTGCCTTTACCTCC	27	1	yes
GATCTGGGATAAGGAGAGCG	27	7	yes
GATCGGCGATGTGATGTGCA	5	5	yes
GATCCCTGAAGAGGAAGAGG	2	2	yes
GATCAAGCCCTTCTTCCATT	966	40	yes
GATCAAGCCATCCATCAACT	1427	190	yes
GATCAAGCATCATGATGCTC	41	7	yes
GATCAAGCAGTTTCTGGAGT	47	8	yes
GATCAAGCAGTAGAGTTTTT	4	0	yes
GATCAAGCAGCGTCTCTTTG	28	2	yes
GATCAAGCAGCGAGAGGCTG	428	36	yes
GATCAAGCAGCAGCACGGGG	92	8	yes
GATCAAGCAGAACCTGGAGA	257	13	yes
GATCAAGCAAAATATCCCTA	1	1	yes
GATCAAGAGTTTATTGCATT	25	0	yes
GATCCTCCTCACTTAGCACC	110	17	yes
GATCAAGACTGTGACTTTTG	126	4	yes
GATCAAGACTCTCCTGGAGA	235	25	yes
GATCAAGACGCCTGTCATTT	96	8	yes
GATCAAGACCCTCCAGAGGT	34	5	yes
GATCAAGACCACCACTGCAT	36	1	yes
GATCAAGACAGCTTGTTGGT	9	0	yes
GATCCTCCCAAAAGCCATCT	9	8	yes
GATCAAGACAACCAAGGCTA	32	10	yes
GATCCTCCAGCTGGGATTCC	8	7	yes
GATCCTCCAGCTCCATCAGC	228	63	yes
GATCAAGAACTGTGGGCAGC	14	3	yes
GATCCCCCATCTCTATCTGC	10	11	yes
GATCCTCAGTGAGAGTGTGG	4	3	yes
GATCCTCAGGTTTGTGTTGC	5	6	yes
GATCCTCAGGACGAGTCACA	7	3	yes
GATCCTCACTGGCAGCAGCT	220	50	yes
GATCCTCACCCACCTGCTGG	470	49	yes
GATCTGGGACCTCTGGGGCC	17	16	yes
GATCTGGGACATAGCATCAC	97	40	yes
GATCTGGGAAGACTTCTCTA	161	43	yes
GATCTGGGAAAATGGCAGTT	48	16	yes
GATCTGGCTTTTGTTTTCCA	65	59	yes
GATCTGGCTTTACTTCTCTG	4	2	yes
GATCTGGCTGGTCCAGTACA	32	30	yes
GATCTGGCTGGACAGTGGAC	5	5	yes
GATCTGGCCTGAGCCTGTCC	24	22	yes
GATCTGGCCTCAGTTGGAGC	1	1	yes
GATCTGGCCGAATGGTAAAA	21	3	yes
GATCTGGCCCTTTTGTCCTT	184	1	yes
GATCAACTTTCAGCTGGGAA	8	7	yes
GATCAACTTGCTGGGACCTA	326	5	yes
GATCAACTGTGCAGACAACA	2699	177	yes
GATCAACTGCGACATCTAGG	88	6	yes
GATCAACTGAGGTCTTTCTT	3	3	yes
GATCAACTCTTTGTTTTGGC	16	3	yes
GATCAACTCTTGGCTTTGAC	41	16	yes
GATCAACTACCTGCAGGAAG	529	38	yes
GATCCGAGCCGCACGCTGTG	1	1	yes
GATCCTGTGCTGTCTTCTGG	4	1	yes
GATCAACGGAGGACTATCAT	11	10	yes
GATCTGGCCAGGGTGCCTTT	21	20	yes
GATCTGGCCAACACAAGAAC	42	2	yes
GATCCTGTACCCTGACTCCC	8	1	yes
GATCCTCCCTGTTCTCATCT	30	9	yes
GATCTGGCAGATGTGAGGTT	303	26	yes
GATCTGGCACTACTGCCGAG	44	5	yes
GATCTGGAGTAAGGGCTGTT	112	29	yes
GATCTGGAGGTGGAAGTGGT	35	18	yes
GATCTGGAGGCTGGGAGTCA	38	35	yes
GATCTCCTGGTAGCATGACC	12	4	yes
GATCTCCTGCAATCATCTCC	9	3	yes
GATCAACCTGAGAGGGAGAT	15	7	yes
GATCAACCTGAACTTGGGAC	29	11	yes
GATCAACCTCTTGCCAGCAG	7	7	yes
GATCAACCTCGTCGACTGGG	13	0	yes
GATCAACCTCCTGGGCTTCA	56	41	yes
GATCAACCGACAGCTGGAGG	333	61	yes
GATCAACCCACAGGAGTACC	42	17	yes
GATCCCAGCATCATCTTTGC	19	2	yes
GATCAACCACTGCAAATTCG	599	100	yes
GATCAACCACTGACCTGCCT	275	10	yes
GATCAACATGAACTGAGATT	7	6	yes
GATCAACAGTGAGGCAAGCA	65	10	yes
GATCAACAGCTGCCCTGCCT	897	211	yes
GATCAACAGCGTTGCCTTCC	66	60	yes
GATCAACACGAACACGTTTT	12	3	yes
GATCCCCAGAAACTGAGTGT	71	2	yes
GATCAAGCCTGGAGAGGTGG	7	6	yes
GATCAAGCCACTTACCTACT	14	1	yes
GATCTTGTGCCATCTTTGGT	5	5	yes
GATCAGCTCCAACTATGGTG	29	5	yes
GATCCTTTCAATGTACGCTC	5	5	yes
GATCGGCTCTTCCCACCTAC	13	12	yes
GATCTCCGAGATGACCCCAA	55	8	yes
GATCTCCCCGTCACAGAACC	10	9	yes
GATCTTGCTCATCACGTGAA	13	12	yes
GATCCAGGCTGAGGGATTGC	18	2	yes
GATCCAGGCTATCTCCTCTG	22	3	yes
GATCTTCTTTCACAGATTGC	2	2	yes
GATCAGTCCTTCCCTCGAGA	77	15	yes
GATCCAGGAGGCTCTGCACG	127	14	yes
GATCTTCTGCCTGATGCAGT	6	4	yes
GATCAGTTTCAAGAAGCGTG	41	18	yes
GATCCCAGCATTTCTCAATT	8	3	yes
GATCCCAGCATCGGCAAGCG	223	7	yes
GATCCCAGCAGCTGTTACCT	68	4	yes
GATCCCAGCACTGCAAAAGA	7	7	yes
GATCCCAGCACACACCGTGA	232	21	yes
GATCCCAGATGGACATGGCA	4	4	yes
GATCCCAGATGATACCCACT	38	3	yes
GATCCCAGAGGAAAGGGTTT	170	12	yes
GATCCCAGAGACAATCTCAT	100	19	yes
GATCCCAGAGAAGTGGGGCC	2	2	yes
GATCCCAGACGCCTCAAATG	13	0	yes
GATCCCAGAATGAACAGAAC	24	11	yes
GATCCCAGAAGCCGCACAGG	72	1	yes
GATCCCAGAAGCACACTGGC	55	8	yes
GATCCCAGAACCATTGCCTG	14	4	yes
GATCCCACTTCACCTGTTAT	7	7	yes
GATCCCACTGTTGATAAGGA	10	4	yes
GATCCCACTGCTCATTTGAC	52	9	yes
GATCCCACTAACCTGCAGTG	124	3	yes
GATCCCACGGTAGAACCTGA	162	16	yes
GATCCCACGAGCCAGAGAAC	351	40	yes
GATCCTAGCGGACCTCAACC	69	5	yes
GATCAGTAGACCATAGTGTG	5	4	yes
GATCTGCACTTCGGGAGGTC	2	2	yes
GATCTGTCTGTAGCGGTCAA	10	5	yes
GATCTGTCTCTTTCACGGAA	1	1	yes
GATCAGGTTGTGTGAGACTG	11	8	yes
GATCTGTCCAGGGGACATTA	31	3	yes
GATCCACAGCAGCAAGCGAG	1	1	yes
GATCTTCCAGAAAATGATTT	1	1	yes
GATCCAAGTCAGGGAGAAAG	76	3	yes
GATCCCACCTTCACCTCCCT	42	8	yes
GATCCCACCTGTCACCCCAT	4	1	yes
GATCCCACCTCACGTGTGAT	232	5	yes
GATCCCACCGTGTGAAACAG	1	1	yes
GATCCCACCGCAGCTACCAG	338	19	yes
GATCCCACCCCGAGCCTGGT	12	11	yes
GATCCCACCCCAGTAGGAAG	8	7	yes
GATCCCACCATTCTCCTTGG	326	63	yes
GATCCCACATTTCCCTTGCC	7	7	yes
GATCCCACAGTGTGACTGAT	208	18	yes
GATCCCACAGGCCGGTGGAG	54	1	yes
GATCCCACAGCCAGGCTCAC	47	8	yes
GATCCCACAGATGTAGTTTG	1	1	yes
GATCCCACACTTAAGACTTC	48	9	yes
GATCAGGTGGATGTGCAGGA	54	3	yes
GATCAGGTCCTAAACATGGC	31	9	yes
GATCCAGCAGCCGAGACTGA	43	9	yes
GATCAGGGGGCTCTGCCTGG	7	7	yes
GATCCCACACAGCAGACAGA	31	5	yes
GATCCCAATTGGTGGAAAGG	83	18	yes
GATCCCAATTCTGTCCCAAT	13	0	yes
GATCCCAATTCCCAGTATTA	22	7	yes
GATCCCAATTACAACCCACT	60	10	yes
GATCCCAATGGTCACACACC	75	5	yes
GATCCCAATGCTGCCCCATC	69	5	yes
GATCCCAATGATAGATTCAA	2	2	yes
GATCCCAATGAGCCCACCTA	17	6	yes
GATCCCAAGTTCAAAGCCAG	4	4	yes
GATCCCAAGTGCTGGGAAAG	103	25	yes
GATCCCAAGTCCAACACCCA	170	17	yes
GATCCCAAGGGTCAGCACTG	38	10	yes
GATCCCAAGCCTCACCGGCT	368	60	yes
GATCCCAAGCCAAGAAACAC	8	3	yes
GATCCCAAGAGGAAGGGTAT	16	5	yes
GATCCCAAGAAAGGATGGAA	30	8	yes
GATCCCAAGAAACTACTTGA	140	9	yes
GATCCCAACTGTCAGTGCCA	71	14	yes
GATCCCAACTGTAACAGCAA	5	0	yes
GATCCCAACTCTGCAAGAGC	3	1	yes
GATCCCAACGTGACCATCAT	27	1	yes
GATCCCAACATTTGAGAGGC	6	3	yes
GATCCCAACATTGTTGGCAA	7	0	yes
GATCCCAACACAGCGATATG	556	42	yes
GATCCCAAATTGGGTTGTCA	10	5	yes
GATCCCAAATTGGGGAAAGT	3	2	yes
GATCCCAAATCTGTGGTGTG	119	1	yes
GATCCCAAATACTCAGTGCT	9	4	yes
GATCCCAAAGGCTCCAGGGT	1	1	yes
GATCCCAAAGCACAATGGTG	8	5	yes
GATCCAGATGTTTGTGGCTG	4	1	yes
GATCAGGGGCCAAGGTCCTT	52	8	yes
GATCAGGGGATGGACTTCAC	22	20	yes
GATCTCATCCAAGCAAATGG	66	11	yes
GATCAGGGCTCCAGTGGTCC	17	6	yes
GATCAGGGCCTGGACTCTGG	81	23	yes
GATCAAAGATTGAGCACTAG	3	2	yes
GATCAGGGAAGACTTAGGGT	10	9	yes
GATCCCAAACTGTATCCTTG	2	2	yes
GATCCCAAACTGCTTTCTCA	9	4	yes
GATCCCAAACTGAGGCAGCA	180	32	yes
GATCCCAAACTACTTAATAG	5	0	yes
GATCCACGTGCCTTTGTCTC	30	4	yes
GATCCCAAACAACTAAGAAT	133	3	yes
GATCCCAAAATGCTGCGGAG	96	10	yes
GATCCCAAAATAGGTGTTGA	4	0	yes
GATCCCAAAAGGGACATTGT	49	6	yes
GATCCCAAAAACCGTGCAGC	38	9	yes
GATCCCAAAAAATCTGTGCC	333	11	yes
GATCCATTTGCTTACACTGT	20	4	yes
GATCCATTTGATGCTTCCAG	10	0	yes
GATCCATTTCTTCTGCATGA	34	7	yes
GATCCATTGTGTGGTTTAAC	3	1	yes
GATCCATTGGTTTCTCAGTC	155	24	yes
GATCCATCTTTTTCTTTGGA	89	19	yes
GATCCATCTTCAGCTGACTG	180	40	yes
GATCCATCTTCAAACCTCAA	2	2	yes
GATCCATCTCTTTCCTTCTG	73	12	yes
GATCCATCTCCTCTGGCTCT	55	6	yes
GATCCATCTCCAGCACATGC	11	12	yes
GATCCCAGAGATGTGCCAGG	14	3	yes
GATCTGGTGTGTCTGAAGAC	14	3	yes
GATCTGGTCCCCTGTTCTCC	4	2	yes
GATCTGGGTTGGATGGGGCT	9	8	yes
GATCTGGGTGGCCAGTACTT	167	154	yes
GATCTGGGTAGGGGACCAGG	48	44	yes
GATCCAGAATGTCAGCTGGA	70	28	yes
GATCCAGAATCCAACTGAAT	3	3	yes
GATCAGGCCTTCCCCCTAGG	17	16	yes
GATCCAGAAGGGTCTCTCTC	54	3	yes
GATCAGGCCGGGGCGGCAGG	295	67	yes
GATCCAGAAGCACTTCCCTT	14	1	yes
GATCAGGCCCTAAAGCATTG	41	5	yes
GATCCATCGACTGTGATAGG	89	3	yes
GATCCATCCTTACTTGGTTT	28	10	yes
GATCCATCCTGTAACCCTTC	20	0	yes
GATCCATCCTATCCATCCGT	19	8	yes
GATCCATCCCCGGCAAAGAG	340	11	yes
GATCCATCCCAGAGGGACTG	47	0	yes
GATCCATCCAGCAAAGAGGA	145	7	yes
GATCCATCCACCAGCAGGAG	13	1	yes
GATCCATCCAATGGCTTACC	108	11	yes
GATCCATCATAAGAAAGCTC	5	4	yes
GATCCATCAGGGCTGAGCCT	46	15	yes
GATCCATCACAGGACTATGT	9	2	yes
GATCCATCACAAGGCAAAAC	15	10	yes
GATCCATCAAGTGGGTAAGT	15	4	yes
GATCCATAGCACAAAGCCAC	26	1	yes
GATCAGGCACACGAATGTGT	8	3	yes
GATCCACTGTGAGGGGGAGC	5	1	yes
GATCAGGAGCTGCTCATGTA	51	2	yes
GATCAGGAGCAGGCAACACC	220	33	yes
GATCCACTCCCTGTTCCCTT	14	3	yes
GATCTCCAGCCTGGATACGA	5	0	yes
GATCCATACTCCCCAGTATG	35	3	yes
GATCCATACCCACCACTGTG	13	4	yes
GATCCATACAGCATTTTGCG	8	2	yes
GATCCATACAATTTGTGCCA	244	10	yes
GATCCATAAGTTTGCCCAGT	43	5	yes
GATCCAGTTTTGGGAAAGGA	141	4	yes
GATCCAGTTTCTGACTCGGG	38	11	yes
GATCCAGTTGTTTGAAGATT	17	8	yes
GATCCAGTTGTGCAGTAGAG	4	4	yes
GATCCAGTTGTCAAGACAAA	25	4	yes
GATCCAGTTCTGCTCAACTA	64	2	yes
GATCCAGTTCTACGAGCGGC	87	6	yes
GATCCAGTTCTAAAACTTGT	156	9	yes
GATCCAGTTACCAGAAGATG	241	18	yes
GATCCAGTGTGTTGCTGGCA	159	32	yes
GATCCAGTGGCAGCCTCAGC	166	53	yes
GATCCAGTGCTGGGGAGATG	24	1	yes
GATCCAGTGCCTCATTGTTG	102	9	yes
GATCAGGACTACCTTATGGC	6	6	yes
GATCAGGAACCCCCTCCAGA	5	5	yes
GATCCACCCGAGGTTCTGGA	9	4	yes
GATCGCCTCGGAGATTGCCC	2	2	yes
GATCCAGTGAGAGCCAGACA	118	23	yes
GATCCAGTGACGTCAGACGC	62	68	yes
GATCCAGTCTGTCCTAGATG	2	2	yes
GATCCAGTCCTGGAGGACAG	620	72	yes
GATCCAGTCCATTCAGCAGT	164	15	yes
GATCCAGTCAGGACATATGA	12	11	yes
GATCCAGTCAGCCCCTGGGG	327	77	yes
GATCCAGTCACAGAAGAACC	6	6	yes
GATCCAGTATCTGAAAGACC	92	6	yes
GATCCAGTACTTGGTTTGTG	4	3	yes
GATCCAGTACTACCAGAATG	6	6	yes
GATCCAGGTTCAGTAAATTA	11	3	yes
GATCCAGGTTCACCACCGGG	20	4	yes
GATCCAGGTTCAATTTCCAG	12	2	yes
GATCCAGGTGTGCTGAGTGG	168	36	yes
GATCCAGGTCCGTGAACCCC	114	7	yes
GATCCAGGGTGTGCAGTGGG	616	23	yes
GATCCAGGGTGCCCCTCCAA	31	4	yes
GATCCAGGGTCCTCTGCCTG	110	7	yes
GATCCAGGGGGGACACCTGC	30	2	yes
GATCCAGGGCTCAGGAGCAC	45	8	yes
GATCCAGGGCGATGTTGGGG	60	1	yes
GATCAAAGTATGACCACTAG	41	11	yes
GATCCAGGGCCTGTGAATCA	66	3	yes
GATCCAGGGCCTGGTGGAGG	258	17	yes
GATCCAGGGCCTCTGCGCCT	21	19	yes
GATCCAGGGCCACTTTGTCT	22	6	yes
GATCAGCGGCCGAATGTCCC	119	13	yes
GATCAGCGCAGGCCCCAGCC	25	23	yes
GATCTGGCACTGCTTTAGCC	57	1	yes
GATCCACCAGGCTGTGACCA	5	5	yes
GATCCACCAGGATTGAAGGA	14	5	yes
GATCAGCCTGTCCTATTCCC	2	2	yes
GATCCACCACAGCAGGCAGG	13	3	yes
GATCAGCCTCTTCCTTTTGT	26	2	yes
GATCAGCCTCAGTCTTCAGG	7	1	yes
GATCAGCCGGGGCTTTGAGG	170	9	yes
GATCAGCGTGACCACCCCCT	23	21	yes
GATCTTTGCAGTGTAATTCT	23	11	yes
GATCCAGGGAATCAAGGAAT	3	1	yes
GATCCAGGGAAGCCTGTGCT	6	6	yes
GATCCAGGCTCTGATGTTTC	22	1	yes
GATCCAGGCTCTCTATGGCA	21	4	yes
GATCCAGGCTCGGGAGCTAA	11	3	yes
GATCCAGGCTCACAGTGTGA	64	11	yes
GATCCAGGCTAAAATCCCCG	75	13	yes
GATCCAGGCGGCCCTGCCAG	82	18	yes
GATCCAGGCGGCCAAGAACT	244	26	yes
GATCCAGGCGGAGGATGACG	5	0	yes
GATCCAGGCCTCCCTTCTTG	112	3	yes
GATCCAGGCCTACTTCGCGT	63	15	yes
GATCCAGGCAGCTGTGTACA	86	6	yes
GATCCAGGCAGAGCTCTTCA	22	1	yes
GATCCAGGCACGTGATTCTC	5	0	yes
GATCCAGGAGTTCAAAGAGG	627	115	yes
GATCCAGGAGGGGTTTGCTC	28	9	yes
GATCCAGGAGCAGGAGCTGC	4	3	yes
GATCCAGGACTTCTTCATCC	7	3	yes
GATCCAGGACCTGGAAGTAT	14	4	yes
GATCCAGGACCATCCTCTCA	1	1	yes
GATCCAGGAACTACTCCACA	15	9	yes
GATCCAGGAAAGCAGCCTGT	302	13	yes
GATCCAGCTGGGCGAGGATG	126	19	yes
GATCCAGCTGGGCAAAATTC	62	0	yes
GATCCAGCTCCTAAACTGTT	27	30	yes
GATCCAGCTCAGGCGGTGTC	24	3	yes
GATCCAGCGCTCTCGGGACT	14	3	yes
GATCCAGCGAGAAAGAAGAA	130	23	yes
GATCCACAGCCACAGAAGAG	39	13	yes
GATCCACAAGGTGGCAGTGT	38	3	yes
GATCAGCAGTCCGCGAGCTT	42	10	yes
GATCCACAACTTGCTTCGCC	5	3	yes
GATCCTGTGTCCCCTGGGCG	1	1	yes
GATCCAGCCTGAGCTCAGTG	6	6	yes
GATCCAGCCTGACCTGCACA	156	0	yes
GATCCAGCCCCTTTGTCACC	10	0	yes
GATCCAGCCCATACAGAAGA	27	25	yes
GATCCAGCCATTTGTGGGTG	4	1	yes
GATCCAGCCAGTCTTCAAAG	2	2	yes
GATCCAGCCAGTCTCTCATT	3	2	yes
GATCCAGCATTTAAATTTCT	2	2	yes
GATCCAGCAGTTAAAGCAGT	59	7	yes
GATCCAGCAGAGAGGGCAGG	62	17	yes
GATCCAGCAGAGACTCCACA	3	2	yes
GATCCAGCACCGTGTGTACC	21	5	yes
GATCCAGCAAACTTGGTTGG	76	12	yes
GATCCAGCAAAAGTATCTGA	3	2	yes
GATCCAGATGCCGGCTTTCA	12	11	yes
GATCCAGATGATGGTTCTTT	26	10	yes
GATCCAGATACAACGCTCAC	12	0	yes
GATCCAGAGTGGCACAGGGT	245	25	yes
GATCCAGAGTGGAACTGTCC	21	2	yes
GATCCAGAGTGACGTGCTCA	4	1	yes
GATCCAGAGGTGCTGGGCAT	33	1	yes
GATCCAGAGCTTCTGCAAGG	53	11	yes
GATCCAATTCGAGAAGTCAA	11	2	yes
GATCAGCAGATGCAAAAGAT	22	3	yes
GATCAGCAGAACATGGACAC	35	16	yes
GATCCAATGCTGACCTGGCT	18	9	yes
GATCCAATCCTCCTGCCTTC	9	6	yes
GATCAGCAACTCCTGCTTCA	67	9	yes
GATCCAAGTTTATCCCACAG	52	11	yes
GATCTCGCCTCCATCATGAA	14	12	yes
GATCCAGAGCTGGGCTCAGG	9	3	yes
GATCCAGAGCGTGTTAACAG	11	4	yes
GATCCAGAGAGATGGGTCAG	7	8	yes
GATCCAGAGAGACTTGGTTG	39	22	yes
GATCCAGAGAACTCAGCTGT	22	1	yes
GATCCAGAGAAAGCAAAGGC	66	1	yes
GATCAAGAGCCCACACCTAG	26	24	yes
GATCCAGACTTGCCTTATAA	74	4	yes
GATCCAGACGCCAAGGCTGC	5	2	yes
GATCCAGACGAATCTTGTCA	19	1	yes
GATCCAGACCTGCCACAGAC	8	7	yes
GATCCAGACCCGGGAAGGGA	361	47	yes
GATCCAGACAGAATGTCAAG	3	2	yes
GATCCAGAATTTGCTTTTCT	7	5	yes
GATCCAGAATTGCTTTCCCA	108	27	yes
GATCCAGAAGTTGGGAAAAC	29	8	yes
GATCCAGAAGCAGTGGAATC	463	26	yes
GATCCAGAAGAACCTACCAC	41	2	yes
GATCCAGAACCTCTCAGCCA	43	7	yes
GATCCAGAACAGTACAGCGT	206	11	yes
GATCCAGAACAGCGACGATG	3	3	yes
GATCCAGAACACATTAACCT	119	3	yes
GATCCAGAAAGAACGATTTG	31	5	yes
GATCCACTTGGGCTCTGTCA	43	9	yes
GATCAAGGCTGCCCAATACC	14	4	yes
GATCCTCAGAGTCAAGGACC	2	2	yes
GATCTTGTGTTTTGCTATCC	17	6	yes
GATCTTGTGTTCTTTGTGCC	4	3	yes
GATCCTCTTTGGTGTTTTGG	19	1	yes
GATCGCTGGTCTTGAACGTG	3	2	yes
GATCCCCCCCTTACCGGAAC	20	18	yes
GATCAAGTTTGCCGTCCATG	106	4	yes
GATCATGAGTTCAAGGGCGT	3	2	yes
GATCGCCTTAACTACTGTAA	5	5	yes
GATCTTGAACAATGAGGTTT	9	4	yes
GATCCTGTGCGCACAAACTT	3	3	yes
GATCTGTTCATCGCCACCTA	4	4	yes
GATCTTAACCACCAGCTCCT	1	1	yes
GATCTTGCTGTTGTGGATGT	19	2	yes
GATCAACACTACGGTGCCAG	35	11	yes
GATCAACAAGCAGACCCCAA	20	18	yes
GATCAAATTCCCACTGCCCG	3	3	yes
GATCCCCAGGGCCGGGCCAG	1	1	yes
GATCTTGACCTTCTCTTTGG	45	13	yes
GATCACCTTCAAGGTCAACA	42	14	yes
GATCCGTGCTTCCTGCACCC	3	3	yes
GATCCACTGGTGGGAGAACG	8	7	yes
GATCCCAACTCATGATGCGC	17	2	yes
GATCTGAGCAGAGGGAAAAG	2	2	yes
GATCAGTTGGACTAAGGATG	3	3	yes
GATCGACTTGGATTACAGAA	18	4	yes
GATCCTCACATGGAAAGTAC	3	3	yes
GATCCTCAACGAGGATGGCA	246	26	yes
GATCCTATGTTGCTGGAGCT	108	11	yes
GATCCTAGTGGGTCTACCAG	415	6	yes
GATCCTAGTGCTGCTCTGGC	64	4	yes
GATCCTAGGTGTCTTCTGTT	10	1	yes
GATCTGAATGTGCCGTCTCT	91	7	yes
GATCCTGCACAGCCAAGAGT	4	2	yes
GATCGTGCCCAATAAATTTT	6	3	yes
GATCCTACCGCCTTTAACAA	112	1	yes
GATCCTACAGAAGGCCCACT	180	44	yes
GATCTGGAGGCCGCTGTGAG	30	27	yes
GATCTGGCGCACGGAGAGAA	10	1	yes
GATCTGGAGGCACCAAGACA	19	17	yes
GATCCTCAACCAAGTGGAGC	23	2	yes
GATCCTAACTAGCAAGGGTT	7	4	yes
GATCTGGAGCTCCTGGGATG	14	13	yes
GATCTGGAGCCTCCACGATG	79	12	yes
GATCTGGAGCCCACAGACCA	38	35	yes
GATCTGGAGAGTGAGCTGTG	2	2	yes
GATCTGGAGAAGCGACGTAT	41	19	yes
GATCTGGACTTGTTTTCTGG	9	1	yes
GATCTGGACTTCTGAATCTG	41	6	yes
GATCTGGACCTCACCTCTGA	215	129	yes
GATCCACTTGTGCATGTAGT	5	5	yes
GATCTGGACAGAATCCAGGC	6	6	yes
GATCTGGAAGTTGGCAGATG	234	32	yes
GATCTAAAACTCACTCCATG	5	4	yes
GATCAACAATTGCTTTGGGA	11	10	yes
GATCAACAAGCCTCCAGATG	6	1	yes
GATCAACAACTTCTGACCTG	11	10	yes
GATCAACAAATCTCCTAGGC	8347	2691	yes
GATCGGGCCTGAACACTTTA	4	3	yes
GATCAACAAAACTGTACCTG	45	9	yes
GATCCTAAAGTACCCGCTAG	5	5	yes
GATCAAATTGGTCTTCACCT	18	9	yes
GATCAAATGTGCCATAGCAC	40	3	yes
GATCCGTGTCCCTGCGTGCA	365	55	yes
GATCAAATGCCAGTCCGTTA	1	1	yes
GATCCGTGGGCCTGGCCTCC	187	23	yes
GATCAAATGAGAACACTGCT	35	32	yes
GATCTGGAAGAGACTTTGGC	142	14	yes
GATCTGGAACCTGGTGTGCG	220	202	yes
GATCTGGAACAGTTTTTGGC	30	6	yes
GATCTGGAAAGCTCTGGGGA	75	30	yes
GATCTGGAAACACTGTAGCA	12	11	yes
GATCCGGGTGTTGTGCCTAA	11	5	yes
GATCCGGGTAGTTGAGTATA	21	19	yes
GATCTGGAAAACGCTGGAGA	54	20	yes
GATCTGCTTGCTTTTCAGTT	5	5	yes
GATCTGCTTGCCAGGCCACT	6	6	yes
GATCAAGAATTTGGTGTGGA	96	4	yes
GATCTGCTTCGCCGGGACGT	27	3	yes
GATCTGCTTCCAGGTCCTCA	164	9	yes
GATCCAGTCTCAGTTACCTC	2	2	yes
GATCTGCTGTCCAGAGCAAG	705	75	yes
GATCTGCTGTAGTCATTCTT	7	4	yes
GATCTGCTGGAGGGACTTCA	237	132	yes
GATCTGCTGCTGGTGCTTGC	35	1	yes
GATCAAATCACTGGCAGACA	95	12	yes
GATCAAATCAAGACCAATCC	6	6	yes
GATCAAATCAAAGACCTACG	22	21	yes
GATCAAAGTTGTTTCACTGT	13	4	yes
GATCAAAGTGCCAACAGCGG	1	1	yes
GATCAAAGTGAGGGAAGCGG	16	1	yes
GATCGCTCGGCTCCACGTGG	1	1	yes
GATCAAAGTCTCCATAGTTG	377	58	yes
GATCAAAGTCATTGCGGTTA	117	23	yes
GATCCGGGCAGCCCAGGAAA	440	23	yes
GATCAAAGTACTTGTTAGGG	3	2	yes
GATCAAAGGGGGCAAAGTCT	21	24	yes
GATCAAAGGGGCCATTTCTC	14	13	yes
GATCAAAGGCTTCAATCACA	39	5	yes
GATCAAAGGCCTGCATCACT	6	0	yes
GATCCGGCCCTACTGTGTGT	173	2	yes
GATCAAAGGAAAGGGGAGGG	574	121	yes
GATCAAAGCTGGCAAGGTAC	566	1	yes
GATCAAAGCCCGGAAAGGCA	2016	236	yes
GATCAAAGCCACGGGGTCAG	114	26	yes
GATCAAAGCCAAGTATCCTG	42	5	yes
GATCAAAGCACGCCTGCATG	10	3	yes
GATCCGCTGTACTCTCCTCC	107	2	yes
GATCCGCGCTGAGGAGCAGC	30	6	yes
GATCTGCTGCAGGACCTGGG	19	3	yes
GATCTGCTGACAAGACTTGA	10	9	yes
GATCCGCGAATGCTCGGAGG	736	26	yes
GATCTGCTGAAGGAGAAAGC	97	23	yes
GATCTGCTCTTCAATGTTGT	13	3	yes
GATCTGCTCTCTGGCCTCCC	8	7	yes
GATCTGCTCTCGGGCCTCGC	122	10	yes
GATCCGCAGTGGCATGTTCT	362	9	yes
GATCCGCAGCGCCTCTTCTT	257	59	yes
GATCCCTGTCTAAGCTAGAT	18	17	yes
GATCTGCGGAACAGCTTTTC	9	8	yes
GATCCGTTGCTGACCTTGCG	94	18	yes
GATCCCAGCCCACAGGATGT	5	5	yes
GATCAAAGAGTTCAGCAAGA	56	10	yes
GATCAAAGAGGCTGCTGTCT	43	16	yes
GATCAAAGACTTGGAGCCTG	15	4	yes
GATCAAACTTGGCAGTGGTG	17	2	yes
GATCAAACTGAGTCTGAAGG	326	32	yes
GATCAAACTAATCAGGCATC	34	11	yes
GATCCGATGCAATGCTGTCA	4	3	yes
GATCAAACGAGTTGTGTGTC	3	3	yes
GATCAAACCAGCCTGTTTTT	11	6	yes
GATCAAACAGTAAAGGTGTG	22	7	yes
GATCAAACAGCAGCCAAGTG	3	3	yes
GATCCGAGAAAGAGAGAGGC	6	5	yes
GATCCGAATGGGTCGACTGA	11	10	yes
GATCAAAATGTTTGTTGCTT	4	4	yes
GATCAAAATGTGGTGCCAGA	51	4	yes
GATCCCTTGGCATAGGGCCC	357	223	yes
GATCCGTGGTATCAGTGGGA	10	0	yes
GATCAACTCAGATTTGGCTC	8	7	yes
GATCTGCCTGAAACCAGGGG	87	6	yes
GATCTGCCTCAGTCCACAAG	360	50	yes
GATCCGTCACAGAGAGCAGG	29	11	yes
GATCTGCCGTGCCCACCAAT	17	16	yes
GATCCAGCCGTCCATCTCGC	13	1	yes
GATCTCTGGTAATGGTGCTA	2	2	yes
GATCTGCCGAAGCGGGCTTG	52	5	yes
GATCTGCCCTGTATTGTTAA	19	4	yes
GATCTGCCCCTGACCCTCCA	91	17	yes
GATCAAAATGCTTGGAGAAA	42	3	yes
GATCAAAATGAGGCAGAGGA	294	28	yes
GATCAAAATCGCAGTTACTG	35	1	yes
GATCGCAGCTTCTTTCTGTA	4	1	yes
GATCAAAATATGCTGCAGAC	29	26	yes
GATCGATGTCAGCTGGGTAC	2	2	yes
GATCAAAAGTGCCCAAGAAA	16	15	yes
GATCAAAACTCAAGAAAAGG	12	6	yes
GATCCCTGGTGCTCAGGCAG	35	7	yes
GATCCCTGGTCCTTAGGTGG	20	3	yes
GATCAAAACCTTCTCTGAGG	4	1	yes
GATCAAAACCTGTGACGGAG	78	25	yes
GATCAAAACCCGAAATAGAG	14	6	yes
GATCAAAACACGATGTCCAA	4	4	yes
GATCCGGGGCCTCTGGAAAG	30	0	yes
GATCCGGGCGTCGGCAGAGC	7	7	yes
GATCTGCCAGGAACATGAGA	143	27	yes
GATCTGCCAGCCGTACATCC	103	1	yes
GATCCCTGATTGCCTCCATG	1145	171	yes
GATCCCTGATGCAAAAGAGA	135	7	yes
GATCGCTCTTTTGGAGGAGG	9	2	yes
GATCCGGCTCCAGATTCAGG	25	5	yes
GATCTGCAGTTGCTCCAGCA	18	17	yes
GATCCCAGGCAAAACCACAC	4	0	yes
GATCTGCAGTTGAACTTTTT	12	1	yes
GATCTGCAGTTCCTGGAAGG	13	11	yes
GATCTAGAACTTGACTAGGT	4	4	yes
GATCTGCAGGTGCCTGGGAA	279	19	yes
GATCAACTTGACACAACTTT	20	22	yes
GATCATAGCCAAAGAATTTG	26	6	yes
GATCCCTCTGCAAACCAAAC	187	10	yes
GATCCCTCTCCCAGCTCTTC	340	21	yes
GATCTGCAGGAGGATGTTGA	3	3	yes
GATCTGCAGGAGGATGGTAA	84	5	yes
GATCTGCAGGAGGATGCCTG	999	34	yes
GATCCGCTTCCTGCACGACC	4	4	yes
GATCTTTGCCCTTCTGTGAA	9	4	yes
GATCTGCAGCAACAGCAACT	23	11	yes
GATCTGCACTCGGTACCCTC	15	0	yes
GATCCGCGCCTGTGGGGAGC	7	6	yes
GATCTGCACAGAGATGCTTC	13	11	yes
GATCTGCACAACTGTGGCCC	21	23	yes
GATCCGCCGCAACTCCACAG	25	17	yes
GATCCCAATACCGCAGAGCA	67	6	yes
GATCACTACTGGCACTTTTT	39	2	yes
GATCACCACTCAGGTGACTA	173	24	yes
GATCCCTCAGTGTAGCATAG	19	8	yes
GATCCCTCAGTCTTTATGAG	1	1	yes
GATCCCTCAGCTTTCTCCAA	226	34	yes
GATCCCTATTAAAGGCCTGC	4	4	yes
GATCTGCAAACGGGAAGGAG	11	2	yes
GATCTGATTTTGACCAAGAT	66	2	yes
GATCCCGTCAACTTCAAGCT	3170	336	yes
GATCTGATTTTCCCCCTGTT	9	3	yes
GATCCCGGGGGCTCCAGGAA	137	11	yes
GATCCGCAGACGTCACTCTG	97	21	yes
GATCCCGGGGCAGTCCAGCC	79	4	yes
GATCCCGGGGACGGGCCCCA	16	1	yes
GATCTGATTGCCACTTTGCT	6	5	yes
GATCTGATTGCACACTCTGT	10	9	yes
GATCCGAGTTGGGGAGCCTG	5	1	yes
GATCAAATTCCCACTGCCCC	1319	18	yes
GATCTGATTCCCGCAGGTTC	64	8	yes
GATCGCAAGCAGAGTGGCTA	6	5	yes
GATCCGAGGGCAGAGGAAAG	4	3	yes
GATCCCCAGGGTTACTAAGA	13	11	yes
GATCCTTTGGACCGGGGCTT	21	23	yes
GATCCCGGGCAATGCTTTCA	25	2	yes
GATCTGTGAGTTCGAGGACA	33	6	yes
GATCTTCTGTTCCCGCTGCT	4	1	yes
GATCCCCTTGGGATTAAAGG	117	10	yes
GATCCTTGGATGAGAAGCTC	25	0	yes
GATCCGACTCTCGCAGCCCT	1	1	yes
GATCTGATACTCTCTTCTGG	7	6	yes
GATCCCAGCACGTGGGAGGC	26	10	yes
GATCTGAGTTCCCGAAGCAA	65	6	yes
GATCCCTTTCCTTTAGCAGT	4	2	yes
GATCTGAGTCCCCTGCTGGG	21	19	yes
GATCTCACTGTTGCCTTTGG	8	7	yes
GATCTGTCCTTTGTGTGCAG	110	11	yes
GATCATCAGCCTGACAGAGA	2	2	yes
GATCCCCTGAGAAGCTGTAT	28	4	yes
GATCCCCTCCCCCAGCTAAA	132	41	yes
GATCCCCTAAAACGAGTTGC	4	2	yes
GATCCCCGGCGTCTGTTTGA	2106	279	yes
GATCCCCCAGCCAGGCCAAA	59	7	yes
GATCCCCATTGGAGCAAAGC	27	14	yes
GATCTGAGGAAGACATTTTG	7	6	yes
GATCTGAGCCCTGTGCCTTC	11	10	yes
GATCTGAGCCCCCTGAGGTT	145	11	yes
GATCTGAGCACGTCCCGCTG	5	5	yes
GATCCCTGGAGCCACCAGCT	18	7	yes
GATCTGAGATGAGCAGTGAC	2	2	yes
GATCCCTGCTTTCATGGAAG	99	9	yes
GATCCTAACCGTGTTACAGA	9	3	yes
GATCTGAGAAACGGGGAAGC	41	1	yes
GATCTGACTGCCTGCACAGG	8	7	yes
GATCTGACTCCACTGCCCAG	106	1	yes
GATCCAGCCCATATGGTTAC	7	7	yes
GATCTGACGCCGAGGAGGTA	361	12	yes
GATCTGACCTTTCCCAAGAT	16	8	yes
GATCTGACCTGGGTCCTGAC	175	31	yes
GATCCCTCAACCCACACATT	32	10	yes
GATCTGACCGGCTGCTGTAC	39	13	yes
GATCTGACCCTAGATTTCTC	2	2	yes
GATCCCTATGGACACTGACA	261	47	yes
GATCCCTAGTGACTCGTTTA	44	10	yes
GATCATAAGGAGGCAGGGGC	8	3	yes
GATCAGAGGAAGACAAGGAG	1	1	yes
GATCTGGTACCGGCCCAGGG	3	2	yes
GATCCGCGCTGACAAGCACA	25	1	yes
GATCAGCACCTGCATCCTGC	19	3	yes
GATCTATTTTTGCACTGGAA	27	10	yes
GATCAGACTTTTAGCTGCTA	53	15	yes
GATCCAGATGGGCTCTGTGG	33	4	yes
GATCTGCGGATGCCCGTACT	1	1	yes
GATCATTTCCTAGGACTGGA	2	2	yes
GATCCAAGAGGACATGGACT	3	1	yes
GATCTAGACTCACATAAGTT	3	2	yes
GATCTGCTCAAGACCTCCTC	3	2	yes
GATCCACTTGAAACCGGGAG	26	24	yes
GATCCACTTCAGAAGCAGCC	49	6	yes
GATCCACTGTTGTCCAGAGG	132	5	yes
GATCCACTGTCTTCCTAGAG	96	12	yes
GATCCACTGGGCCAAGGAGC	45	7	yes
GATCCACTGGCTGGATATAG	80	9	yes
GATCCACTGGAAGCAGCACG	3	1	yes
GATCCACTGCTGGAAGTACC	728	45	yes
GATCCACTCTTTTCATACCC	50	3	yes
GATCCACTCGGGGGCTGTGA	46	11	yes
GATCCACTCCTGCAGAGCAC	68	4	yes
GATCCACTCCAGGCTGCGAG	266	25	yes
GATCCACTCAGACGAACAGT	41	14	yes
GATCCACTACTGTCTCCTGT	4	4	yes
GATCCACTACCAATCTCGTA	7	2	yes
GATCCACTAATGCAGCTGGT	68	19	yes
GATCCACGTCTCGTCGTCAG	148	4	yes
GATCCACGGGGCACCCGCAC	16	1	yes
GATCCACGGGCTGGAATCTG	15	1	yes
GATCCACGGACACCAAGTTA	248	9	yes
GATCCACGCAGCCATCTTGG	85	5	yes
GATCCACGACAGAGTGGAGA	2	2	yes
GATCAAACAGAAGCGCCAGG	9	8	yes
GATCCACCTGTGGTGCTAGT	91	13	yes
GATCCAACTGCCTTTGCCTC	90	2	yes
GATCAGAGCTACACAATGGC	67	6	yes
GATCCAACTATGGCAGTTTT	4	4	yes
GATCAGAGCCGCCTGACTTC	182	5	yes
GATCTGCTCTGTAGGTTTAC	1	1	yes
GATCAGAGCAGGAAGTTTTC	14	8	yes
GATCCAACCTGACCCCATTG	9	4	yes
GATCAGAGCAATGCTGGAGC	13	11	yes
GATCTGCTCGTGTTCCTGTC	7	7	yes
GATCTGCTAAATGAGGCAAA	2	2	yes
GATCAGAGACACGGAGCTGG	20	1	yes
GATCTTCAATTCACACTGCC	12	11	yes
GATCATGTTCCGCCAGCGGT	8	0	yes
GATCCACCTGCTTCTCCCTT	37	6	yes
GATCCACCTGCTGCTGCCTC	5	5	yes
GATCCACCTGCCTGTGCCTC	77	4	yes
GATCCACCTACTTTTTCAGC	3	3	yes
GATCCACCTACCTGCCTCTC	22	1	yes
GATCCACCCTGAAAGTGTCT	1	1	yes
GATCCACCCCTATCTGAGAA	68	14	yes
GATCCACCCACCCTGGGCAT	90	29	yes
GATCCACCATCTGTAATGTC	2	2	yes
GATCCACCAGTGCTTCTGCT	374	55	yes
GATCCACCAGTCCTTGAAGC	175	61	yes
GATCCACCAGGATGTTTGAT	4	1	yes
GATCCACCACATGTGCCAAA	404	52	yes
GATCCACATTTGCTGGTTTG	86	0	yes
GATCCACATTGCTGTCCTAT	17	1	yes
GATCCACATTCTCCATTCTA	15	1	yes
GATCCACATTACCATCAAGC	4	4	yes
GATCCACATGTGCTCGCAAA	37	13	yes
GATCCACATGTACCATCAAC	38	6	yes
GATCCACATGCGTGTAGCAG	411	51	yes
GATCCACATGAGGAGATACT	118	2	yes
GATCCACATCTCCCTCCCCT	15	11	yes
GATCTAGTGCCTAGTGTTGC	36	33	yes
GATCAGACCGTGGCGGTTGG	9	2	yes
GATCAGACCGACGTATGCAG	4	4	yes
GATCAGACAGTTAAACTGTG	44	21	yes
GATCTGCGAAAGGGGCAAGG	9	8	yes
GATCTGCCTTGGGAGAGGGC	4	0	yes
GATCAGAATGGACCAATCCC	6	6	yes
GATCCACAGTCCCTATGTGT	23	7	yes
GATCCACAGTCAGCAAATCC	7	1	yes
GATCCACAGGGTACCTCCCT	83	10	yes
GATCATTTTCGATGAACCCC	5	1	yes
GATCCACAGGCAGTTGTGCC	13	1	yes
GATCCACAGGAGGGTTCCAA	63	0	yes
GATCCACAGCAAATTGAACA	15	2	yes
GATCCACAGATTTTCTTGGG	22	3	yes
GATCCACAGATTCTGCCTGT	11	6	yes
GATCCACAGACAGCAGGAGG	10	4	yes
GATCCACAGAAGCACTGCAG	43	7	yes
GATCCACACTTCTGAAGACT	24	17	yes
GATCCACACTGCCACTAAAA	8	2	yes
GATCCACACTAATATCGCTG	19	4	yes
GATCCACACGGAAGGGGAAA	4	2	yes
GATCCACACCTGATGGCTCC	5	5	yes
GATCCACACCTGAAATGCTA	54	14	yes
GATCCACACCCTAACTCCCA	41	4	yes
GATCCACACACGACTCTCCA	1310	120	yes
GATCCACATCTTCAAATGCC	19	3	yes
GATCCTCTTGCTGCAGCTTT	4	4	yes
GATCCACAAGTCTTAGCTGT	341	51	yes
GATCCACAAGGCCCTCATCA	1	1	yes
GATCCACAAGCGACTCATTG	1137	65	yes
GATCCACAACCTGATTCCCG	140	37	yes
GATCCACAACAAGTCACTTT	11	3	yes
GATCCACAAAACCAATAAAA	2	2	yes
GATCAGAAGGCTGAGCACTG	69	45	yes
GATCAGAACAGAACAGGTGA	3	3	yes
GATCTGCCATCCCCTTCAGA	60	4	yes
GATCAGAACACCCCACATTT	13	12	yes
GATCTGCCACTGAAGTAGAC	64	6	yes
GATCATTGACTCCCAGATTT	12	9	yes
GATCTGCTGACACCATCTGT	6	0	yes
GATCCAATGGCATCTTCTGG	4	3	yes
GATCCAATGCTCTATCAAAC	11	2	yes
GATCCAGAGGCAGGTGCAGA	696	117	yes
GATCCAATCTTTGTCTTAGG	26	7	yes
GATCCAATCCCTGTGCAGCA	45	8	yes
GATCCAATCAGGGCAAGAAC	105	19	yes
GATCCAATACTGTCTGGAAA	53	9	yes
GATCCAAGTTGTACATGAAT	29	17	yes
GATCCAAGTTCGAAACATGG	4	2	yes
GATCCAAGTGTTTAACCATA	21	1	yes
GATCCAAGTGCTTCAGCAAC	2	2	yes
GATCCAAGTGCCCTTCTGCT	10	5	yes
GATCCAAGTCCAGGAACCCT	349	56	yes
GATCCAAGTCATGATTTGAA	29	1	yes
GATCCAAGTCACCCCCCGAA	85	2	yes
GATCCAAGTACTACCATAGG	16	5	yes
GATCCAAGTACACCTAAGGG	214	0	yes
GATCCAAGGTCAAGGCAGAG	387	14	yes
GATCCAAGGCCTCAGGTCAC	312	7	yes
GATCCAAGCTTTGGATGATG	7	2	yes
GATCCAAGCTCTGGGAAGCA	55	6	yes
GATCCAAGCGTTACAATCGC	8	2	yes
GATCTGCCAAACGCTATGGC	25	1	yes
GATCATGTGCCTACCCTGAC	1	1	yes
GATCCAAGCGTGAGCCAGTC	30	10	yes
GATCCAAGCGGACAGAGTGA	4	0	yes
GATCCAAGCAGGCTTGAATA	12	5	yes
GATCCAAGCAGGCCCCTTAT	105	1	yes
GATCCAAGAGGAGGAGCACA	124	21	yes
GATCCAAGAGCCCACACAAG	2	2	yes
GATCCAAGAGACCACCTTTG	74	2	yes
GATCCAAGACCAGGGTGGCT	335	0	yes
GATCCAAGACACTTTGCAAA	9	4	yes
GATCCAAGAAGAAAAGCAAG	78	19	yes
GATCAGGTTATTTACTGGGG	2	2	yes
GATCCAACGTGTTAGCCTTG	163	13	yes
GATCCAACGTAATCTTTAGG	3	1	yes
GATCCAACGAAAAACACTTG	9	1	yes
GATCCAACCCCACCTCAAGT	207	8	yes
GATCCAACCAACCTGAAGAA	19	1	yes
GATCCAACATGGAAGGTGTA	20	5	yes
GATCCAACAAAGGTTGTGAG	1347	61	yes
GATCACTTCCTTCTGGAATC	78	20	yes
GATCACTGTGGCGTCTTGAA	21	6	yes
GATCACTGTCGTGTTTGGTA	22	3	yes
GATCATGGTTCGGTGGCAAT	16	15	yes
GATCACTGGGGTCAATGGCA	46	5	yes
GATCACTGGCCCCGATGGTG	76	20	yes
GATCACTGGAGGCCAGAGAA	18	3	yes
GATCACTGGAGCAGGCCTCC	38	34	yes
GATCCAATACTGTCAATCCA	21	6	yes
GATCATGCTGCTCCGCAATA	3	2	yes
GATCATGCTCTGGCTGAGTT	97	14	yes
GATCCAAATGGGATTTCCCT	33	1	yes
GATCCAAATCTTCCAGGCCC	6	1	yes
GATCCAAATATTGTCATAGC	34	7	yes
GATCCAAGCAGGTTGGGGAA	2	2	yes
GATCCAAATACCCAGGATAA	4	3	yes
GATCCAAAGTTGGCCAGCAT	232	14	yes
GATCCAAAGTCACACCTCCA	128	5	yes
GATCCAAAGGCAGCAAGAAG	21	4	yes
GATCCAAAGCTTTCCCATTT	13	1	yes
GATCCAAAGCTGCTTAAATC	13	1	yes
GATCCAAAGCTCAGGAGACA	16	1	yes
GATCCAAAGCCCCAGTAGAA	24	1	yes
GATCCAAAGCAGTGCTCCCA	586	79	yes
GATCCAAAGAGAGAAAGAGC	98	20	yes
GATCCAAAGACTCAGGTGTT	149	9	yes
GATCCAAAGACACAGTCTGT	114	9	yes
GATCCAAAGAAGACAAAATG	6	3	yes
GATCCAAACTTAACGAGCCC	55	4	yes
GATCCAAACCCCAGTGTACC	391	16	yes
GATCCAAACCCAGAGACCAA	15	2	yes
GATCCAAACAAGAAGACTGA	46	3	yes
GATCCAAACAAAGACACAAG	76	8	yes
GATCCAAAATGTGGCATTTT	48	6	yes
GATCCAAAATGCTACTGTTA	16	7	yes
GATCCAAAAGGAGACTTCTA	98	90	yes
GATCACTGCAGCCCCAAACT	46	5	yes
GATCATGATGTGCTGCCCAG	44	1	yes
GATCTCCATGCTCAGCCTCA	2	2	yes
GATCACTGAAGTGGGGCTGT	2	0	yes
GATCATGACTCTTTGAGATT	2	2	yes
GATCACTGAAGCTCCGCATT	12	11	yes
GATCACTGAACATATCCAGG	11	10	yes
GATCACTCTCTCACACCACC	3	1	yes
GATCTTCTTGCTGGTCTTGC	30	10	yes
GATCCGTAGACCTCCGTCCT	8	9	yes
GATCCAAAAGCCTGCTCGGT	41	0	yes
GATCCAAAAGCAGCGTTTGC	31	13	yes
GATCCAAAAGAGCCTGATGG	17	1	yes
GATCCAAAACAGCACGTCTT	6	4	yes
GATCCAAAACAGCAAATAGG	74	18	yes
GATCCAAAAATGGGGATGTT	58	8	yes
GATCCAAAAATGCTGGACTT	32	8	yes
GATCCAAAAATACAGCCTGC	18	0	yes
GATCCAAAAAGCTAATAAAA	1	1	yes
GATCATTTTTTACTGTGGGT	9	4	yes
GATCATTTTGTCGAGTGAGT	32	10	yes
GATCATTTTCTGCCGTACCA	8	2	yes
GATCATTTTCCCAACGTTAC	31	5	yes
GATCACTCCTTGCTTTGCCA	45	1	yes
GATCATCTGCTACCCAGCAG	4	3	yes
GATCACTCAGGGTGGGCAGT	76	1	yes
GATCACTCAGGACGGTACCC	131	3	yes
GATCACTCACGAGAACATCT	25	6	yes
GATCATCGGCAAGGTGGAAA	2	2	yes
GATCATCGCTTAGGAAACCA	4	1	yes
GATCACTAAGTTGAGCAGTT	8	1	yes
GATCACTAAAGGGTTTCCTG	44	7	yes
GATCACGGTCACTTTCAACA	271	16	yes
GATCATTTGCGTTTGGAGGT	89	9	yes
GATCATTTGATTCCCCTCCC	4	4	yes
GATCATTTGAAAACTGAGAA	9	0	yes
GATCATTTCTTTCTGGCCTG	48	1	yes
GATCATTTCTCGCTCAGATT	12	5	yes
GATCATTTCAGTGAGATTGG	3	2	yes
GATCATTTCAGGTGAGCAAT	4	4	yes
GATCATTTCACTGGTGGCTG	118	20	yes
GATCATTTCACGGATAAAGG	5	4	yes
GATCATTTACAAACTCCAGA	4	4	yes
GATCAAGCTTGTGGCTGCTT	4	2	yes
GATCACGGCATCGAAAGGAA	25	8	yes
GATCACGCCCCACTTTACAT	1	1	yes
GATCACGATGCCACACCCTG	10	9	yes
GATCACGATAAGCTCATCAG	38	3	yes
GATCAGGCAGAGACCCCTGG	10	9	yes
GATCCGGGTCAGCTAACCCG	18	5	yes
GATCATTGTGGCCCCGCCCC	125	115	yes
GATCATTGTGAACACCTCGT	13	0	yes
GATCATTGTCCTCCAGTCAG	24	1	yes
GATCATTGGTTGAATCGGTT	34	7	yes
GATCATTGGGAAGGGGAGAG	5	4	yes
GATCATTGGAGAGGGGTCTG	99	6	yes
GATCATTGCCACGGAAAACA	97	1	yes
GATCATTGCAGTCTGAGGCT	4	2	yes
GATCATTGCAGACAGTGCTA	4	1	yes
GATCATTGATGTTGTCTACA	3	2	yes
GATCTACAGCAAGTTCAAAG	4	0	yes
GATCATTGAGAGCAAGCGAG	43	3	yes
GATCATATTGCCCTGCATCT	101	15	yes
GATCACCTAGATGACACTTG	22	3	yes
GATCACCGCTGCCGCCTGGG	3	2	yes
GATCACCGCCTGCACCGCAG	131	10	yes
GATCATACCCGTCCCTCTCT	36	7	yes
GATCACCCTGGGCCTGGTCA	61	5	yes
GATCACCCTCAGCTGAAGAC	64	18	yes
GATCTGAGAGGAGTGTGTGG	20	18	yes
GATCCCTTTCTCCGGGAACA	3	2	yes
GATCCCTGCTCAGCCGAGGG	9	3	yes
GATCATTGAAAGCCAGAGAC	28	2	yes
GATCACAGCATTCAGGAGTC	4	3	yes
GATCATTCTCCAAAGGCAAC	205	41	yes
GATCATTCCTAAGTTTTGAC	15	2	yes
GATCATTCAGGACAAAGGAG	209	21	yes
GATCATTCACAGAACAGAGT	2	2	yes
GATCATTATGTGCTGAAAAT	21	10	yes
GATCATTAGTTCAAGGCCAA	2	2	yes
GATCATTAGGGGTTTGGTCT	155	42	yes
GATCATTAGCCCACATACCC	46	8	yes
GATCATTAGCATGCCAGGAA	8	7	yes
GATCATTACTGTGTGAGTGT	2	0	yes
GATCATTACACGGAGAACAC	4	4	yes
GATCCCGGCAGCACTCGCTC	41	4	yes
GATCCTGTGAGTCCTGGTGA	11	5	yes
GATCAGACAGTGTCACTGAC	2	2	yes
GATCCAGCAGTACCTGAAGG	4	4	yes
GATCAGGAAAACCATCCATT	3	3	yes
GATCATTTGAGCCAAGAGGT	3	3	yes
GATCCCCACATGCACGCTTA	2	2	yes
GATCAGGTCTTCTTGGCTGT	1	1	yes
GATCCCTTCCCTCCAAACTA	9	3	yes
GATCGGAGCCAGTGGGGTGG	5	1	yes
GATCCCCTGGTACAGGAGCA	6	6	yes
GATCCTTCTGAATGCCTGCT	38	1	yes
GATCAAGGCTCCCGGTTTGC	38	14	yes
GATCGAGGTGTCTCCCATTA	9	10	yes
GATCGACTCTCCCTCACCGG	2	0	yes
GATCTGGATTTTAGGTGGTA	30	10	yes
GATCCCTGCTTCTTGCCCAG	3	1	yes
GATCCTCCGCTGTTACCGGG	9	10	yes
GATCCCCAATATGCTGTTGA	33	5	yes
GATCCCCAAGGCAGCTACCA	139	48	yes
GATCTGGGGGGTCCTCACCT	35	32	yes
GATCGCGGCGCTTTCTCTGG	4	1	yes
GATCAGTTTCCAGAACTTAC	2	0	yes
GATCCAAACCTCGGCACCCC	5	4	yes
GATCCCAGTGGATGAGCATG	57	8	yes
GATCTGACCCACCACGGAGA	62	10	yes
GATCCCGTTTCTTAGCACGT	4	2	yes
GATCTGACAGGACCGCAGAG	87	21	yes
GATCCCGTTCCTATAGTCCA	13	11	yes
GATCTGACACTCTTCTGGAG	17	2	yes
GATCCCAGCACTTGGGAGGG	19	17	yes
GATCCCAGCACCGAGGGGAA	205	16	yes
GATCCCCAAGCATCATGAAT	1	1	yes
GATCTGACACAGAGTCACTG	6	3	yes
GATCTGACAAAGAAAGTTTA	1	1	yes
GATCCCGGCACTGTCTTCGT	2	2	yes
GATCTGAATGGCCTCAAAGA	24	22	yes
GATCCCGGACGCGAACCCGG	206	23	yes
GATCTGAATCTGAAATCCCA	3	1	yes
GATCTGAAGTTCAAATTCCG	38	5	yes
GATCTGAAGTCTTACAAAGC	8	7	yes
GATCCAAGCCAGTCTAGATG	4	2	yes
GATCCCACTGCACCGCCATT	26	2	yes
GATCCCACTGCACATAGGAC	20776	2285	yes
GATCCCACGGGGTGCAGTGA	708	7	yes
GATCCCACGAAGAATTCTTC	70	16	yes
GATCCCACCTAGCAGCCACC	1146	162	yes
GATCAAACTGGCCTGCAAAA	7	2	yes
GATCCCACCACCATGTTCAG	16	15	yes
GATCTGAAGGAGTCCAGGGT	60	16	yes
GATCTGAAGAATTTTGAAAG	58	26	yes
GATCTGAACTTTGTACAGGA	97	5	yes
GATCTGAACTGTGAGCCTAA	9	8	yes
GATCCCCTCCCTCATGTTAA	39	12	yes
GATCAAACAACCCAACAGGA	4135	786	yes
GATCCCCGTGTCTGTGGAAA	26	4	yes
GATCTGAAAGTAGACTCTGC	63	57	yes
GATCCCACAAGGTGGCTTGT	682	19	yes
GATCTGCATGAAACAGCATA	14	4	yes
GATCTGCAAAATTCTATAGT	137	2	yes
GATCCCAAGTTTTTCCTTAA	23	6	yes
GATCCCAAGACCACCCACCT	68	13	yes
GATCCAGCCCCACCATCACC	9	3	yes
GATCTGAAAAACAACTCCTA	77	14	yes
GATCTCTTTTCCTGACCCTC	591	60	yes
GATCCCAAAGCCTCGTATGC	25	2	yes
GATCTCTTTCCCCGAGTTGC	4	3	yes
GATCTCTTCTGTGGTCCTTC	4	3	yes
GATCCATTCGCTGTAACATG	6	1	yes
GATCCATTCCAGAGGGACAT	39	16	yes
GATCTCTCCCCCTCGCCTCT	23	21	yes
GATCCATGTTTTCCAGGTAT	1	1	yes
GATCCATGTTGACCAAATGC	108	16	yes
GATCCATGTGTTGGTTGAGA	43	11	yes
GATCCATGTGATTGGAAAGT	19	2	yes
GATCCATGTGATGGACTGCA	400	54	yes
GATCCATGTCCTTTGGCTCC	267	41	yes
GATCTCTATCCTGTTGACAG	34	4	yes
GATCACGTACTGTGCCTTGT	22	3	yes
GATCCATGGTGGGGCCATTT	81	8	yes
GATCCATGGTAGTCAGATAG	99	20	yes
GATCCCACACCCTGCCTACC	7	4	yes
GATCCACACCTCCTTGTGTA	6	3	yes
GATCTCTGTGAGCACCACTG	18	9	yes
GATCTCTGTCCGAACTGTGA	95	16	yes
GATCTCTGTCCACTGTATGC	30	4	yes
GATCTCTGTCAAGGTGGTGG	6	5	yes
GATCTCTGGTCTCCACAGGC	13	12	yes
GATCTCTGGGGTTTCCATGG	30	28	yes
GATCATGAGCGGAAGGGTTT	58	1	yes
GATCCATCCATGCACACAAC	17	16	yes
GATCCATGGGCTCCTTTGTG	61	17	yes
GATCCATGGGCCTTAGGGCT	193	23	yes
GATCCATGGGACTAAACAAC	2	2	yes
GATCCATGCTCTGATGAGCG	26	15	yes
GATCCATGAAGTTTTCAGTC	66	14	yes
GATCTGTTGTGGAACGGTTT	17	0	yes
GATCCATGAACTCTAACTCC	10	11	yes
GATCCATCTGCATTTGCGGC	2852	155	yes
GATCCATCTGCACATGGCTC	49	4	yes
GATCTCTGGGAAGGGCTGCG	89	40	yes
GATCACAGCTAGTGAGATTA	1	1	yes
GATCTCTGCTCCCTACCCTT	26	5	yes
GATCTCTGCTCCCCGCCTTT	40	6	yes
GATCTCTGCTCCAATCACAG	2	2	yes
GATCTCTGCTATGAGGCTAC	256	80	yes
GATCAGTGTGCCAGAATTGA	4	4	yes
GATCCCAGGAAGTCCCACGA	69	17	yes
GATCTCTCTGTTCTCCTGTG	32	6	yes
GATCCCAGCAGCATGGCGTC	30	3	yes
GATCTCCGAGGAGAGTGCCG	12	2	yes
GATCTCCCCTCTCTCTTGTC	22	4	yes
GATCTCTCTCGCTGAAGGCG	24	1	yes
GATCCATAGGGAAATTGTCC	14	0	yes
GATCTCTCTCCCTCTACACA	3	3	yes
GATCTCTCGCCTGGACCCCT	56	51	yes
GATCTCCAGCCTCCACCTCT	18	3	yes
GATCTCTCCCAGATGGTAAA	14	3	yes
GATCTCTCCAAAGCACACGC	29	3	yes
GATCTCTCAGGCCATGGGTC	318	31	yes
GATCTCTCACGCAGACAGAA	76	13	yes
GATCCCAGAGGCTGAACTAA	33	15	yes
GATCTCTACCCAGATGTCAC	3	3	yes
GATCTCGTTAGTCACGCTTC	91	10	yes
GATCCCAGAACCTGCAGCTA	134	32	yes
GATCCACGCCCGCTACATCC	2	2	yes
GATCCAGTTTCCTCACAAAT	7	0	yes
GATCTCCACACCATCCAGGA	2	2	yes
GATCCAGTGTGGAAGAGGTG	49	6	yes
GATCTCGGTGGCCAGCTTCC	12	11	yes
GATCTCGGGAGATTGGCTGG	5	4	yes
GATCTCGGGAATCAGAGTTC	36	33	yes
GATCTCGGAAGTGAAGATGG	25	23	yes
GATCTCGCTTACAAGAAACC	63	3	yes
GATCCCACCTCCCCCCAGTC	223	38	yes
GATCACCACCACAGCCCAGC	17	16	yes
GATCTCGCCCTGTCAAGCAT	266	13	yes
GATCTCAGTCCTTGCTGCCT	16	3	yes
GATCTCGCAGCCTTCCCCTC	611	29	yes
GATCTCGCAAGCACAAAGCC	195	28	yes
GATCTCGAGTCACAGCCAGC	204	114	yes
GATCTCGAATCAGGTCTTTT	22	1	yes
GATCTCCTTTGCCGATTACA	3	1	yes
GATCCCACACCCACCTGCTC	49	4	yes
GATCTCCTTGGAAAGCGACT	4	4	yes
GATCTCCTTCACCTGAACCA	18	16	yes
GATCACTTTTGTTTGCCAGG	9	8	yes
GATCCAGGGTGGGAAGGAAG	102	10	yes
GATCCAGGAGACTCGAAGAT	227	31	yes
GATCTCCTGTCTCTATGAGG	5	1	yes
GATCCAGCTTCCCTCCGAGA	704	57	yes
GATCTCCTGCAGAGTAACTG	26	9	yes
GATCAAGGTCACACCCATAA	2	2	yes
GATCCAGCGAGGGAGCTGCC	41	7	yes
GATCTCCTCACACTGGTAAT	13	12	yes
GATCTCCTACAATGAGACCA	13	14	yes
GATCTCCGCCCGAGCCTACG	139	2	yes
GATCTCCCTGGTCCTGGCAT	3	2	yes
GATCCAGCCAGGAAACCCCA	39	2	yes
GATCCAGCATGGGTGTCCCG	38	12	yes
GATCCAGCATCACCCAGACA	92	4	yes
GATCTACTTCCTACGGCACA	3	1	yes
GATCCAGCAGACCCAGCACA	66	4	yes
GATCCATTTTGTTCGTGGAC	55	12	yes
GATCTCCCCTCTTCCTGGAT	244	3	yes
GATCCAGAGTAAAGACAGCT	88	15	yes
GATCTCCCCGAAGGAGAGAT	12	4	yes
GATCTCCCCACCACCCCAGG	67	4	yes
GATCCATTAGCTTTGTCTGA	57	14	yes
GATCTCCATCTTGGACAGCT	30	33	yes
GATCTCCATCCAGGACTAAG	37	34	yes
GATCTCCATCACGAAGACAG	14	13	yes
GATCCATGCTTTGCCCGAGA	39	8	yes
GATCTCCAGGGTGGATTTCT	138	59	yes
GATCTCCAGGCTGAAGTCAG	4	4	yes
GATCTACATTTTCTCTCTCT	2	0	yes
GATCAGCTGCCCTTGACCTT	3	3	yes
GATCCTTCTCTGTGTCAGCT	20	11	yes
GATCTGACTGATGTAAGTAG	2	2	yes
GATCCTGGAGTGGTGCGGAG	2	2	yes
GATCTCCAGCCTCGCCGTGA	10	9	yes
GATCCATGAAACAGCCAGGA	6	6	yes
GATCTATACTGGGCACCACA	12	1	yes
GATCTCCACTCCGCCACCTG	11	10	yes
GATCTCCACCCTATGCGAGT	357	29	yes
GATCTCCACACAGCACACAG	881	24	yes
GATCTCCAATGCTGGGTCTG	34	5	yes
GATCTCCAAGTCTCTCAGTC	32	6	yes
GATCTCCAACTGTGCTTTCA	4	4	yes
GATCTCCAACGTCAGCCAGC	57	52	yes
GATCCATATCCTGCTCCACC	73	10	yes
GATCTCATTGCTGGAAGGAG	45	2	yes
GATCCTGCCATGCTTCCTGC	12	11	yes
GATCGACTGCCAACAGCCTT	4	5	yes
GATCGAGTCTTCAAGCAATT	8	3	yes
GATCCTGCTGCAAGATTTGT	3	3	yes
GATCCCTCTGCCTCTCAAGT	2	2	yes
GATCGCTAAGTACATGGAGT	13	4	yes
GATCAAGTTTTAGACTCTGT	25	23	yes
GATCAAGTTTCTGGCCTTGC	25	5	yes
GATCTCCCTCTGGGTGGCAA	34	2	yes
GATCACCCAGGAAGAGAAAT	14	0	yes
GATCTGAGAATTCTCCCTGG	20	5	yes
GATCACCAGGAAACTTGAAA	19	3	yes
GATCAGTTCCTCTTCAGAAT	14	7	yes
GATCACCAGAAGCCATGCTC	46	11	yes
GATCATTAATGCCCTTGAAG	22	21	yes
GATCATGTTCTTTCCGCAGG	474	87	yes
GATCATGTTCGCCTGGACAC	126	23	yes
GATCATGTTCCTGGAGGTCA	78	10	yes
GATCATGTTACACTTGCCAG	55	2	yes
GATCATGTGGCGTTCTCTCT	31	7	yes
GATCATGTGGATTCCAGGAA	11	3	yes
GATCATGTGGATGCCTTCCC	536	8	yes
GATCATGTGGAAGGTGAGAT	17	6	yes
GATCATGTGCTCACCTGCAT	17	16	yes
GATCAGTCTTCTGCCCTGTC	3	3	yes
GATCACATTCCTTCCGAGGT	11	1	yes
GATCTGACGCCCTCTTGTGG	60	16	yes
GATCACATGGTGACTCTAGC	35	2	yes
GATCACATGACCCCTGAAAT	10	4	yes
GATCCTCCTGTCTCTACCTC	66	20	yes
GATCATGTGATGCTAAACTC	11	1	yes
GATCATGTGAGCATCGTGGA	351	25	yes
GATCATGTGAGAACAGGCAT	56	1	yes
GATCATGTCTTCTCCATGTT	254	53	yes
GATCATGTCTGTGAAATGAC	1	1	yes
GATCATGTCTCAAGGTGGCA	63	11	yes
GATCATGTCTATCTCAGGGG	207	10	yes
GATCATGTCCCACAGGCATT	46	10	yes
GATCATGTCATTGCCTGTTA	82	15	yes
GATCATGTCAGCATGAGTAG	2	2	yes
GATCATGTCAGAGGGAGATG	13	7	yes
GATCATGTACAGAGGTCTTT	13	0	yes
GATCATGTACAAGCTGATGG	63	11	yes
GATCATGTAAAGACGCTGGG	56	2	yes
GATCATGGTGTGGCTTGTGG	25	0	yes
GATCATGGTGTCTTGTGGTT	44	1	yes
GATCATGGTCTTCGGAAAAC	59	11	yes
GATCATGGTCAGCTCTGAGG	22	5	yes
GATCAAGCTTCGTGGCTTTT	38	1	yes
GATCATGGGTGTTGCTACCA	53	3	yes
GATCATGGGTGTGCCAGGGG	38	3	yes
GATCATGGGGTTCTGACTAT	9	1	yes
GATCATGGGGTTCAGTCTTC	2	2	yes
GATCATGGGGCTGGAGAGAT	10	2	yes
GATCATGGGGATGGACGGGG	348	23	yes
GATCACAGTTCATGTAATGC	9	3	yes
GATCACAGGCCTGAGCTGGG	19	3	yes
GATCACTCTGCATCCTACAG	2	2	yes
GATCCTGAAGGAGCTGGACG	16	10	yes
GATCATGGGACTTGTAATCA	6	6	yes
GATCATGGCCTTTACGATGC	48	8	yes
GATCATGGCCTTCAGATATG	78	1	yes
GATCATGGCCCAGACCTGAG	117	6	yes
GATCATGGCAAAGGATGACC	139	4	yes
GATCATGGATGTGTGGGGAA	15	4	yes
GATCATGGAGGCAGAAGAGA	27	25	yes
GATCATGCTGTGTTCGTGAT	20	0	yes
GATCATGCTCCTGCAGCTGA	288	4	yes
GATCATGCTCCTGAGTGGCA	8	7	yes
GATCATGCTCATCTTCACTG	40	4	yes
GATCATTGGGGGAGGGTAGT	36	33	yes
GATCATGCTACGTTTTGTCT	25	0	yes
GATCATGCTACCACTGCATC	23	3	yes
GATCATGCGCCTTTCTAAGC	130	34	yes
GATCATGCCTTCTGTAAAGC	14	3	yes
GATCACAGTGGCTATATCTC	34	31	yes
GATCACAGCTATGCCCTTTC	73	6	yes
GATCAGGAAATGGGGGACGG	41	6	yes
GATCACAGCCCTAGCACCTA	16	3	yes
GATCGTGTGTTGCCATTTTG	55	13	yes
GATCACAGCAGCCCAAGCTC	148	6	yes
GATCTCAAGAAAGAGTTGCG	33	0	yes
GATCATGCCGTGCTACGCTC	7	7	yes
GATCATGCCCCAGGACACAA	11	10	yes
GATCATGCCCAAAACAACCA	152	10	yes
GATCATGCAGACTGTTCCTT	501	156	yes
GATCATGCAGAAGAACGGTG	81	6	yes
GATCATGCACTGTATTCACA	13	3	yes
GATCATGATTTCCGAGCTAC	2	2	yes
GATCATGATTCTCCCTCAGC	11	3	yes
GATCATGATAGCAGCACAGA	151	63	yes
GATCATGAGTGTCCCACTAC	56	11	yes
GATCATGAGGGAGTTCCGGT	762	142	yes
GATCATGAGGCTGTCTGCAG	93	25	yes
GATCATGAGCCTGGAAATTC	4	0	yes
GATCATGAGCCATTTTTAAC	13	4	yes
GATCATGACTGGGAGCATGC	21	20	yes
GATCATGACTCAGTATCAAC	29	3	yes
GATCATGACGCTGGTAGATG	23	2	yes
GATCATGACATTCCTCAGAT	7	2	yes
GATCACAGACCATGGTCTCA	175	3	yes
GATCAGCTGACCCAGGCTTC	14	0	yes
GATCACACCCTCATCAGAGT	36	13	yes
GATCATGAACATCATCCAGG	97	6	yes
GATCATCTGGCAAGCAGAAG	2	2	yes
GATCATCTGCTACCAATGTG	22	5	yes
GATCATCTGCCCTTTCTATC	41	0	yes
GATCATCTGACAAAGTGCTA	4	1	yes
GATCATCTCCCCCTTCAGTG	27	5	yes
GATCATCTCACAGGACAGGG	72	18	yes
GATCACACCACTCTCAACCA	59	14	yes
GATCACACATCTGGGCAGTG	94	4	yes
GATCACACAAAGCCCTAACA	39	5	yes
GATCCCTCCTGTGGACCTGC	4	3	yes
GATCTCTGTAACAGAGCCTC	17	16	yes
GATCTGTCACTGTTACCATG	4	0	yes
GATCAGTTCTTCAGCATGGT	8	7	yes
GATCATCTCAAAGCCTGTTT	7	7	yes
GATCATCTACGACAGAAAGT	14	3	yes
GATCATCGTGTCGGGATGAT	95	10	yes
GATCATCGTGGGCCTTGAGC	4	3	yes
GATCATCGTGCTTTCAGACT	7	7	yes
GATCATCGTCAGTGACGTTT	103	4	yes
GATCATCGGCATGGCATACG	166	5	yes
GATCATCGGACGGCCAGTTG	59	6	yes
GATCATCGGAAGGATAGATG	19	6	yes
GATCATCGAGTTGTGGATGG	2	2	yes
GATCATCGAGGACAAAACTT	13	12	yes
GATCATCCTTGTGTTGTGAA	92	12	yes
GATCATCCTCTCACAGATGG	13	4	yes
GATCATCCGCAAAGTTGTGA	5	1	yes
GATCATCCATGAGCCATGAT	2	2	yes
GATCATCCAGGGCTGCCCCT	8	7	yes
GATCATCCACCTGCTCACTG	1235	12	yes
GATCATCCACAAACTTCCAG	11	10	yes
GATCATCCAAGCTGTTGTAA	27	1	yes
GATCATCATTCGTGTGCAGA	13	8	yes
GATCATCATGGAGCTGGTGA	28	2	yes
GATCATCATGCTTCCAGATG	151	0	yes
GATCACAAGCCAGAACTTCC	41	4	yes
GATCACAAGATGGCGTTATC	10	9	yes
GATCAGCAGTTCTAGCCTGA	21	6	yes
GATCAGGTCATCGCCTCCTT	977	65	yes
GATCAGGTAAGGGAGCACAC	42	39	yes
GATCAGGGTTAAGGAGGAGC	90	16	yes
GATCAGGGATATGAGGTTGC	28	0	yes
GATCAGGGAAGCAGACATTG	471	30	yes
GATCAGGCTGTCTGGAGACT	4	4	yes
GATCAGGCGAGACATGTTCT	48	7	yes
GATCAGGACTTGAGGGTTAT	26	2	yes
GATCAGGAAGCAAAGAAAGA	9	8	yes
GATCAGCTGTGGGCTCTGGG	308	13	yes
GATCATCATCTTGACAGCTT	10	0	yes
GATCATCATATTTCTCACCT	2	2	yes
GATCATCAGTTATCCAGACT	2	0	yes
GATCATCAGTTAGAGTTCTG	4	2	yes
GATCATCAGTGTGTTGGAGC	5	5	yes
GATCATCAGCTGAGGCAAGG	22	7	yes
GATCATCACTGCTGCCCTAT	15	3	yes
GATCATCACTCACGGACATA	1	1	yes
GATCATCAAGTGTCCTGGCG	15	2	yes
GATCATCAACAAGACTATCT	1	1	yes
GATCATAGTGGGCTCCCCTT	11	3	yes
GATCATAGGACCACAGACCA	17	16	yes
GATCATAGCTTCCTGTCCCC	4	0	yes
GATCACAAACATAGCCAATG	70	1	yes
GATCTCTATGACACGCTGAC	11	2	yes
GATCAATGCCTGGACGGCTC	559	71	yes
GATCAGATGAGGCGTCCTGG	35	32	yes
GATCTCGTCATGATTCTGAA	15	5	yes
GATCAGAGGCCACATAGCTT	3	2	yes
GATCAGCTCTGTAGCAGCAG	20	18	yes
GATCAGCGTGCGCCTAGCGG	575	5	yes
GATCAGCCTTCAATAGCCAT	12	13	yes
GATCAGCCTCTTTCCCATCA	88	23	yes
GATCAGCCCTGGCAAGGAAG	99	5	yes
GATCAGCCCCATTGCGGTGC	19	2	yes
GATCAGCCATCCTGGATGGA	2	2	yes
GATCCCAGCTGTTTGGGGCT	78	86	yes
GATCAGCCAAGCCAGACTTG	2	2	yes
GATCAGCATTCCACCCCGGA	20	7	yes
GATCATAGCTGATGGCCTTC	47	4	yes
GATCATAGCTCTAGCAGAAC	24	1	yes
GATCATAGCTACTTTGTGCT	5	1	yes
GATCATAGCAAAGATGGACG	78	14	yes
GATCATAGATTGGGCTACAT	72	8	yes
GATCATAGATGACTTTGCCT	114	6	yes
GATCATAGAGGTGTGGCTTT	7	6	yes
GATCATAGACCAGAGCGAGG	15	14	yes
GATCATACTGTTAGTCGGCT	37	0	yes
GATCATACGCCCAGGGAGAG	100	39	yes
GATCATACCCTCTCTGGCTT	18	5	yes
GATCATACCAAGAGGTGAGG	260	23	yes
GATCATAAGCTCCTGTGGGC	2	2	yes
GATCATAACAGTTCTGTGAA	7	7	yes
GATCTCGCTGCTGTGGAACG	8	3	yes
GATCTCCACTGAAGTTGGCA	6	5	yes
GATCTCCTTGGGAGTTTGTG	1	1	yes
GATCAAGTTGGGAGTGGCAG	21	6	yes
GATCAGCAGGTGGTTATCAA	84	5	yes
GATCAGCAGCTGCTTTTGCA	66	2	yes
GATCAGCAGCCGGAGACGAC	12	0	yes
GATCAGCAGATGTTGGTGGC	13	0	yes
GATCAGCACTGGGGTCAACG	40	11	yes
GATCAGCACTGCCTGTGAAT	8	9	yes
GATCAGCACTCTCGGTATGC	115	13	yes
GATCAGCACCACACTGGACT	43	29	yes
GATCAGCACAGCCTCCTTAG	13	11	yes
GATCAGCAAATTCAGAGATA	30	6	yes
GATCAGAGTGTCACGGTAGG	5	4	yes
GATCAGAGGCGCATCGAATG	35	32	yes
GATCAGAGCCCTGTCGATGG	65	9	yes
GATCAGAGATGGGCTCTGTG	15	14	yes
GATCAGAGAAACTGGGTAGA	52	11	yes
GATCAGAGAAACTCTGACAT	20	3	yes
GATCAGACTAACCCCGGAGT	118	2	yes
GATCAGACGAGGTTCTCTCT	37	8	yes
GATCAGACGAAAGACATTTG	38	5	yes
GATCAGACCATGGTACTGGC	186	26	yes
GATCTCCAAACAGGGCCAGA	2	2	yes
GATCAGTTTTTGGTGTCATT	400	13	yes
GATCAGTTTTGGTCTTGATG	12	5	yes
GATCAGTTTTGGAGTGCAGC	53	8	yes
GATCAGTTTTGACCTCTTAT	8	3	yes
GATCAGTTTTCATGTCCTCT	4	4	yes
GATCAGTTTGTTTTCACTGT	35	1	yes
GATCAGTTTGAGCCTACCTT	20	22	yes
GATCAGTTTCTGTGTAGTCT	14	1	yes
GATCAGTTTCTGTGACTGTA	8	3	yes
GATCAGTTTCAGCCAGGAGT	49	0	yes
GATCATTTAGCGACAAGCAT	38	3	yes
GATCAGTTTATCAGTCCGTT	19	0	yes
GATCAGTTGCCAAATGATTG	23	2	yes
GATCAGTTGATATCTGGGGG	6	1	yes
GATCAGTTGAAACTTGGAAA	36	2	yes
GATCAGTTCTGAGCCGAGGA	146	10	yes
GATCAGTTCCTGGTATACAG	22	13	yes
GATCAAGTGCTGTGACAGTG	42	0	yes
GATCTCCTGCCAGCTTTGGC	24	12	yes
GATCTCCTGAGACTGGAGTT	7	7	yes
GATCGCTTCTGGCTAGAGAC	4	4	yes
GATCAAGGTGGCGGAGGACG	32	29	yes
GATCAGAACAGTGGTCCAGG	2	2	yes
GATCAAGGTCGGAAAGAAAT	1003	7	yes
GATCAGACAGTATCAGGGCT	5	5	yes
GATCCTGCTGGAGGTGAACA	20	5	yes
GATCAGAATGAGGGACCTCC	127	25	yes
GATCAGAAGTTCCCCTTCAG	41	13	yes
GATCAGAACCCGCAGACCAA	20	3	yes
GATCAGAACAGACTCACACA	3	2	yes
GATCTGTGCAGGGTATTAAC	4683	1114	yes
GATCAGAAACCCGAGCTGAA	17	16	yes
GATCCCACATCCCCAGGTTT	2	0	yes
GATCACTTTGACTTCATCCT	34	4	yes
GATCTGTGCAAAAGCAGTGA	374	21	yes
GATCCCTGCATGTCTATGTG	4	0	yes
GATCACTGGCAAGCACGAAG	2	2	yes
GATCACTGCTGTAGGAAAGC	12	2	yes
GATCACTGCTCTGGACCTAA	34	7	yes
GATCAGTTCAGTGTGCATCG	16	3	yes
GATCAGTTCAGACAACTGTG	7	6	yes
GATCTCCGCTTGCTGACGCC	2	0	yes
GATCAGTGTTTCTGCGAAGG	9	4	yes
GATCAGTGGCTTCAGTCACA	17	16	yes
GATCGGCGTGACTACCCCTT	34	31	yes
GATCAGTGCTGTACTTCACT	48	3	yes
GATCAGTGCTCTGCTAACGC	903	37	yes
GATCAGTGCCTTTGTTGGCA	327	7	yes
GATCAGTGCATTTCAGAGTT	5	4	yes
GATCAGTGCACACAGCTCTC	13	12	yes
GATCCCTGAGCCTGAATTAC	8	7	yes
GATCAAGAAAAGCAACTTAT	2	2	yes
GATCACTCAGTAACTGCTGG	127	18	yes
GATCACTCAGCCCTTGAGCA	58	2	yes
GATCACTACTCCTTAGACGT	116	18	yes
GATCACGTTTGTGTTGTCTT	24	1	yes
GATCACGTTCTGATTGAGCT	37	4	yes
GATCACGTGTCCAAAGGTGA	71	3	yes
GATCACGTGTATGTGTCGTG	28	6	yes
GATCACGTGGGCTGCGTTTC	119	3	yes
GATCACGTGGCTGTTCTTGT	221	30	yes
GATCACGTGCCTGAGGTATG	42	13	yes
GATCACGTGACCACCCTTTC	100	2	yes
GATCACGGTGCCTGGTTACA	22	21	yes
GATCACGGGAGCTGAGCAAC	21	19	yes
GATCACGCAGTCTTAGAAAT	42	0	yes
GATCACGACGACGCCCACGC	207	17	yes
GATCACGAATGGCTCTGGGG	2	2	yes
GATCACCTTTGGGACTGTGG	1	1	yes
GATCACCTGCTCTAATGTCC	793	466	yes
GATCACCTGCCAGACTGTTA	17	2	yes
GATCTGTCTGTTTAGTGGAT	3	3	yes
GATCACCTCCCAGATTCTGA	93	14	yes
GATCACCGTTCCCATCCCCG	13	4	yes
GATCACCGTGTAGCTGAGGC	3	2	yes
GATCACCCATAAGAACCAGA	11	10	yes
GATCACCCACCCATCAGCCA	104	12	yes
GATCCAGCACCCTTTACAAG	7	6	yes
GATCACCATGCTGTCCCAGG	5	0	yes
GATCACCATCCACTTACCAT	6	4	yes
GATCACCATCACTGCACCGC	13	11	yes
GATCACCACCGGAGCTCAGG	19	18	yes
GATCACCACACTGCGCACCG	24	26	yes
GATCACCAAGGAATCCAAGG	503	35	yes
GATCACCAACTCACGTCATG	249	44	yes
GATCACCAACCACCCCAGCA	351	48	yes
GATCACCAAAAACATCCAGG	8	7	yes
GATCCATCCCACCTGCTCTG	2	2	yes
GATCACAGTGGAATCTTCGG	76	18	yes
GATCACAGTGAGATTCTCAT	59	7	yes
GATCAAGTCCTGCTACTACT	3	3	yes
GATCACAGGTCTGAGCAAAG	114	9	yes
GATCACAGGATTGGCGTCCC	70	1	yes
GATCACAGGACTTGACCCAT	17	8	yes
GATCTCTGTGAGGTGGACAC	2	2	yes
GATCACAGAGGGGCCAGGAT	250	41	yes
GATCACAGAGGACCGCCTCT	17	16	yes
GATCCAAGCAGTGTGAGCTT	5	0	yes
GATCACACTTGGGGAAGATG	29	5	yes
GATCACACTGGAACAGAACC	77	0	yes
GATCACACCTGTGGGGTCAA	96	87	yes
GATCACACCTGTAGACAAGA	29	1	yes
GATCACACCCAAAGCTGTCC	174	34	yes
GATCACACAGGGAGGCCTTG	331	35	yes
GATCACAACTGATGGCGGGT	726	56	yes
GATCACAAACACCGGTGAGA	51	7	yes
GATCAATTCCCCACCTACAA	87	1	yes
GATCAATCTATGGGAAGACT	10	9	yes
GATCAATCCGACCAGCGTGT	1	1	yes
GATCAATCCACAGACGACTG	35	1	yes
GATCAATCACCAGCGCGAAG	349	7	yes
GATCAAGATTTGGCCAATTG	33	30	yes
GATCATCTGCGGAAGGGTGC	4	4	yes
GATCAGGAGGTGAACAGAGA	123	14	yes
GATCAAGAAATTGCCAAAAA	5	4	yes
GATCAACTCATGGAGCTGGC	176	81	yes
GATCGGACGCCACCACATTA	2	2	yes
GATCAACGCCATGACCTACC	159	7	yes
GATCAACCCCTACCAGCCAG	8	7	yes
GATCGCTGAGGCACCCGGTG	7	6	yes
GATCAACCAGGTGGCCTTGG	26	2	yes
GATCAACATCGATGTTCTTT	22	11	yes
GATCAACACTTTTCTCTCAG	22	9	yes
GATCAACACTCCCTGTATCT	13	11	yes
GATCAACACACTGGAATGGA	4	4	yes
GATCAAATTCCCAGGGACAT	246	17	yes
GATCCGAATCTGTGCCCAGC	248	41	yes
GATCTGGGACATTCAAAAGC	6	6	yes
GATCACCAAGGCTCGGGAGT	4	4	yes
GATCCCTCTCTCACACTCCT	5	5	yes
GATCCCACTCTGAGTCCAAA	16	3	yes
GATCCCGTGTTCCTTTCAGC	16	3	yes
GATCAAATCCTGCGTCTTTT	11	6	yes
GATCAAAGAATTTGGTTCTG	9	8	yes
GATCCTCCTGGGCTTGAACT	43	5	yes
GATCGACACATGTGTGGGGA	52	1	yes
GATCAGTACCCTCTGCTTGA	10	9	yes
GATCCCTTTATGAACCTTGT	33	17	yes
GATCATCCAAAGTCCTCCAT	14	6	yes
GATCTTTTGTGACTGTTGCT	3	3	yes
GATCCTCAGTCTCAGCCACA	20	7	yes
GATCCCTTCCCCTTCCACTA	6	6	yes
GATCAAGACTACCATGGTCA	39	6	yes
GATCAGGCAGCTGTTGAGTT	5	1	yes
GATCAGTCACAGCTTGTGCC	4	4	yes
GATCGTCTTAGGGAACCCAC	3	2	yes
GATCCAGAGGCCCTAGCCAG	178	12	yes
GATCCAGAGAGCTTCCTAAA	59	1	yes
GATCCAGAATGTGTGGCAAC	40	6	yes
GATCCAGAATACTGAGCAAA	4	2	yes
GATCCAGAACACTTGACACT	7	7	yes
GATCCAGAAATTGGAGATAA	39	4	yes
GATCCCTCTTGGTTTGTGAC	17	6	yes
GATCAGGTCCACCCTCCAAC	34	13	yes
GATCCACTGCGTTTCCATGC	173	87	yes
GATCCACCTTGTGGCCTGGC	283	58	yes
GATCCACCTGTCTCTCCTTC	44	12	yes
GATCTCATGGTTGACTCTCT	8	3	yes
GATCTCATGGCCAAAGTAAG	32	35	yes
GATCTCATGGCACACATAGC	80	14	yes
GATCTCATCCAACTGTTTAC	21	1	yes
GATCCACCGTACCAGGAAGC	226	57	yes
GATCCACCCCTACAGAAAGA	13	11	yes
GATCTCAGTTTTTGGTTACA	25	4	yes
GATCCAGTCGTTCTGCTGCG	139	5	yes
GATCTCAGTCCCCGCCTGCA	256	37	yes
GATCTCAGGCCTGTCCTGTG	23	21	yes
GATCCAGGTGTTTGGCCTGA	46	1	yes
GATCTGTCCTAGGTTGCGAA	9	0	yes
GATCCTGCCCCCACGCTGGG	91	9	yes
GATCCACCAAGGTAGAAAAC	89	7	yes
GATCCACCAAGAGAAGAAGA	5	5	yes
GATCCACATAGTGCTGCTGC	20	18	yes
GATCCACAGGCTCCTGGGCC	12	11	yes
GATCCACACGGGCGAGAAGC	15	7	yes
GATCCACACAGGAGAGAAGC	62	14	yes
GATCCAGGACAGCCAGAGCT	25	2	yes
GATCTCACTGTTACTCTGGC	1	1	yes
GATCTCACTGTGTCGCTCTG	36	2	yes
GATCCAGGACACAGCGTGGT	28	4	yes
GATCTCACTGGTGAATAATC	8	7	yes
GATCTCACTGGACTTGGTGT	172	1	yes
GATCCCGTGTAGCCTTCGTT	39	12	yes
GATCCAGGAACCGAAGAATG	14	1	yes
GATCAGGACCTCAGCGATGG	3	3	yes
GATCTCACTAACCTGCCACC	52	9	yes
GATCCAGCTGCAGAAGCCAG	83	6	yes
GATCTCACGGCCTGCGGGGT	32	15	yes
GATCTCACGGCCAGACAGAC	152	16	yes
GATCTCACGCCTCTGTGCAT	86	30	yes
GATCAAGCCTAGCCAGGACC	13	0	yes
GATCCAAGTTATTGGCACAC	13	4	yes
GATCCAAGGGCCCTGTATGT	52	5	yes
GATCTCACCTACCTATCAGG	585	37	yes
GATCCAAGGAGCTGGGGAGG	51	14	yes
GATCCAAGGACAAGACACCA	7	7	yes
GATCTCACAGTTAGTAGTCA	84	15	yes
GATCTCACAGGACTGGATGT	10	9	yes
GATCGAGTGTATCACGCAGG	4	4	yes
GATCTCAAGCGCTTTGCTCT	150	39	yes
GATCTCAAGCAAGTCAGAAG	86	30	yes
GATCCAGCAAATCGGGACAG	25	9	yes
GATCTCAAAGTGGCTGATGC	38	7	yes
GATCTCAAAGGGAAACTGAC	47	2	yes
GATCTCAAAGGAACTTCTCC	8	7	yes
GATCTCAAAGCCATTGATAG	8	1	yes
GATCAAACCCTGGTGCTGAA	1	1	yes
GATCCTAAAAGGGCCAAAGC	28	6	yes
GATCCCTTACAAGATGGTCT	5	1	yes
GATCCCTGCTCAAGCTGCTG	5	4	yes
GATCCAACTGACTGGCTAGC	427	6	yes
GATCCAACTGACAGATGAGG	39	2	yes
GATCCAACTCTGTAAAGGCT	10	1	yes
GATCCAACTCAGTTAGGCTT	5	1	yes
GATCCAACTCACCCCATCAG	98	16	yes
GATCCAACGCAGCACCGTCT	72	6	yes
GATCCAACCCCCTCTCCTGA	14	5	yes
GATCGAGCCAAGAGCTGTAA	60	14	yes
GATCGAGCAGGCCCGGCTGC	55	1	yes
GATCTCAAACCTGCACTACA	43	39	yes
GATCTATTTGGTAACCAAAG	5	0	yes
GATCCAAAGACGCTAGATGT	64	8	yes
GATCTATTCTCCCACTGGAC	5	4	yes
GATCCAAACGTCACAGAATT	34	8	yes
GATCCAGACCCTTCCCAGAA	22	5	yes
GATCTATGTCATGGCCACGC	166	7	yes
GATCTATGGAGGACGGCAGA	15	14	yes
GATCTATGAGTTCAAAGCCA	4	3	yes
GATCTATGAGACAGAACTGG	92	2	yes
GATCTAGTATTCAGGGCGGA	122	30	yes
GATCCAAAAGCCCAACCTTA	4	3	yes
GATCCAAAAAACTTGTGGTG	1	1	yes
GATCCACTTGCGTTGTGAGC	12	13	yes
GATCTAGCCTTATGCCCGGG	11	1	yes
GATCTACTTGTGTGTGTGTG	209	10	yes
GATCTACTTGCTACCAGTCT	36	6	yes
GATCTACTGGGGCTGGGCCA	118	70	yes
GATCCACTCCAGGGCTTGGA	24	8	yes
GATCTACTCCTTCAGAGCCT	151	36	yes
GATCTACTACCAGACAGACA	50	3	yes
GATCCACGGGGTGACTTCCA	8	2	yes
GATCTACGGTTCCCACGCAT	291	58	yes
GATCTACGGCCTGGACTTCT	66	10	yes
GATCTACGGCCCCTGGAACC	13	11	yes
GATCATTTCGGGTGACTTAA	42	0	yes
GATCATTGTTCTTAGTTGCA	3	3	yes
GATCCTGTGCCACAGTCACA	3	2	yes
GATCTACCTGTTCTCCCTGC	2	2	yes
GATCCTGTCTCTGGCAACCC	16	7	yes
GATCTACCTACCCGTGGTGT	51	14	yes
GATCTACCTAAAAGCAACAG	12	1	yes
GATCTACCAGGTGGACACCC	157	34	yes
GATCTACAGGGCACAGAGGG	22	20	yes
GATCTACAGGACCCGCCCCT	8	7	yes
GATCTACAGCGTGCCCTGGA	40	6	yes
GATCTACAGCACTGCCTTTC	31	5	yes
GATCCACCAGCGTGTGCATG	36	14	yes
GATCCATGCTGAGTAAACAT	3	1	yes
GATCCAGGGTGAGTTCTTAA	3	1	yes
GATCATGACGAGATGGTGAT	7	2	yes
GATCTGCTGTCTTCTGCTGC	6	1	yes
GATCACCTCCATTGTTGTCC	2	0	yes
GATCAGTACCTAGCGCCCAC	10	9	yes
GATCATTCTGAAGTACATTG	9	2	yes
GATCATTCCAAGTTTCACGT	38	5	yes
GATCTACAAAACACAGGGAG	8	7	yes
GATCTAATAGGACTTCTGTT	25	1	yes
GATCCACACTGGCGAGAAGC	4	4	yes
GATCCACACAATGGAGACCT	103	12	yes
GATCTAAATCTTTCCTCAGC	9	3	yes
GATCTAAACTGTGGTGTGAA	73	1	yes
GATCTATTACCTGGTTGTAG	1	1	yes
GATCTGTCCTGCCTTGTTCC	4	4	yes
GATCCGAACCATCGCTGCCA	4	3	yes
GATCCAGAGGAGAAACTAAG	3	3	yes
GATCTAGTCCTCCCGTTCAT	30	4	yes
GATCTAGTATTTCCGTCTCA	3	3	yes
GATCCTGAGTGTGGTTCCCA	8	3	yes
GATCGGCACTGGCATGAAGG	1	1	yes
GATCGTTGTGAGCCACCATG	5	1	yes
GATCGTTGTCGCCGCGTCTT	31	5	yes
GATCGTTGGATACTCACAGA	55	21	yes
GATCGTTCCAAAGCCGGAAG	14	12	yes
GATCGTGTTGGGACTTTGAC	24	6	yes
GATCGTGTGGAGTGAAAGGC	60	14	yes
GATCGTGTCCGGCATGAAGT	1447	76	yes
GATCGTGTAGCAGGGTAAGG	4	4	yes
GATCCAAGGGGAGAGTCAAG	7	1	yes
GATCCAAGGGCGCACGAAGA	23	21	yes
GATCGTGGTGCAAGGAGAGC	303	11	yes
GATCTAGACTACTCCTTTCT	2	2	yes
GATCACATCACAGCCAGGTA	5	2	yes
GATCATGGTTGCCTGTCTGG	1	1	yes
GATCGTGGTCCAGAGGAGCA	3	3	yes
GATCCAAGGCGGCGACCCGA	179	23	yes
GATCGTGGGAGTGGCAAGCG	11	1	yes
GATCCAAGGACTGCGGTGCA	18	20	yes
GATCGTGGCACCTCCGGGCT	21	19	yes
GATCCAAGAGGCTGTTTTCG	25	1	yes
GATCGTGAGGCGGCTGGACC	28	7	yes
GATCGTGAGGATGGAGAAGG	35	8	yes
GATCGTGACGGCACTGACGT	24	5	yes
GATCGTGAAGCCGCTGAATC	59	1	yes
GATCGTGAAGCACCTGAATT	18	16	yes
GATCGTCTCCGTGCTGGTGA	1	1	yes
GATCGTCTCAGTTACGAGGC	13	11	yes
GATCGTCGTGCAGGCCACAG	3	3	yes
GATCGTCACCACAGTGGGAA	3	3	yes
GATCGTCAAGTGGTCAGATG	31	11	yes
GATCGTATCCCCAGGCGTGG	55	3	yes
GATCGTAGTAGTTCCTGTTG	10	2	yes
GATCGTAGAACTTGTTGCTG	33	11	yes
GATCGTACGGCTGTAACAGG	82	3	yes
GATCCAACCATGACCAGGTG	12	7	yes
GATCAAGCTTGGCTAGTCTG	10	3	yes
GATCGGTGTCGAGCACGGAC	89	9	yes
GATCTAAGCTTGAGAGAAGG	7	4	yes
GATCAAGAACCAACATGTCC	3	1	yes
GATCGTGGTCATCCATGAGG	13	6	yes
GATCGTGGCAGCCGGTGTGG	7	3	yes
GATCCGCTACCCTGGTGCTG	34	6	yes
GATCCGCCTGGTCCAGCGCC	7	7	yes
GATCCTAGCTGGGCAGTAGT	41	3	yes
GATCCGACCTTTGTTGGCCT	15	8	yes
GATCAAACCTACCAGCCGGT	4379	451	yes
GATCGTATCCTCCATCAGCC	1	1	yes
GATCTATGTGCTGGGGGGAC	46	9	yes
GATCAGAGAAACCGTCTCCC	6	5	yes
GATCAGTCTTTTCAGTATTT	19	2	yes
GATCAGTCGTAAAGGACTCA	11	5	yes
GATCAGTCCTCTAGCATTTC	308	6	yes
GATCTTGGCTGACTACGGCA	3	2	yes
GATCAGTCCTACAAAGTTCC	37	4	yes
GATCAGTCCCTTCCCCCAAC	97	21	yes
GATCAGTCATCAAAGAACAC	2	2	yes
GATCAGTCAGCCTTACCTTC	16	3	yes
GATCAGTCACCACTGGCACT	4	4	yes
GATCAGTCACAGGCAAACTC	7	2	yes
GATCAGTATGGCCCTCATGT	33	30	yes
GATCGGCTGCTTTTGTCTCT	63	18	yes
GATCGCTAAGCCTGTGAGGC	6	5	yes
GATCGCCTGCATCTTCAAGG	4	1	yes
GATCAGTAGGAAGCACAGGT	394	98	yes
GATCAGTACTGCAGTTCCTG	63	5	yes
GATCAGTACTCTAGGGGCTC	23	21	yes
GATCGGCGACTCCATTTTCT	4	1	yes
GATCAGTACTACTGTGGTGT	34	13	yes
GATCAGGTTTGGACTCCTTC	61	11	yes
GATCAGGTTTGCACCAAGGT	76	1	yes
GATCAGGTTCTGCCACATCT	32	2	yes
GATCAGGTGTTCAAAGTCAC	7	6	yes
GATCAGGTGTCAGTTTTCTA	115	8	yes
GATCTGCGATGAACTGGGAG	1033	53	yes
GATCGCCAACTCGCTGGCCA	4	0	yes
GATCGCATTTCATGTGTGTG	10	11	yes
GATCGCATCATACGTGAGGT	52	1	yes
GATCCATTTGGAGCTTACTC	6	2	yes
GATCAGGTGAAGACCCTCTC	26	24	yes
GATCAGGTCAGAGATGCGGT	109	15	yes
GATCAGGTAGAGAGAGCTTG	121	28	yes
GATCAGGTAAAGAAGCGTTT	11	10	yes
GATCAGGGTGTGTGCCCACG	26	4	yes
GATCAGGGTGGAATGTGCCT	26	24	yes
GATCAGGGTCCTCCTTCCCT	32	1	yes
GATCAGGGGGAAGGGGTCAG	14	12	yes
GATCAGGGCGTGGTAGAGAA	79	12	yes
GATCAGGGCCGTGTGGATGC	121	5	yes
GATCAGGGCCGAGTGATGAG	18	12	yes
GATCAGGGCCCATTAGTGAG	15	14	yes
GATCAGGGCCAGGGGAGGTC	345	58	yes
GATCAGGGCCAAGGCATCCC	14	4	yes
GATCAGGGCAGAGATGGAAG	89	10	yes
GATCAGGGCAAGAGGATTGT	98	15	yes
GATCAGGGCAAAGTGGCTTT	5	1	yes
GATCAGGGACTCTTCGGTGT	5	5	yes
GATCAGGGACCTCACAAGTC	13	11	yes
GATCAGGGACCACGAACAGA	379	89	yes
GATCAGGGAAGTTCATTGTG	117	14	yes
GATCCTCCTTGGAAGAGAAG	2	2	yes
GATCAGGACATCTGTGGCCC	1	1	yes
GATCAGGCTTGGCACATGAC	15	14	yes
GATCAGGCTGTTGTGTGTGA	38	15	yes
GATCAGGCTGAGCTGAATGT	31	3	yes
GATCAGGCTACTACAAAGTT	1059	51	yes
GATCCAAACACACACTAGGA	412	41	yes
GATCAGGCGACAGTGAAGAT	59	9	yes
GATCAGGCCTGAACCCGTCC	142	4	yes
GATCAGGCCCACAGCCGAGT	41	10	yes
GATCAGGCCATCAAGTCACA	187	14	yes
GATCAGGCCATACGTAGCCT	70	17	yes
GATCAGGCCAAACACTTGGG	965	87	yes
GATCAGGATGGGACAGTTCC	56	0	yes
GATCAGGAGTTTAAGTGGTT	4	3	yes
GATCAGGAGTTCCAGGACAG	22	12	yes
GATCAGGAGTTACTATCCAG	36	0	yes
GATCAGGAGTCCTTTGAGTG	26	5	yes
GATCCTTCTCCCATACCCAG	12	3	yes
GATCCTGATGACGTTCGGAT	1	1	yes
GATCAGGAGGGTCTATTTCC	24	22	yes
GATCAGGAGGGTCAGCTGTG	30	4	yes
GATCAGGAGGCTGTCCCTAA	9	3	yes
GATCAGGAGGCAGTGTGTGG	68	19	yes
GATCAGGAGGAGAAAGTGAG	7	6	yes
GATCAGGAGCTGGCATTGGC	348	32	yes
GATCAGGAGCCCATTGGTGA	60	21	yes
GATCTTTCTCAAGAGCAGTG	39	6	yes
GATCAGGAGCCAGGGAGCTA	331	15	yes
GATCAGGAGCACCTGTGGCT	141	21	yes
GATCAGGACTTGGTGGAAGC	30	8	yes
GATCAGGACTCCTGTGACTC	34	2	yes
GATCAGGACGGAACTCTGTG	42	17	yes
GATCAGGACCTCATTTCACG	19	17	yes
GATCAGGACAAAGAAATACC	48	1	yes
GATCAGGAATGTGTGCAGCA	124	25	yes
GATCAGGAAGATGGTAGCCT	55	50	yes
GATCAGGAAGATGACTGGCA	116	12	yes
GATCAGGAAGATGAACACTT	3	3	yes
GATCAGGAACTCCAGTTCAT	14	13	yes
GATCAGGAAAGTTGTGGAAG	29	11	yes
GATCAGGAAAGAAATGGAGC	230	77	yes
GATCAGCGGTGGGAATGACA	1876	149	yes
GATCAGCGCTATTTCCTGAG	71	13	yes
GATCAGCGCCTCCAGTTCCT	280	37	yes
GATCAGCACTGACCAGGGCA	4	1	yes
GATCAGCGATTTATTAGTAG	4	4	yes
GATCAGCCTTTTCTGTCTTG	79	0	yes
GATCAGCCTTCAGTTCATTT	13	4	yes
GATCAGCCTGGGCCACCTTG	122	10	yes
GATCAGCCTGCTCCTGGGGC	65	12	yes
GATCAGCCTCCATCCGCTCA	52	22	yes
GATCAGCCGTTCCTCTGGTG	113	6	yes
GATCAGCCGCTCAAGATTCT	751	20	yes
GATCAGCCCTAATCCTCTGG	8	0	yes
GATCAGCCCGACTGTCTGCT	10	0	yes
GATCAGCCCATCCACTCTTT	90	16	yes
GATCAGCCCAGCCCATGTGA	270	34	yes
GATCAGCCCACTCAGCCTAA	14	13	yes
GATCAGCCATTTCTTGGGGT	23	2	yes
GATCAGCCAGTTGACTTGGA	14	16	yes
GATCTCTGACCTCCTCCCCA	4	1	yes
GATCAGCCACTTAGAATTCA	4	3	yes
GATCCTCCATGCTGCTGTCC	7	7	yes
GATCAGCCACAAGATTTCAT	64	9	yes
GATCAGCCAAGGGTTCAGAG	2371	541	yes
GATCAGCATTCTTGAGCTGG	146	30	yes
GATCAGCATGGTTGTTCTTC	30	1	yes
GATCAGCATGGGCACACAGC	32	30	yes
GATCAGCATGCCTGTCCTGC	1	1	yes
GATCAGCATAGTTGTAGATT	11	6	yes
GATCAGCAGTGTCGGCCATT	292	22	yes
GATCAGCAGTGCCTTGTGTT	133	2	yes
GATCAGCAGTCTTCAGCTCT	30	2	yes
GATCAGCAGGAACCCCACCT	25	5	yes
GATCAGCAGCCTACGACCTT	55	0	yes
GATCAGCAGAGTGGTTATGG	63	7	yes
GATCAGCACTTGCCTGGAAA	46	8	yes
GATCAGCACTCTGCCTCCAA	50	10	yes
GATCAGCACTAAGACTGCTA	64	3	yes
GATCAGCACCTTGAAGAAGT	32	8	yes
GATCAGCACCTCTCCAAGAA	17	16	yes
GATCAGCACAGGGTCAACTA	37	5	yes
GATCAGCACAGACACCATTT	125	0	yes
GATCAGCAAGTGACATTGAT	41	12	yes
GATCAGCAAGTCAGGAGTCA	110	5	yes
GATCAGCAAAGGGGCTAATC	160	147	yes
GATCTATGGGGCGCCACACC	10	9	yes
GATCATCCCGCGGGACCTCT	2129	62	yes
GATCAAAGAGCCAGGAATGG	5	1	yes
GATCTTGGACAAGTTACAGT	2	2	yes
GATCTTGCTTCTTCCTCTCC	9	0	yes
GATCAGATTTGTCCACAAGG	62	6	yes
GATCAGATTTGGTCTATCGG	36	6	yes
GATCAGATTGTCTCTGTTCT	31	3	yes
GATCTAGTCCTTGTCTGGTA	2	2	yes
GATCAGATTAGTCAGCCAGG	16	15	yes
GATCAGATGCATCTGACCAA	8	7	yes
GATCAGATGAGGGTGTGAGA	3	2	yes
GATCAGAGTTCTTTTGTACC	9	8	yes
GATCTGCCAGGCTTCGCTTG	2	2	yes
GATCAGAGTGTGTCCTGCTT	21	4	yes
GATCAGAGTGTGGAAACTAA	5	1	yes
GATCAGAGTCGCCCTCCCAT	40	9	yes
GATCAGAGTCCACCTTTACC	27	6	yes
GATCAGAGTATTCCTGCCAG	14	5	yes
GATCAGAGGTTCAGAATATC	25	0	yes
GATCAGAGGTTAGGACGTGA	41	6	yes
GATCAGAGGTGTGTGCAATC	7	1	yes
GATCCCTATGAGTTCAAGGC	7	0	yes
GATCCCCAGAGACAGAACTT	38	3	yes
GATCGCCCCCACTCAGGTCA	7	7	yes
GATCGAGGAAAAAGTGCGGA	15	2	yes
GATCAGAGGTGTGCACCACC	13	11	yes
GATCAGAGGCTGTGACTCAA	8	7	yes
GATCAGAGGCTCCCAACTGG	138	24	yes
GATCAGAGGCATTAACGTTT	2	2	yes
GATCAGAGGATGCGGAGCTA	85	27	yes
GATCAGAGGAGACTTCCTCG	59	5	yes
GATCAGAGCTCCAGGCTTGG	32	10	yes
GATCAGAGCCGAACCTACTT	34	10	yes
GATCAGAGCCAAGAAACGCC	272	15	yes
GATCAGAGATGGGCAGCCTA	37	33	yes
GATCAGAGAGTGTCAACTTA	24	6	yes
GATCAGAGAGAGAGAGTTTC	37	6	yes
GATCAGAGACAAGTTCATTA	18	2	yes
GATCAGAGAACGGAAGAAGC	34	31	yes
GATCAGACTGGTGAGAAAGC	40	5	yes
GATCAGACCTGTGGCTGAGT	96	7	yes
GATCAGACCTGGGCGTGAAA	27	11	yes
GATCAGACCGTTGGGTGGAC	7	1	yes
GATCAGACCCAAAGAAAAGT	50	9	yes
GATCAGACCATTGAAACCAC	52	6	yes
GATCAGACACTGACTGGTGA	154	1	yes
GATCAGACACTCCCTCACCA	61	5	yes
GATCAGACAAAGCCTCTCAA	43	24	yes
GATCGCACGTGCAATGTCAT	115	9	yes
GATCAGAATTCCAAGGACTA	4	4	yes
GATCAGAATGAACTTGCCAA	26	6	yes
GATCTCGTCAGGGCACTGCG	5	5	yes
GATCATTTCATCGCCAAGGA	14	8	yes
GATCAGCTCCTCTCGTCTGA	91	44	yes
GATCCAAGGCCTCCACGTCT	17	3	yes
GATCCAAGGAAGAGCCCATG	6	0	yes
GATCAGACTCCCTCCCATGG	41	38	yes
GATCACAGGCTACCTGTTAA	28	16	yes
GATCAGGAGTTCGGGGCTAG	2	2	yes
GATCAGCAGTGATGATGGCT	5	4	yes
GATCCTAGACTTGTATGGCA	4	4	yes
GATCCTAATTGCTTAGGTTT	10	9	yes
GATCCGTCGCCACTGGGGAG	3840	429	yes
GATCAGTAGTTGCATAGGGA	28	26	yes
GATCTCAGAGAGTGACAAAT	8	7	yes
GATCTTGTCAACTTCACCAA	30	6	yes
GATCAGAGCGAGCAGAGGTC	1	1	yes
GATCCCTTCCCCACCTAGCT	39	4	yes
GATCTCAACTCTGTGCTCTG	2	2	yes
GATCTGCTGATTTCTGAAGA	2	2	yes
GATCCTTGGAACCCACAGGT	3	3	yes
GATCACTTGGATACCCCTGC	2	2	yes
GATCTGCAGCACGTAGACAG	3	3	yes
GATCTGGCCATCCCAGGGGG	13	4	yes
GATCCAGGAGTTCCAAGAAG	26	24	yes
GATCCAGACCTCTGGCTTGC	16	3	yes
GATCCACTCCCCCTCCCTTT	2	2	yes
GATCTCCTGGGAGAGCTGAT	30	7	yes
GATCGTAAACTACTTGAGCT	70	2	yes
GATCGGCGCCTCCGGAGTAC	83	6	yes
GATCACTGAAAGCCAGGCAC	9	2	yes
GATCACTCTTTCTCTCAGGT	17	4	yes
GATCACTAGTAAAACCGTCT	2	2	yes
GATCATTCTGGTTTCAGAAC	24	1	yes
GATCAGTGGAAGCCTCTAAA	29	26	yes
GATCTGGGCTATGAGCCACT	34398	3144	yes
GATCCTTGAGAGGCAAGACG	80	5	yes
GATCAGCCATTAAGTCGTTG	2	2	yes
GATCAGGTGGAGTTGAAGGA	40	9	yes
GATCCTGGGTAGCATTTTAG	44	40	yes
GATCACCCCTCCCCATTCCA	19	17	yes
GATCCCTGCCTTACAATTGG	31	7	yes
GATCGGGTCAGTCACCTTTG	5	5	yes
GATCGGGCTGCCTGGCGTGG	44	2	yes
GATCCAAATGCCTTTCTTTT	4	1	yes
GATCGGGAACAGAAAGGGCG	41	46	yes
GATCGGCGTGTGGGCCAGGC	31	28	yes
GATCGGCGCTTTCAGACTAA	24	1	yes
GATCCTGAGAAACCTTTGAC	30	8	yes
GATCGCTGTTTAGGATGGCG	65	5	yes
GATCGCTGTGGCCGAAACTT	176	0	yes
GATCGCTGGGGAGTCGGGTC	100	23	yes
GATCCAAACTCAGGTCTTCT	1	1	yes
GATCCAAACTAAAGGCAGAG	29	1	yes
GATCCAAAAGGCAACAGGGA	14	12	yes
GATCACATAAAGCCATCCCT	63	4	yes
GATCACAGTGTACCCCACAC	2	2	yes
GATCACAGTCTGCATCCTAG	56	4	yes
GATCTTCAGTGGGTTTCTCG	14	2	yes
GATCGCTGAGCGGTGTGCAT	38	10	yes
GATCGCTCTCATTGCCCTTT	11	0	yes
GATCATTGGGACTGAGTGAA	16	3	yes
GATCGCTACCAAGCAGTTCT	131	35	yes
GATCGCGGACGGGCTGTGCC	28	25	yes
GATCGCCTTCTCCACCAATT	289	61	yes
GATCCTCAGGGCCTGAGCCT	30	7	yes