#ID_REF = Signature - 20 nt sequence including DpnII site (GATC)
#VALUE = Mean abundance for a signature derived from all MPSS runs for the sample, in transcripts per million (TPM)
#ST_DEV = Standard deviation of the mean abundance from multiple MPSS runs
#REP = Replication_global
ID_REF	VALUE	ST_DEV	REP
GATCCTCTCGTGGCTTCCTA	66	13	yes
GATCTGACACATCTGGAGTG	2	4	yes
GATCAGTGTGTGCCAAGGAG	753	52	yes
GATCAGTCAGTGACAACCAA	56	17	yes
GATCAAGAGGAAGCACAATA	67	26	yes
GATCAAGAGAAAGAAGTGGG	11	10	yes
GATCAGTAGAGCTTGGACCC	244	14	yes
GATCAGTACACGGTGTATGT	14	11	yes
GATCAAGACGCAGGTCGAGG	61	40	yes
GATCAGGCTCTTTGTTTGTG	72	6	yes
GATCTGGCCAACGGCAACAT	151	25	yes
GATCTGGCAGTCATAGCTTG	632	114	yes
GATCTGGCAACTGTGCGGGG	12	9	yes
GATCTGGCAAAAACTACGGG	100	69	yes
GATCTGGATTTGGTTGAGAT	44	19	yes
GATCTGGATGTGTGATAATC	7	8	yes
GATCTGGAGTTGGCTTGTGC	27	18	yes
GATCTGGAGTCTGGTGTGGC	351	142	yes
GATCTGGAGGGAGGGGCGGG	40	29	yes
GATCTGGAGAAGAATGGTCG	6	9	yes
GATCTGGACTGGTGTTTCTT	4	6	yes
GATCTGGACTCACCTGGGAG	410	27	yes
GATCTGGACGATTCTGAGCC	258	14	yes
GATCCTCCTTGGCTACAGTG	1	1	yes
GATCCTGTGTTTGAATGACA	28	41	yes
GATCAGGCCCACTCCAGGAG	47	30	yes
GATCAGGAGCAGTTGTTGCC	14	3	yes
GATCAGGAAGACACGGACTC	25	3	yes
GATCAGCCTACGCTCACATT	21	5	yes
GATCAAGAATGGACCAAGAT	17	13	yes
GATCAAGAAGTCGTCATTCA	6	6	yes
GATCAGACTGTTGCTTTCGC	91	8	yes
GATCAAGAAGAACAAGGATA	2	2	yes
GATCAGCACCAAGTGACTTG	28	19	yes
GATCAGACAGATTTTGTTCC	10	8	yes
GATCTGGACCAGGCTTGGAA	21	2	yes
GATCTGCTTTTTGAAATGAA	11	2	yes
GATCTGCTTTGTGCTTGGCT	35	8	yes
GATCTGCTTTGCTGTCGGTG	5	4	yes
GATCTGCTTTCTCAGGACTC	31	6	yes
GATCTGCTTTCCCTTTGTAA	105	23	yes
GATCTGCTTTCCATCGTGTC	13	6	yes
GATCTGCTTGTGTTGTGTTG	608	40	yes
GATCTGCTTGGCTGCCATTA	54	36	yes
GATCTGCTTGCCCCAAACAA	175	35	yes
GATCTCTACCACCCAGGTAC	26	17	yes
GATCTCGGACGCTCAGTGGG	189	7	yes
GATCTCGCTGGTTCGCACCT	107	18	yes
GATCTCGCTGCATTTACATA	62	2	yes
GATCTCGATTCTACAGTGGT	6	7	yes
GATCTCGAGCACTCTCGTCC	17	11	yes
GATCAGAAGTTCAAGCTCAT	6	6	yes
GATCAGAACCTTGCCGAAAC	12	6	yes
GATCAACGTGATGGACGCAC	29	19	yes
GATCTCCTTCCTGGCTGTAT	22	15	yes
GATCTCCTGGCCACTGTGGT	16	17	yes
GATCACTGTTTGTGCCTCTG	397	32	yes
GATCACTGTGTCCCAGGCTG	66	17	yes
GATCACTGACATCTATACCC	2	3	yes
GATCAGAATGGCGGAGGCGG	167	36	yes
GATCACAAGTGGAAAGCAAT	9	6	yes
GATCACTCTTCCCGCTGCTG	153	26	yes
GATCACTCTGGTCGTGTGGG	5	5	yes
GATCACTCTGGCAGTCAAAT	10	5	yes
GATCACTAAGAGGGAAAATG	3	5	yes
GATCACGCTGCTCCGACAGG	3	2	yes
GATCACCTGTGGAGTTGTCA	56	53	yes
GATCACCTGACTCCTAACCG	25	21	yes
GATCTCCTCTCTTCCCACGG	51	3	yes
GATCTCCTCTCCAGGGAGCT	136	95	yes
GATCTCCCTGTGCCGGTGCC	121	31	yes
GATCACCATATCAAGTTTTC	7	10	yes
GATCACCAGAAAGTTTGTTA	12	9	yes
GATCACATGGGTCGAGGGTT	27	4	yes
GATCACAGGGGAACTAATTC	8	10	yes
GATCACAGAGTGGGAATCTC	96	32	yes
GATCACAGAGACCAACATGA	30	32	yes
GATCTTGAAGAAGATGAGGC	6	7	yes
GATCAACACTCCCCACGATG	2	3	yes
GATCACACTGTCTGAGGCGT	26	9	yes
GATCACACTCTGGCCCCCAA	27	19	yes
GATCACACGCAGAATGAAGT	2	3	yes
GATCACACCAGAGTCCAGGT	55	4	yes
GATCACACAGGAGAGAGAAA	27	9	yes
GATCTCCAGGACTTGTGTGG	17	19	yes
GATCTCATCGAAACAAAGCT	179	32	yes
GATCTCAGTGGGTCACATAA	12	13	yes
GATCAAGGCTGCCTGGCTCT	25	17	yes
GATCAAGGACATCCATGTGC	96	9	yes
GATCAAATCCGACGACGAGG	40	17	yes
GATCAAGAGCAGTGCTGCTC	60	19	yes
GATCAAATCCATCCAGGCTG	4	5	yes
GATCAAAGTTCCCAGAAATG	8	5	yes
GATCGCTGCCAACATCCAGG	58	6	yes
GATCTCAGGGCAGAAATGAT	104	75	yes
GATCTCAGAGGCTCGGTATC	87	22	yes
GATCTCACGATGAGCTATGA	29	30	yes
GATCAAACCCAGGGCTTTGT	101	11	yes
GATCAAAATCAGGAAACGAT	3	5	yes
GATCACTTTATTTGCTAGGG	299	27	yes
GATCAAAGGAAATGGAGCCA	17	28	yes
GATCTCACTATGTATCCCTA	6	5	yes
GATCTCAAGTTGAACCGACT	41	36	yes
GATCAAAGCACTGGCGGGCT	15	11	yes
GATCGAGGATGTGAGGAAGT	1	1	yes
GATCAAAGAAGGCTGTTGAC	38	25	yes
GATCTTTTTCTCCATCTCTT	125	8	yes
GATCTTTTGGAACTGGAGTT	3	3	yes
GATCAAACGTGGCTGAGCGC	1678	133	yes
GATCAAACGTGGCTGAGCGA	28	47	yes
GATCCCAGCTTTGTGTGAAG	1	2	yes
GATCATCTTGTGAAAACCCA	658	155	yes
GATCAAACCTGAGGGCACAT	48	23	yes
GATCTTTTCCACCTTCAGAG	47	6	yes
GATCAAACCCGTGGAAGAGG	27	3	yes
GATCAAACAGGCTGTCAAGA	5	8	yes
GATCTTTTACTTCGTGGCTG	89	19	yes
GATCAAACACCTACTTCCAT	13	10	yes
GATCAAACACACACAAGCAT	28	6	yes
GATCAAAACCCATCAACACC	65	10	yes
GATCCAAGCCCGGGGCCCGC	32	53	yes
GATCTTTCTGGCAAGGAAAC	1383	17	yes
GATCCATTGACAGAGACAAC	6	4	yes
GATCCGGGCGTGGGGAGCTT	1	2	yes
GATCATCCAGAACACAGCCT	2046	316	yes
GATCCATTCACCTACGGCAA	32	21	yes
GATCGAATCCAGATGGGAAG	6	4	yes
GATCGAAGCCAGTGAAGGTG	29	3	yes
GATCTGCTCCAAGAAATGTC	6	6	yes
GATCCAGAAACACAAAAAGG	36	16	yes
GATCCTGATGCTGCCACGGA	76	18	yes
GATCTGCGCTTCCAGAGTGC	2890	257	yes
GATCCTGAGCATCCCCAGAA	14	13	yes
GATCCAGGGATGCTAAGTAG	10	8	yes
GATCCACTCAGCCGTGGTTT	3	5	yes
GATCCATGGAAGAGTTGACC	4	3	yes
GATCCTGAGCTTTCAAAAAG	7	6	yes
GATCCTGAGCCAGATGTCAT	76	8	yes
GATCCTGAGATGCAGCTCAT	10	7	yes
GATCCTGAGAGAAAACAGCA	17	11	yes
GATCCTGACTTTGCCAGCTG	12	4	yes
GATCCTGACTCTGACACTAC	65	13	yes
GATCCTGACCTGGGCTTCCT	62	17	yes
GATCCTGACCACATGAACAA	556	333	yes
GATCCTGACCAATGACAATA	3	3	yes
GATCCTGACAGTGCACCTAA	196	34	yes
GATCCTGACAGAGCCTTGGT	2035	207	yes
GATCCTGAATGTGGAAAAGA	55	18	yes
GATCCTGAATGACGTTCAGG	323	119	yes
GATCCTGAAGTGGCCTCAGC	29	10	yes
GATCCTGAAGGTCATCCGCA	73	39	yes
GATCCGCACCGGGTGGGGAA	21	6	yes
GATCCGATTTCTGTGTCTGA	3	5	yes
GATCCTGAAGAACTTTGTCA	20	6	yes
GATCCTGAACGAGAGCCTGC	1	1	yes
GATCCTGAAAGCCAAGTTAG	278	46	yes
GATCCTGAAACTGACTCGCT	17	3	yes
GATCCTCTTTGCCAACCCCA	59	42	yes
GATCCTCTTTGCACAGAAGA	81	21	yes
GATCCTCTTTCACGCTTCTT	29	7	yes
GATCCTCTTGTTCCACGATG	24	6	yes
GATCCTCTTGTCCACTCCAC	13	11	yes
GATCCTCTTGCTGCAGCTTC	67	10	yes
GATCCTCTTGCGGGACAGTC	41	8	yes
GATCCTCTTGATTCCTTCTG	115	15	yes
GATCCTCTTGATGCAGAGAG	18	12	yes
GATCCTCTTCTTCCTCGTGA	85	23	yes
GATCCTCTTCTTCAGCACAC	591	93	yes
GATCCTCTTCTGCTGTTCTG	1	2	yes
GATCCTCTTCCTGCTCCAGC	116	98	yes
GATCCTCTTCCCATCCATCC	27	5	yes
GATCCTCTTCATCTTGGGCA	738	33	yes
GATCCTCTGTTGGGGCCTCG	82	29	yes
GATCCTCTGTTGCGTATTCT	14	12	yes
GATCCTCTGTGCCTCACTCC	138	17	yes
GATCCTCTGGAAAGGCAGCA	2	4	yes
GATCCTCTGCTTTAAGTCCT	14	11	yes
GATCCTCTGCACCAGAAGAA	22	33	yes
GATCCTCTGAGGCAGTATTG	50	46	yes
GATCCACCCCTTAAGAACCA	64	6	yes
GATCCGAGAGCTTTGTGTGG	2	3	yes
GATCAAGAAATGTCCTCTGT	3	2	yes
GATCCCCGCCCTGCCCCCGC	92	11	yes
GATCCTCTGAATGTTTTCCC	1249	172	yes
GATCCTCTCTTGTGCTACCT	43	31	yes
GATCCTCTCTGAACCTCCTG	304	69	yes
GATCCTCTCTCGGTGTGGTT	91	8	yes
GATCCTCTCATTCAGTCTTC	2	2	yes
GATCCTCTAGGGGTTATGGG	745	141	yes
GATCCTCGTGCCTGTCTCCC	278	67	yes
GATCCTCGGGCAAGCCAAGA	2114	702	yes
GATCCTCGGGAGACCACTGG	123	37	yes
GATCCTCGGGAATTTTTACC	62	16	yes
GATCCTCGCAGCTTCTATGA	285	77	yes
GATCCTCGAGTGAGGACGAC	19	16	yes
GATCCTCGACAGGAAGCCAC	21	19	yes
GATCCTCCTTGTCAAGTACA	230	43	yes
GATCCGCCTGCTTCTGCCTC	10	8	yes
GATCCCTTGGAACTAGATTT	10	6	yes
GATCTGAGCTGAATTTGAAG	4	6	yes
GATCAACAGCGGAGTGTGTG	56	9	yes
GATCCTCCTGCCCCTCCAAT	41	28	yes
GATCCTCCTGCCCCGACAAG	176	21	yes
GATCCTCCTGAGTGCTGGGA	107	33	yes
GATCCTCCTCCTGTGTTTCT	6	6	yes
GATCCTCCTCAGACTTGTCC	16	17	yes
GATCCTCCGTGAGTATGCCT	192	47	yes
GATCGTTTAGTTCTCTGTTT	7	3	yes
GATCCTCCCCTTTACGGACA	96	76	yes
GATCCTCCCCCTCTCCCACC	10	15	yes
GATCCTCCCCAGGGATGGGG	123	49	yes
GATCCTCCCACAGGGACACT	48	39	yes
GATCCTCCCAAGTGAATGAC	231	47	yes
GATCCTCCAGTCAGTCTATT	40	16	yes
GATCCTCCAGGACAAGGGGT	86	20	yes
GATCCTCCAGCAGAGTGGAC	8	12	yes
GATCGCCCTCAAGGGCGGCA	42	16	yes
GATCCTCATCTTCATTCCTT	28	6	yes
GATCCTCATATGAGGACCAT	15	23	yes
GATCCTCAGTTACTCGCTGC	28	10	yes
GATCCTCAGTGGGTAAGTGC	23	35	yes
GATCCTCAGTGCTACTTGCG	34	9	yes
GATCCTCAGGGTCTGCCCTT	21	19	yes
GATCCTCAGGAGTTGCAATG	911	217	yes
GATCCTCAGGAAACAGTCTC	97	38	yes
GATCCTCAGCTGGCTGGAGC	148	37	yes
GATCCTCAGCTGCCCTGCCT	87	32	yes
GATCCTCAGCCCCAGATGCT	39	9	yes
GATCCTCAGCCACCCACAAC	34	9	yes
GATCCTCAGATTAGATGTTT	11	8	yes
GATCCTCAGAGACGTGCTCG	96	42	yes
GATCCTCAGAAGGTGAAGGA	34	13	yes
GATCCTCACCATCCACGTTT	54	38	yes
GATCCTCACCAGCCGCGGGC	993	133	yes
GATCCAGTGCCTGTGTAGAA	63	7	yes
GATCCAATGCGAGGTGGCCC	18	19	yes
GATCCCTGCTCTGCAATGAG	56	13	yes
GATCCAATCAATCTCCCCGA	41	7	yes
GATCCGAGGCTCCACCTGTC	2	2	yes
GATCCTCAACTCCTCCAAGG	22	33	yes
GATCCTCAACATTCCTCGAA	6	4	yes
GATCCTCAACATCCGCCTGC	155	15	yes
GATCCTCAACAAGATGCTAT	252	41	yes
GATCCTCAAACAGACATTGT	95	30	yes
GATCCTATTTTGGATGGTGA	2	2	yes
GATCCTATTCTTTGTCTTAT	13	1	yes
GATCCTATTCTTAGGTCTAA	13	10	yes
GATCCTATTCCAGCCAAATG	13	8	yes
GATCCTATTCAGTGGCACAA	33	22	yes
GATCCTATTAGCCAAACTTT	15	5	yes
GATCCTATGTGTTGGCCATT	48	7	yes
GATCCTATGTGGCTCTAAAA	80	22	yes
GATCCTATGGTGTCCACACT	12	9	yes
GATCCTATGGTGATTCCAGT	8	4	yes
GATCCTATGGCATATGCAAG	17	11	yes
GATCCTATCTCCCGGTTGGG	123	18	yes
GATCCTATCATTGCTGGTGG	140	15	yes
GATCCTATCACCAGCACTGA	34	28	yes
GATCCTATATTTCCTGCTGA	22	19	yes
GATCCTACTTTGGGAACATG	68	9	yes
GATCCTACTGTGGATGACAC	849	128	yes
GATCCTACTGATGAAGTGCC	242	43	yes
GATCCCTGAGGCTGCCTCGA	2	3	yes
GATCGCTAAAATCGTGGCGG	10	6	yes
GATCCAAGACACCAGCCCAA	32	10	yes
GATCCCTCTGCTGCTGCTTC	111	30	yes
GATCCAAGGGGTGGTAGGGC	4	4	yes
GATCCCTCTCCCAGGAACAA	6	8	yes
GATCCAAGCTGTCAAGAAGG	1245	110	yes
GATCCAAGCTCCATTGTACC	133	7	yes
GATCCCTCCGAGTGTATCCT	2	3	yes
GATCCAGCTCTGAGTGAGCC	5	5	yes
GATCACTTGTTTGTGGTGGG	55	71	yes
GATCCTACGGAGCAAGTCTA	25	6	yes
GATCCTACGACTCCCCGTGC	29	19	yes
GATCCTACCTTCTGCTTTCG	231	25	yes
GATCCTACCTGAGTGGCAGC	1057	247	yes
GATCCTACCATCCCTTTGAT	9	5	yes
GATCCTACATCCATTCGGCT	71	17	yes
GATCCTACAGTGGCTGGCAA	341	57	yes
GATCCTACAGTCACTTCACA	59	23	yes
GATCCTACACTCCTGGCAGT	21	3	yes
GATCCTACACATGGAGGCTG	129	35	yes
GATCCTACACACCTACCAGA	232	21	yes
GATCCTACACACAGTGGTGA	388	55	yes
GATCCTACAAGCCTGTCCGT	113	16	yes
GATCCTACAAAGGTCTTGAA	33	11	yes
GATCCTAAGTAGAATCAGAT	53	10	yes
GATCCTAAGCAGATTCTGGG	241	55	yes
GATCCTAAGAAAGAAAGCTG	22	10	yes
GATCCTAACTGTGGAACCTC	3	2	yes
GATCCTAACTCTGACCTTTC	202	25	yes
GATCCTAACTAAGCACATGA	54	3	yes
GATCCTAACCTAAGATGCCT	45	12	yes
GATCCTAACCCTGAACCCCA	38	26	yes
GATCCTAACCCAGTGGACTC	91	19	yes
GATCCCGTTGAAGCACGGTG	6	5	yes
GATCCCGTGTCCTGCAGACG	86	20	yes
GATCCCGTCTCAGCCACGTC	7	3	yes
GATCCAACACCGGCGGCCAG	3	2	yes
GATCAACAACAGCGGCCCCA	19	20	yes
GATCAAGGGGTCCAATCCAG	50	12	yes
GATCCTGTACAGAAACTCTT	5	5	yes
GATCCTAAATTTGACCCAGG	72	19	yes
GATCCTAAAGGCCGGTCACA	556	65	yes
GATCCTAAACTCTGTTGCCA	46	15	yes
GATCCTAAACTCCAAGGGGA	67	47	yes
GATCCTAAAACTGAGGAAAG	3	5	yes
GATCCTAAAACCAAGGGAAT	41	36	yes
GATCCGTGAGCTAGTTCTCT	2	4	yes
GATCCGTTTGGCCTCTCAAT	12	1	yes
GATCCGTTGTTTATGTGGAT	2	3	yes
GATCCGTTGGAAGGTTTACC	84	6	yes
GATCCGTTGCCTCCTTAAAG	39	58	yes
GATCCGTTGCCAGTTACCTG	328	123	yes
GATCCCCCTCGCCCCCCCCC	2	2	yes
GATCCGTTCCTAGGGTACCT	263	30	yes
GATCCGTGTGTTGTTAAGAT	6	4	yes
GATCCGTGTGTGTGTGGGAG	449	116	yes
GATCCCAGGCTTCTGGGGAC	2	1	yes
GATCCGTGTGAAGGTCCCAT	9	4	yes
GATCCGTGTGAAACTGGATG	1416	219	yes
GATCCGTGTATGTCTAAACA	53	12	yes
GATCCGTGGCTGCAGCAGAA	56	19	yes
GATCCGTGGAGAAACTTGCC	8	12	yes
GATCCCGGCTCAATCTCTGG	8	7	yes
GATCCAAAGGAGCTACTTAG	148	22	yes
GATCCTAGCCACCTTGAGGG	2	1	yes
GATCCCGGAAGGGGAGAAAG	87	8	yes
GATCCAAAACACACTGAGTT	7	1	yes
GATCCGTGCTGAGCGTCGGC	233	31	yes
GATCCGTGCTGAATTGGTTT	137	9	yes
GATCCGTGCATCTCATTGGC	97	2	yes
GATCCGTGCAGGAGTAATAC	6	6	yes
GATCCGTCTGTGGGGGCCTC	76	3	yes
GATCCGTCTGATGACAGTAG	1	1	yes
GATCCGTCGCCTGGAGGTGG	148	14	yes
GATCCGTCATCTCCAGGACA	30	45	yes
GATCCGTCAGTGGTCAGTGC	10	3	yes
GATCCGTCAGGCTTGCTCGT	21	10	yes
GATCCGTCAAGCTAACTGGA	22	16	yes
GATCCGTATCAGGTTCATGT	8	12	yes
GATCCGTAGTCTGAGTGATG	326	25	yes
GATCCGTACCCTGGTGCTGA	85	20	yes
GATCCGTAAGAAAGAGAAGG	70	71	yes
GATCCGGTTCTGGGACAGCA	18	23	yes
GATCCGGTCCCAAGACCGCT	1111	45	yes
GATCCGGTCCAAGGCTCTTG	86	12	yes
GATCCGGGTGTCCAGTGACA	415	81	yes
GATCCGGGTGATGCGAATCG	35	13	yes
GATCCGGGGGTTCAATTTAT	222	42	yes
GATCCGGGGCACACATTCTC	24	7	yes
GATCCGGGCAAAGCCTGCTC	464	29	yes
GATCCGGGAGGTGTGCGGCT	1869	351	yes
GATCCGGCTGGGCCTGGCTC	115	21	yes
GATCCAAAATGTTCCATGGA	14	11	yes
GATCCCCTGGTCTCTCCCGT	6	3	yes
GATCCAAAAAGCAGTTCAAC	97	2	yes
GATCATACTCTCTCTCATTA	3	2	yes
GATCCCCTCCGTTGGCCCGG	10	6	yes
GATCCACGTGCTGGACACGG	3	3	yes
GATCCGGCAGAAGGATGAGG	347	43	yes
GATCCGGATGAAACATTGTC	12	18	yes
GATCCGCTTGGCAGCCATTC	429	65	yes
GATCCGCTTCGTGGAATGGG	45	5	yes
GATCCGCTTACAGAGACTTT	404	72	yes
GATCCGCTGTCAGGAGCTGA	55	2	yes
GATCCTATTCTGTCACATTA	44	15	yes
GATCCGCTGCAACCCGGTGC	63	8	yes
GATCCGCTCTGTGGTCGCCT	224	30	yes
GATCCGCTCTGAGGTTCTGT	252	13	yes
GATCCGCTCTCTGCATCTGT	8	7	yes
GATCCGCTCCTGGCGACTCC	181	24	yes
GATCCGCTCAGAGCCCAGCA	288	34	yes
GATCCGCTCACGCCCAGCAG	407	37	yes
GATCCGCCTTCTACTCGGAA	27	4	yes
GATCCGCCGGCGGTCAGCGG	9	6	yes
GATCCGCCGCTAAGACCTGG	95	39	yes
GATCCGCCCTGTGAGTCACC	31	23	yes
GATCCGCCCACACCCACGTG	18	12	yes
GATCCGCCAAGTTATTCAGG	2	3	yes
GATCCGCCAAAAAAATGCAC	123	32	yes
GATCCGCATGATGGGAGGAG	32	5	yes
GATCCGCATCCGCAAGCCCT	257	27	yes
GATCCGCAGGTCAGATGACA	122	24	yes
GATCCGCAGCTTTTCCAGCA	203	14	yes
GATCCGCAATTATGAAGAAC	118	20	yes
GATCCGCAAGGTGCTGGACG	513	61	yes
GATCCGCAAGGACTTCTTAT	5	5	yes
GATCATTTCGGGCCAGTAGG	171	14	yes
GATCCAGACAGCCATCAAGG	63	14	yes
GATCCCCGAAGTCTCTCTCC	12	10	yes
GATCCCCCCGGAGTGTTCAG	4	4	yes
GATCTATGGGGCAGGGTTGG	85	27	yes
GATCTTGTGACAGTGTGTGT	56	9	yes
GATCCGCAACTGTCCGGAAG	83	13	yes
GATCCGATTTCTGATTTTGC	154	21	yes
GATCCGATTACAGATGGTGT	8	8	yes
GATCCGATGGGCCAGCCTTT	259	18	yes
GATCCTTTTATTTCACCGGG	13	11	yes
GATCCGATGAGGAAGATGAC	53	35	yes
GATCCGATGAAATTATTTCT	6	5	yes
GATCCGAGTGAAAGCCGGAG	1186	91	yes
GATCATCAGCGTATATGGGG	143	107	yes
GATCCGAGGCTAGAGGGAGC	120	12	yes
GATCCGAGGCAGATTTTCTT	46	3	yes
GATCCGAGCGACTGTCACCA	231	29	yes
GATCCGAGCAGCCACATTCC	32	21	yes
GATCCGACAGGAGGGTGTAA	279	31	yes
GATCCGAATTGCAGAGCTGT	67	9	yes
GATCCGAACTTCACCCTAAT	22	9	yes
GATCCACTGCAAATCAGTCT	24	8	yes
GATCTGCAAGGCCTAATTAC	17	19	yes
GATCACGCTGCCCCCGACTC	4	4	yes
GATCCCTCTCTAAGCCCCTT	17	13	yes
GATCACAGCTCCTGTGGCTG	7	2	yes
GATCGTTCCAAAGCCCGAAG	15	16	yes
GATCTGCTTCCTGAAGAGTG	49	7	yes
GATCTGCTTCCCATTGTGGT	248	23	yes
GATCTGCTTCCCAACTGTTA	9	11	yes
GATCTGCTTCCATCCATCTC	49	5	yes
GATCTGCTTCATTATTTCAC	27	5	yes
GATCCTTTGCTCTGCTTCAT	19	6	yes
GATCCTCAGCATGATGGACC	2	2	yes
GATCTGCTTATCCCATTTAG	70	48	yes
GATCGAGCGGCAGCGGCTGG	10	7	yes
GATCCTAGCTCAGAGAGGCT	247	19	yes
GATCTGCTGTTCCTCACGAA	42	12	yes
GATCTGCTGTAGCATCAAGC	47	1	yes
GATCTGCTGGTCATTAAGGG	792	31	yes
GATCTGCTGGCAGTAGTAGT	49	10	yes
GATCTGCTGGAAGATAATCT	56	5	yes
GATCTGCTGCCTGCTCCCAC	163	10	yes
GATCTGCTGCCAGGTTTTGC	15	13	yes
GATCTGCTGCAGGGTTCTGT	182	32	yes
GATCTGCTGATGTTACGTCG	8	6	yes
GATCTGCTGATGATGGAACA	5	8	yes
GATCTGCTGATATTCCGGGC	2	3	yes
GATCTGCTCTGATGGTATGT	1	2	yes
GATCCCCAACACCCACCCTC	37	2	yes
GATCCCAGGTTGGAGAAAGG	2	3	yes
GATCCTTCCCACTTCCCTAG	7	7	yes
GATCTGCTCTCAAAAATTCC	3	2	yes
GATCTGCTCCTTCTGTCCCA	221	41	yes
GATCTGCTCCTTAACGTTTT	18	14	yes
GATCTGCTCCTGGAGGTGGT	24	3	yes
GATCTGCTCCTGAGTGCTGT	4	6	yes
GATCTGCTCCCAAGTTATCT	34	8	yes
GATCTGCTCCAACTACAGGA	128	36	yes
GATCTGCTCAGTGACTTGTG	84	10	yes
GATCTGCTCACTCTATTACT	10	7	yes
GATCTGCTCAACAACTCCTT	2	3	yes
GATCTGCTATGTACTCCAGG	95	72	yes
GATCTGCTAGCAGAACTTGT	7	9	yes
GATCTGCTAGAGCTGTAATA	171	119	yes
GATCTGCTACTGGAGATGTT	43	15	yes
GATCTGCGTATGGCGGCCAT	1558	403	yes
GATCTGCGGTGACTTGATGT	1475	47	yes
GATCTGCGCTATAGAAAAAA	22	15	yes
GATCTGCGCCTGCCTTGTCT	273	9	yes
GATCTGCGCCTGAGCCAAAG	94	10	yes
GATCTGCCTTGGATTTCCTC	20	9	yes
GATCTGCCTGTTACCTCTTC	18	26	yes
GATCTGCCTGTCACTGTGGC	1	1	yes
GATCTGCCTGCCTCTGCCAC	6	7	yes
GATCTGCCTCAGGAAAAATA	122	17	yes
GATCCCAACATGAAATACGA	5	5	yes
GATCCTGTGGAAAAATGAAA	1	2	yes
GATCCTGCAGCACGTTATCG	44	12	yes
GATCTGCCGCAGTAAGCGAG	10	3	yes
GATCTGCCCTTTCTGGGTGA	166	15	yes
GATCTGCCCTTGCACCCGGC	10	7	yes
GATCTGCCCGAAGCCATGAG	61	2	yes
GATCTGCCCCATGGTGTTTT	8	6	yes
GATCTGCCCAATCCTTCCTC	88	16	yes
GATCTGCCATTCCCATCTGT	1	2	yes
GATCTGCCAGTTTTGGTGCC	80	19	yes
GATCTGCCAGTCCGAGGTTC	481	54	yes
GATCTGCCAGTAGTTCTGTA	9	7	yes
GATCTGCCAGGACAAGCTGG	29	2	yes
GATCTGCCACTTGTTTTAAT	83	37	yes
GATCTGCCACTGCTTCTCTA	29	7	yes
GATCTGCCACAGCAAGAGTG	29	6	yes
GATCTGCCACACAGTAGACT	128	42	yes
GATCTGATTGCCTTCATGGA	44	29	yes
GATCTGATGTTCTCTTCTGG	53	15	yes
GATCGGTCTGAGATGACTCA	7	12	yes
GATCAGTTCATCCACATAGA	6	9	yes
GATCTGATGTCAGTCGTGGT	3	2	yes
GATCTGATGTATGCCAAGCG	153	27	yes
GATCTGATGGTGGGGTGGCA	54	42	yes
GATCTGATGAATAAAGGAGG	15	23	yes
GATCTCAAAACCAAAACCAC	96	15	yes
GATCGCCATGCTCCTCTTCT	114	134	yes
GATCTATCGGCCTCTGCCTC	71	11	yes
GATCTATCCTAGCCGGGAGG	1240	202	yes
GATCAGTCTCCATCAGACTT	22	7	yes
GATCTGAGTGGGTGGGGGGT	75	52	yes
GATCTGAGTCCTCACACTGG	18	23	yes
GATCTGAGGGTTGATTGACA	17	12	yes
GATCTGAGGCCTTGTTTTTT	19	24	yes
GATCTGAGGAGCAGATGATG	35	16	yes
GATCTGAGCTTTGTATAACA	4	7	yes
GATCTGAGCTGCCCTCTGCT	35	3	yes
GATCTGAGCCTCCACCTGTG	64	42	yes
GATCTCAAAACCTTGCACAG	21	22	yes
GATCTACTCCCGGGCCCAGC	25	18	yes
GATCCTTCAGGCTCTGGCTT	3	2	yes
GATCTTTGCCAAAATGTGTG	81	5	yes
GATCTATGGATTTTGAGGAG	54	52	yes
GATCTTTCTACATCCCTGGG	12	13	yes
GATCTTTCGGAGGAGATGTC	68	7	yes
GATCTATACAGTCGGGAAAC	470	91	yes
GATCTGAGCCCCACTGTTCC	13	9	yes
GATCTGAGCCCAGATGGAAG	18	7	yes
GATCTGAGCATAGCGTCAGA	8	10	yes
GATCTGAGCATAGAAGAAGG	4	3	yes
GATCTGAGCAGGTGAAAAGT	120	11	yes
GATCTGAGAGCCGTGGTGCC	11	12	yes
GATCTTACTGTAGTTTAGGA	29	20	yes
GATCTGAGACCCTCCCTGAT	109	57	yes
GATCTGAGAAGATGTGGATG	4	7	yes
GATCTGACTGTAGCCTTTTC	10	11	yes
GATCTGACCTCGGAGTGTGC	66	43	yes
GATCTGACCGAGAACTGAAC	8	8	yes
GATCTGACCAACAAGACCAC	124	51	yes
GATCCCCTGGGAATGTAGGG	53	15	yes
GATCGTGACTGACTGCAGAC	2	1	yes
GATCTACCGTGCAGGGACTG	90	21	yes
GATCTACCGTAATGGCTCCA	14	15	yes
GATCTACCACCCTAACATCG	28	30	yes
GATCCTGGCACCTGATATCC	3	3	yes
GATCTTTCCAGAAGGTCTTC	27	29	yes
GATCTACACATGGGGCAACC	1676	102	yes
GATCACTGACTGCCCCAAAC	9	6	yes
GATCTACAATGAAGCTCTGA	37	40	yes
GATCTAGCTTCCTGGGAGAC	25	19	yes
GATCTTTACAAGTCTGGCAC	21	23	yes
GATCTTGTTGAGTCTGAGGC	1	2	yes
GATCTGAATTTCTTCCTCTT	56	13	yes
GATCTGAATTTCACAAGAAG	9	8	yes
GATCTGAATGTCCGAGAGAG	485	49	yes
GATCTGAATGCTCTGGGGGC	23	34	yes
GATCTGAAGTCTGAATGGCA	31	25	yes
GATCTGAAGTATCTGTACAG	7	9	yes
GATCTGAAGCTGCTGATGAA	46	32	yes
GATCTGAAGATTTCCCTATC	149	11	yes
GATCTGAACTCCAGAGAACA	101	8	yes
GATCTCTTTTGCCAAGAAGT	41	8	yes
GATCTCTTTGTGTTCAAGAC	16	10	yes
GATCTAATTGCAGTGGTTAA	66	9	yes
GATCTACGCACGCATCAGCA	54	13	yes
GATCTACCGTGCACACCCAG	2	2	yes
GATCTACCCTGACTCAGGTT	82	7	yes
GATCACTACAGTGAAGTATT	3	5	yes
GATCTTGTATTCTCTGGCTT	62	13	yes
GATCTTGTACAAACCGGTTT	94	9	yes
GATCTTGGTTTTGAGTTCTT	32	23	yes
GATCTCTTTGTCCTCCCAAT	2	2	yes
GATCTCTTTGCTTTGAAACT	47	12	yes
GATCTCTTTGCCCTTGCACT	2	4	yes
GATCTCTTTCTTGTTCCCCC	303	33	yes
GATCTCTTTCTGAGACCTTT	49	11	yes
GATCTCTTGTGAAACGAAAC	28	30	yes
GATCTCTTCCATGTTACAAG	10	15	yes
GATCTCTTCAGCTCTGCCAA	5	5	yes
GATCTCTTCACTGTTTTTCT	85	20	yes
GATCTTGGGGAGTTTGACTG	63	6	yes
GATCTTGGCTCTGTGGAATG	537	13	yes
GATCTAACTGTCCACATTGG	8	8	yes
GATCTTGCTTTGTGACTTTT	68	18	yes
GATCTCTTACCAGTTTACAA	5	5	yes
GATCTCTGTGTTCAGGCTCT	10	7	yes
GATCTCTGTGGGCCTTTGGG	36	27	yes
GATCTCTGTGCTGGCGCCTG	114	79	yes
GATCTCTGTGAGTTTGAGGG	33	56	yes
GATCTCTGTGAGCTTGAAGC	5	5	yes
GATCCCTCAGAAGTTTTGAC	40	4	yes
GATCAGTGCAGCCCGGTCTT	3	3	yes
GATCTAACTCCTGTTGCTCT	64	5	yes
GATCTTGCTTCAGCCAACGC	1679	63	yes
GATCGTGATTGTGCTGGGCG	217	321	yes
GATCTTGCTCTTCCTCTCTG	2	3	yes
GATCTTGCGTGTTCTGTCCG	8	6	yes
GATCTTGCCCCTGCCAGTGG	146	76	yes
GATCACCTTTTTTGACGAGT	3	2	yes
GATCTTGCAGGACGTTCTCT	17	11	yes
GATCTTGCAAAAGGACCATT	4	7	yes
GATCACGTCTATGACCGGCT	13	9	yes
GATCACTGTCAACACTGTCA	1	1	yes
GATCGTCTGCTGTGAAACGT	111	14	yes
GATCACCTTCTGAAGATTCC	1	1	yes
GATCGTCCCCAAAATTGCCT	47	11	yes
GATCGTCCAGAGTCACTCAA	73	13	yes
GATCGTACGGGGCTGGAAAC	79	27	yes
GATCACATGAGCCTCCAAAT	11	2	yes
GATCTTGACCTTATCCAGTC	10	11	yes
GATCGGTGGGACCCGGGCGA	1045	118	yes
GATCGTGGGCTTCAGCACCC	61	23	yes
GATCTTGAAGTCTTTCTTGA	17	15	yes
GATCGTGGATGAGTTTACTC	5	8	yes
GATCTTGTTTCTCTCTTCTT	2	3	yes
GATCGGTCTGAGATGACTCC	106	10	yes
GATCACACTGAAGATGCCTC	98	6	yes
GATCGGCTTTGAGAGAGGGT	101	34	yes
GATCGGCGTGGCAGCTGTGG	10	11	yes
GATCTTCTCCCTGGGTTACT	13	9	yes
GATCTTCGAGACTTTGTTAG	19	20	yes
GATCGGCAAGCTGGAAGGCT	15	25	yes
GATCAGTTGACAGTGGCAAT	648	39	yes
GATCACCAGCCTTTTGCAAA	6	8	yes
GATCGGCGGGAAATGGCGGA	147	5	yes
GATCTTGAAAGAACTCAGAG	107	32	yes
GATCGGCGCCGTGAGATTCG	93	8	yes
GATCAGTGACTAAGTGCAGA	36	10	yes
GATCAGGTTCAGCGTCCTCT	5	3	yes
GATCGCTCATTGGAACAGCT	1229	152	yes
GATCCGCTGCCGCCCCCTGC	1	1	yes
GATCTTCCCAACAGTGCTGC	7	8	yes
GATCGCCGAGCCAGCGCCGG	34	17	yes
GATCGCCCTTGCTGGTCTGC	93	6	yes
GATCAACCCCAGGGCTCCTC	9	6	yes
GATCTTCCAAGTCTCTCATT	5	5	yes
GATCGGAGAACCGAACTTGC	2	2	yes
GATCTTCAGGTGGCCAAGTG	3	5	yes
GATCGTGGCGCCCACGCTTG	42	30	yes
GATCGTGACGGGGATGGAGA	5	3	yes
GATCAACATCCTCTTCTGAC	5	5	yes
GATCTGACTCCCTCTTCGGG	1	1	yes
GATCTTCAGCCTCTTGGGGA	38	27	yes
GATCTTCACTCACGTCCGGC	19	13	yes
GATCGCCTGCTAGTGCGGGA	33	6	yes
GATCTTCACCCTATCCAGTC	22	19	yes
GATCTTCACACACAGCAGAT	46	32	yes
GATCTTCACAAGTTTGGGGC	6	7	yes
GATCAGAGAATAAAGCCCTA	6	11	yes
GATCTGTTGGTGCTGCTACT	8	5	yes
GATCTCTTTTCAGAAGTGTC	83	12	yes
GATCCCTGTGGGTCGGCTGT	4	7	yes
GATCAGGGATGCAGTACCAC	8	13	yes
GATCATGTTCACAACGCAGG	51	38	yes
GATCATGTGGAGCTTACCTT	3	4	yes
GATCCCTTTTCCATTCTGGA	146	17	yes
GATCCCTTTGGGGTGTGGAA	718	77	yes
GATCTACAGGAGTGGTGATA	6	7	yes
GATCCCTTTCTCTGGCCCAG	1047	67	yes
GATCCCTTTCCACCTAAAAC	23	7	yes
GATCCCTTGTGAGCCCTAGT	200	38	yes
GATCCCTTGTCATGGTTTGG	4	4	yes
GATCCCTTGTAGCCAGAGTT	332	85	yes
GATCCCTTGGGCAAGTATCA	236	51	yes
GATCCCTTGCTTGCCTCTTG	130	15	yes
GATCCCTTGCTTCAACCTCC	278	20	yes
GATCCCTTGCTACATCTCCT	191	46	yes
GATCCCTTGCCTCCTGAGTT	79	19	yes
GATCCCTTGCATTTGCAACA	3	4	yes
GATCCCTTGCAGTTCTGTGC	137	18	yes
GATCCCTTGCACACAGCCCA	564	146	yes
GATCCCTTCTGCTCTACCTC	32	13	yes
GATCCCTTCCTTTGAAGTGA	133	9	yes
GATCCCTTCCTGCCCTCTTT	578	60	yes
GATCCCTTCCCCAGCGGTTC	117	15	yes
GATCCCTTCCAGCTGAGCCC	111	23	yes
GATCCCTTCCAAATCTGCTC	111	19	yes
GATCCCTTAGGTGTAGGTCC	70	20	yes
GATCCCTGTTTGGACATCAG	4	2	yes
GATCCCTGTTCCCCTGAGAA	32	12	yes
GATCCCTGTGTTCTACATGG	22	15	yes
GATCCCTGTGGTCACTTAGC	44	22	yes
GATCCCTGTGGATTTTGAAA	33	23	yes
GATCCCTGTCTGATTTCTGA	4	3	yes
GATCCCTGTCTCGGGAGGTC	17	5	yes
GATCCCTGTCTAGTCCCTGT	108	22	yes
GATCCCTGTCCTTTCTGTTT	17	14	yes
GATCCCTGTCCCCCTACCCC	95	72	yes
GATCATGGGTTGGGAGCTCA	100	27	yes
GATCATGGGCAAAAAGCCCG	344	236	yes
GATCCACTGAGAGCTTTGGA	2	3	yes
GATCCCTGTACACTATGTCT	63	5	yes
GATCCCTGGTTGCATCTTCG	3	3	yes
GATCCCTGGTGGCTGCCCTT	595	172	yes
GATCCCTGGGTGCCAGTTTT	93	21	yes
GATCCCTGGGTCTCCTTTGA	28	21	yes
GATCCCTGGGGTCCACTTTC	51	18	yes
GATCCCTGGGGGCTGTGATG	299	32	yes
GATCCCTGGGGCTGCCTGTC	733	96	yes
GATCCCTGGGGCATGTTGTA	278	34	yes
GATCCCTGGGGAGCCTGCGG	3	4	yes
GATCCCTGGGAGGATATGAG	10	7	yes
GATCCCTGGGAACGAAGCTG	1	2	yes
GATCCCTGGCTCAGTGAACA	7	10	yes
GATCCCTGGCGTCCCTATCA	218	44	yes
GATCCCTGGCCCCTGTGCCA	107	23	yes
GATCCCTGGCCAGAAGTACA	36	5	yes
GATCCCTGGCACTGCTGCCT	50	54	yes
GATCCCTGGCACCCAGCATC	32	3	yes
GATCCCTGGAGTGACCAGAG	2742	160	yes
GATCCCTGGAGTCTCTGAAG	19	28	yes
GATCCCTGGAGGCTGGAGAG	29	9	yes
GATCCCTGGACTGGAACAAA	1	2	yes
GATCCCTGGAAGCTGTGATG	8	2	yes
GATCCCTGGAAGCAGGGACA	521	56	yes
GATCCCTGGAACAGAGTTAT	6	4	yes
GATCCCTGCTTTTGTGGCCT	940	115	yes
GATCCCTGCTTGCCCCGCAC	1	2	yes
GATCCCTGCTTCCTGCCCAG	127	8	yes
GATCCCTGCTCTTAGGTGCT	90	14	yes
GATCCCTGCTCTGGACCCTC	358	55	yes
GATCCCTGCTCCCCTCTGGG	132	7	yes
GATCCCTGCTCCAGGTCCTC	108	11	yes
GATCCCTGCTAATGGAAGAA	69	13	yes
GATCCCTGCCTGTGGGGGGT	158	9	yes
GATCCCTGCCTGTCCTGAAA	44	19	yes
GATCCCTGCCTCGTCTGCCT	95	2	yes
GATCCCTGCCGAGGTGCTCA	544	20	yes
GATCCCAGGGACTCTGTTTT	80	22	yes
GATCATGGCTTTGAGGCCAG	6	8	yes
GATCATGGCGGTCAGCAGAA	14	11	yes
GATCATGGCAGTGGGAGACC	3	5	yes
GATCATGGCAGGGATACGCA	48	7	yes
GATCATGGCAGGCCTTTAAC	146	48	yes
GATCTTGATGCGGGTGGAAC	220	31	yes
GATCCCAGAGTGCTTGATGC	1	1	yes
GATCCCTGCCCTTTGGCCTG	94	1	yes
GATCCCTGCCCATGCTGTTC	51	14	yes
GATCCCTGCCACCTCATTGG	148	37	yes
GATCCCTGCATTTCCTCAAG	307	30	yes
GATCCCTGCATAGGACTGTT	35	14	yes
GATCCCTGCAGTACCATCTG	386	24	yes
GATCCCTGCAGGTCGCTCAG	189	131	yes
GATCCCTGCAGCTGGGCGAG	38	6	yes
GATCCCTGCAGCGCTGTTTG	651	105	yes
GATCCCTGCAGAGGCTTCCA	9	11	yes
GATCCCTGCAGAAGGGGGGT	79	16	yes
GATCCCTGCACAAGGTGTTT	107	3	yes
GATCCCTGCAACAGCAAGGG	36	24	yes
GATCCCTGAGTTTACCAGCG	86	20	yes
GATCCCTGAGTTCAAGGCTA	82	33	yes
GATCCCTGAGTTCAAGGCCA	33	25	yes
GATCCCTGAGTAAACTTCTT	40	14	yes
GATCCCTGAGGTCTCCTGCC	108	26	yes
GATCCCTGACATAGCAGGAC	32	24	yes
GATCCCTGAATAGAAATTGG	2	2	yes
GATCCCTCTTCTGGTGTGTC	59	7	yes
GATCCCTCTTACCTGCAACG	511	70	yes
GATCCCTCTGTACAGCATCC	8	5	yes
GATCCCTCTGGTGACTCCAC	80	14	yes
GATCCCTCTGGGTCATGTCT	300	79	yes
GATCCCTCTGAACCGCCGAG	45	13	yes
GATCCCTCTCTTTTCCTTCT	6	4	yes
GATCCCTCTCTTCAATGATG	33	5	yes
GATCCCTCTCTCTGGGGAAT	10	2	yes
GATCCCTCTAAGCCCCCTCC	55	4	yes
GATCCCACTTCTGCGTCTTA	126	25	yes
GATCAACCGATGAGCATGGT	2	2	yes
GATCCCTCGGTGACCACATT	366	32	yes
GATCCCTCGACGGCCAAGCC	395	54	yes
GATCCCTCCTTGTGAGCAGC	147	23	yes
GATCCCTCCTGTCACTGCAG	14	3	yes
GATCCCTCCTGGGCATTGCT	115	12	yes
GATCCCTCCTCAGGCATCTG	1663	82	yes
GATCCCTCCCTTGGGCCTCC	339	74	yes
GATCCCTCCCTCCGAGGCCA	752	89	yes
GATCCCTCCCCTCCCTGGCT	92	3	yes
GATCCCTCCCCACCCTGCTC	38	13	yes
GATCCCTCCCAGAAACCTGC	4171	526	yes
GATCCCTCCCACTCTGGCTC	12	12	yes
GATCCCTCCAGCCTCTACTG	3	3	yes
GATCCCTCCAGACACCAAGG	149	17	yes
GATCCCTCCACAAGATTCTG	65	11	yes
GATCCCTCAGGGTGTGTGCC	37	13	yes
GATCCCTCAGGAACAGAGGG	792	99	yes
GATCCCTCACCTCCTTCATC	210	15	yes
GATCCCTATGCTGACCCCAA	24	19	yes
GATCCCTAGTGGCCCATCAT	65	18	yes
GATCCCTAGGGAGAAGGTGG	237	9	yes
GATCCCTAGCCCCATCCCAA	25	18	yes
GATCCCTAGCATTCTGTACT	175	16	yes
GATCCCTAGAGCCAGCACAT	113	8	yes
GATCCCTACTGCACCACCTT	263	60	yes
GATCCCTACTCGTTTCAACA	31	14	yes
GATCCCTACTATTGATTCTG	288	25	yes
GATCCCTACTACGTGCTGGA	2713	166	yes
GATCCCTACCTACAACCCTA	216	50	yes
GATCCCTACCCCACATGCTG	106	10	yes
GATCCCTACCCATGGGAATG	40	28	yes
GATCTTCGGTGCCACCGGCA	7	9	yes
GATCATGACATTGTAGCCAG	10	7	yes
GATCATGACAGTCCCCCCAC	43	30	yes
GATCCCAAGTGGCACTGTTT	30	2	yes
GATCCCAAGACGACACATGG	1	2	yes
GATCCCTACCCATGGACCCT	291	21	yes
GATCCCTAATGAGAGCAGAG	81	8	yes
GATCCCTAAAGAAAGACTTC	2	3	yes
GATCCCTAAACTACCTCTTG	29	5	yes
GATCCCGTGGCTTGTGGAAG	1	2	yes
GATCCCGTGGACTGTTTGCT	25	11	yes
GATCCCGTCCTTGAAAGTAG	33	9	yes
GATCCCGTCCAAGGAGCATC	516	33	yes
GATCCCGCGAGGCCCGGAAG	1483	151	yes
GATCCCGCCTGCCCAGCTGA	305	25	yes
GATCCCGCCGTTCCACCCTC	36	7	yes
GATCCCGCCCACCCAAAGCT	49	11	yes
GATCCCGCCAAAAGAATTAC	260	19	yes
GATCCCGCACATCCACAAGT	259	26	yes
GATCCCGAGATTGCCAGCCT	1071	56	yes
GATCATCTGCTAGGGTGTGG	14	9	yes
GATCCACAAACTTCCTGACA	49	6	yes
GATCCCAAACCGGCTCCCGA	28	10	yes
GATCCTGAGAACTTCAGGCT	32	27	yes
GATCATCGCTCTGGTTTTGG	8	8	yes
GATCCGTGACCGGCTACTGG	7	10	yes
GATCCCGACACCAAGGAGAT	2642	246	yes
GATCCCGAAAACCAGAACTT	36	11	yes
GATCCCCTTTTTGAACAGGT	218	9	yes
GATCCCCTTTACCTTCTGGG	793	85	yes
GATCCCCTTGGTTGCTGGAT	65	22	yes
GATCCCCTTCTCAGGGTCTA	389	10	yes
GATCCCCTTCCTACCTCTAG	72	55	yes
GATCCCCTTAGCTGATGAAT	4	1	yes
GATCCCCTGTTGACTTACAA	87	18	yes
GATCCCCTGTATATGTTGAA	114	36	yes
GATCCCCTGGGTTGAGAGAT	73	11	yes
GATCCCCTGGGGCAAGCTGC	240	5	yes
GATCCCCTGGGAGGAGACAG	194	12	yes
GATCCCCTGGCAAGAAGGAA	6	5	yes
GATCCCCTGGATACATGGTC	71	11	yes
GATCCCCTGGATAAAAGCGT	80	15	yes
GATCCCCTGCTACACTGATG	61	5	yes
GATCCCCTGCCTCAGCTCCT	263	49	yes
GATCCCCTGCCCCCCAACCA	27	6	yes
GATCCCCTGAGATGGAATTA	97	8	yes
GATCCCCTCTTCCCAAATAA	62	8	yes
GATCCCCTCTGTGGGTATGA	2	3	yes
GATCCCCTCTGGGCCTCCGA	199	20	yes
GATCCCCTCTCCTGCCCACA	4	7	yes
GATCCCCTCGGACCCCCTTG	1213	87	yes
GATCCCCTCCTTTCTGCCTG	84	16	yes
GATCCCCTCCTCCAGGCAGT	106	16	yes
GATCCCCTCCCTTGCTTTCT	74	13	yes
GATCCCCTCCCAGGCTGTCC	13	6	yes
GATCCCCTCCCACAGAATAG	3195	183	yes
GATCCCCTCACATGTGCTAT	451	33	yes
GATCCCCTATGGGGAGGAGG	442	32	yes
GATCCCCTATGCAAGCTGTG	148	30	yes
GATCCCCGTTGTACCTGGTG	49	8	yes
GATCCCCGTGTGTTTGCAGG	167	57	yes
GATCCCCGTGGTCTCATGAA	1	1	yes
GATCCCCGTGCCCCTGCCTA	712	67	yes
GATCTTTCTCTAGGGGGTCC	68	9	yes
GATCATCCCCTGGCAAAGGC	10	8	yes
GATCTTCACTGCAGATGTGG	66	46	yes
GATCCATCTGCCTTCTCCAG	2	2	yes
GATCAAACTGAATGAAACAC	25	10	yes
GATCCCCGTCTGTGTCTGTG	576	42	yes
GATCCCCGGTGCTCTTCGTG	458	69	yes
GATCCCCGGGAAAGTGTAGT	62	12	yes
GATCCCCGCAGAATCAGGAA	114	14	yes
GATCCCCGCAAAGTGAGCGA	17	1	yes
GATCCCCCTTTGCTGCCTCC	36	2	yes
GATCCCCCTGATGGAGAGAA	40	7	yes
GATCCCCCTCCCTGCTCTCA	8	6	yes
GATCCCCCTCCCCCGCTGGC	55	82	yes
GATCCCCCTCCCCCCAGTGG	2754	374	yes
GATCCCCCCCTTTTTTTGTC	149	15	yes
GATCCCCCCCAGCACACTCT	38	14	yes
GATCCCCCCACCCCACCACC	706	117	yes
GATCCCCCCAACTGTGTGCC	13	3	yes
GATCCCCCAGGTCTCAGAGG	310	20	yes
GATCCCCCAGGGAAAGACTT	22	14	yes
GATCCCCCACCTCCTCGGCC	29	18	yes
GATCCCCCACATCCTGGGGC	293	44	yes
GATCCCCATTTGCAGTAAGA	106	19	yes
GATCATCACCTGACCCACTT	2	2	yes
GATCCATCCTGGAAGCAGAA	3	3	yes
GATCCATCCACCTTCAATGT	90	13	yes
GATCATATGGGTGATTCAGT	17	6	yes
GATCCCCATGTTGAGCTCTG	732	47	yes
GATCCCCATCTGCAGTACAA	130	9	yes
GATCCCCATCTGACTCAGTA	30	9	yes
GATCCCCAGTCTTTAGTCCC	416	40	yes
GATCCCCAGTATGCAGTAAT	23	1	yes
GATCCCCAGGGGCTCCCGGT	104	22	yes
GATCCCCAGGGAGGGAATGT	1	2	yes
GATCCCCAGGAGATGAGGTC	22	2	yes
GATCCCCAGCCTTGGATAGT	269	24	yes
GATCCCCAGCATTAGGCCAT	3	3	yes
GATCCCCAGCAGTAACACTT	44	13	yes
GATCCCCAGCACAGGAAGGC	64	13	yes
GATCCCCAGAGTCCCCTGTG	380	26	yes
GATCCCCAGAGCCTTGGGGA	28	2	yes
GATCCCCACTGTGCCTTTTT	55	10	yes
GATCCCCACCAGCCACCCCC	859	135	yes
GATCCCCACAGCTGCGTATG	420	4	yes
GATCCCCAAGTCTGTGACAC	285	61	yes
GATCCCCAAGAGTCCCCCAA	34	24	yes
GATCCCCAAGAACAACTTGC	2	3	yes
GATCCAAACATTCCAAGAAA	4	3	yes
GATCCCCAACAATGTGAAGA	856	82	yes
GATCCCCAAAGGGCAGGTCC	7	10	yes
GATCCCCAAAGCCTGGAGCC	487	41	yes
GATCATGCTTTCTTCTTTAT	7	10	yes
GATCCCTTTACAATGCATTG	2	3	yes
GATCATACCCACGTTGCCCA	17	6	yes
GATCATAAGTTCAAGGTCTT	73	5	yes
GATCACCCAGGCACCGGCAA	6	7	yes
GATCCAGTCCAAGCTGGGTC	22	7	yes
GATCCCCAAAAGGGTTAAAA	3	2	yes
GATCCCATTTTTGACAGCAA	63	24	yes
GATCCCATTTCACAGGTGTA	3	0	yes
GATCCCATTGGAGCTCTGTT	43	7	yes
GATCCCATGTTCAAGCTGGT	989	166	yes
GATCCCATGTGTCTTTTTGC	65	16	yes
GATCCCATGTGTCTCCCCCA	324	80	yes
GATCCCATGTGCCACCATCA	270	92	yes
GATCCCATGTCCTGCTTTCT	4	4	yes
GATCCCTGCCCTCAAGGTGG	7	5	yes
GATCCCATGCTTTGAAAAAT	83	3	yes
GATCCCATGCTAGCCTCTTG	497	7	yes
GATCCCATGCCTGGAATTTG	62	28	yes
GATCCCATGCAGAGCGGCCT	237	24	yes
GATCCCATGATGGAAATATT	72	15	yes
GATCCCATGAATCATTTGCC	243	16	yes
GATCCCATGAAATCCCCAAA	27	19	yes
GATCCCATCTTCAGAGCTTA	58	10	yes
GATCCCATCTCCTGGAAGGA	98	5	yes
GATCCCATATCCCTGTGAAA	31	7	yes
GATCCCATACCTGACATGAC	54	20	yes
GATCCCAGTTTGCTTCATGA	46	11	yes
GATCAGTTACTTACCCACTC	47	7	yes
GATCAGTTACACTGGGTCTG	5	3	yes
GATCCAAACTTCTACAGCAA	46	20	yes
GATCAGTGGGTGCCCGTGAT	37	40	yes
GATCCAGGGGGTGTGGCTGC	4	4	yes
GATCAAGGCCACGGGGAGGA	106	14	yes
GATCCCAGTTCATAATGAAC	14	22	yes
GATCCCAGTGTTGCTACGTG	122	8	yes
GATCCCAGTGTGAATCATGG	171	38	yes
GATCCCAGTGGTATTCCGCC	208	3	yes
GATCCCAGTGGATGAAGTGT	84	13	yes
GATCCCAGTGCTGTGGAAGT	124	22	yes
GATCCCAGTGCTGGTCAGTT	416	48	yes
GATCCCAGTGAGATGCTGGT	113	14	yes
GATCCCAGTGAAGGGTTTCT	134	20	yes
GATCCCAGTCTGAGTGATTA	198	38	yes
GATCCCAGTCCTCCTGGGCA	7	5	yes
GATCCCAGTCCGAAATGGGG	20	4	yes
GATCCCAGTACTTGGGAGGC	54	6	yes
GATCCCAGTAATGTAAACAA	1	1	yes
GATCCCAGGTGTCCCCATTT	118	6	yes
GATCCCAGGTGGAGCAACCC	332	24	yes
GATCCCAGGTCCCTCTGGGA	531	114	yes
GATCCCAGGGTTTTCTTGGT	17	6	yes
GATCCCAGGGGTCCTAGGGG	175	29	yes
GATCCCAGGGGCTCTTCTGC	99	21	yes
GATCCCAGGGAAAGTGCTAT	617	83	yes
GATCCCAGGCTCCACCAGCG	44	7	yes
GATCCCAGGCTAGCAAGCAA	362	40	yes
GATCCCAGGCGTCAAGCTCG	74	19	yes
GATCCCAGGCAAGGGATGGT	676	29	yes
GATCCCAGGAGTCAAGCTCT	45	16	yes
GATCCCAGGAGAGAGGCTTC	81	12	yes
GATCCCAGGAAGGACCATCA	102	15	yes
GATCCCAGGAAAGTTCTAAT	87	30	yes
GATCCCAGCTGGAGAAGCCC	33	26	yes
GATCCCAGCTATGATGTAGC	150	25	yes
GATCCTCTTTGACTTCACGT	473	57	yes
GATCCCTGTCTCCAGCTAAG	6	6	yes
GATCCTAGAAGGACAGCTTT	29	19	yes
GATCGAATCCGGACACCGTC	5	6	yes
GATCCTCACCTCAGTTTGGT	25	6	yes
GATCTCTGTCTTTCCCTGGT	240	14	yes
GATCTCTGTCACATCCGATG	219	100	yes
GATCTCTGTATGTTCGAGCC	26	45	yes
GATCTCTGTAAACAGTTTGG	58	40	yes
GATCTCTGGCCTGTGGAGTA	167	14	yes
GATCTCTGGCCAGGCAAGTT	80	7	yes
GATCTCTGGAGGTCCCGGTG	7	8	yes
GATCTCTGCTGTGGGAAAGG	1966	289	yes
GATCTCTGCTGTCGGTTTCT	1	2	yes
GATCCCCTCCTGAAGGACGC	4	6	yes
GATCTCTGCCCAAACCAGGC	776	38	yes
GATCTCTGCCACCCACCCAC	95	14	yes
GATCTCTGCCAATATGTTGG	4	7	yes
GATCTCTGCAGCTGGAGTCT	21	27	yes
GATCCAGAAAATAGCAAGTT	3	2	yes
GATCCGAGTGTCCCCTCTGC	32	17	yes
GATCCCTGGGGGTGGGGAGG	32	4	yes
GATCACAGTCTAGGTCTAGG	12	13	yes
GATCTCTGCAAGCAGTTGTC	82	57	yes
GATCTCTGAGTTCCATGCCA	18	19	yes
GATCAAAAGGTAAAGGCCAG	35	23	yes
GATCTCTGACTGTGACCTTC	5	5	yes
GATCTCTCTTGTTGGAAGGA	97	29	yes
GATCTCTCTTCCCAGAGGAA	789	74	yes
GATCTCTCTGGAACTATCTA	34	36	yes
GATCTCTCTCCTTGGCCTTC	136	16	yes
GATCTCTCTCATTCAACTTT	69	3	yes
GATCCGCCCCAGTGGGAACC	11	2	yes
GATCTCTCGTGTGCCTTTGG	17	18	yes
GATCTCTCGAGCAGCAGCAG	59	39	yes
GATCTCTCCCGTTCTCAGCA	4	3	yes
GATCTCTCCATATCAAGCGA	4555	328	yes
GATCTCTCAGGCCAGGATTT	19	12	yes
GATCTCTCACTGGACCAGCG	31	8	yes
GATCTCTCAAATCTTGGATT	17	12	yes
GATCTGACTCTAGAGCAAGC	2	3	yes
GATCCCAGTGGCATCATCGG	2	2	yes
GATCAAGATAACGGTGGCTT	366	32	yes
GATCTCTACTTTGGAGTCCT	21	14	yes
GATCTCTACTGGCAGGCCAT	64	44	yes
GATCTCTACTGCTGTTAGGT	66	46	yes
GATCTCTACTCCCAGGAGAT	134	33	yes
GATCACGTGTACTATTTCCT	70	10	yes
GATCTCTACCACCCAGGTAG	499	66	yes
GATCTCGTTTTTCAAAAGCA	3	5	yes
GATCTCGTTCATTGGCAAAA	47	21	yes
GATCTCGTGCAACTGTTGTC	494	55	yes
GATCTCGGTCTGTGCCGGGG	321	42	yes
GATCTCGGCCTCACAAATCC	17	5	yes
GATCTCGGAGTCCTGGCCCC	34	36	yes
GATCTCCTTTGTGAATGGTG	7	9	yes
GATCTCCTTTCCGGAAGCAA	222	20	yes
GATCCATGAGAATGAGAAGC	3	2	yes
GATCTCCTTGGAGTCTCAAG	210	145	yes
GATCTCCTTCCTTAGGTTAT	4	6	yes
GATCTCCTGTGAACACCACA	1	2	yes
GATCTCCTGGAAGCTAGCAG	19	24	yes
GATCTCCTCTTCGGGGTTCT	20	15	yes
GATCTCCTCGCTGGAAAAAG	22	20	yes
GATCTCCTCCTTGCTTTCCT	145	16	yes
GATCTCCTCCTTATTCCCCA	614	57	yes
GATCTCCTCAGAGAAGTCTG	86	61	yes
GATCTCCTCAACCAGTGTGT	33	23	yes
GATCTCCGTCCCTCAGCTCC	447	73	yes
GATCGCAGAGAGGCGAGAGC	274	21	yes
GATCTTACTTAGCATGCACA	6	7	yes
GATCTCCGCACTGTGTGTAC	398	41	yes
GATCTCCCTTTGTACTGTCT	38	9	yes
GATCTCCCTCGTGCAGTGGC	109	76	yes
GATCTCCCGTGTTACCAATG	17	18	yes
GATCCTTTCAACTCAAAAGC	164	30	yes
GATCCTTGGTGTAGCTTCTG	285	61	yes
GATCTTATTGCCAAGTTCCT	17	14	yes
GATCTTAGGCAAGTTCTTGG	14	15	yes
GATCTTAGCAGTCGTTCTTT	12	16	yes
GATCTTAGAGAAAGGCCAAC	164	45	yes
GATCGCAGCACTGAAAACAA	7	10	yes
GATCCCTCAGGAACAGGCTG	7	6	yes
GATCTCCATCGTGCAGGGAT	247	3	yes
GATCTCCAGTCCAAGGCTTC	15	11	yes
GATCTCCAGTAACCTTTGTC	3	5	yes
GATCTCCAGCTTCTCTGCCT	9	7	yes
GATCTCCAGCACAGCAGAGG	60	12	yes
GATCTCCAGACCGTTCCACT	1	2	yes
GATCTCCACTTTCTACAACA	144	3	yes
GATCTCCACTCTCCCTCTGG	28	8	yes
GATCTCCACGGGTGCTTAGT	29	20	yes
GATCTCCACATCCTAACCCT	1	1	yes
GATCTCCACAGGCCAGCCTT	156	32	yes
GATCTCCACAGCGTGTTCAT	10	2	yes
GATCTCCACACAACAGGTGA	187	30	yes
GATCTCCAATGTTGTGCTAA	33	24	yes
GATCTCCAACTTTGAAAGGC	66	46	yes
GATCTCCAACATTTTGGAGG	43	64	yes
GATCTCATTTTAACATCCAC	33	23	yes
GATCTCATTTCTAGTTTCCA	52	7	yes
GATCACAGCAGTAAATGTGA	384	6	yes
GATCACAGCAGCTGAGCTGT	481	65	yes
GATCACAGATTTAAGGGGAG	40	33	yes
GATCACAGATTGCTTCTCTG	51	13	yes
GATCACAGAGTGGTTACTGG	56	8	yes
GATCACAGAGGGACACACTA	28	30	yes
GATCCCCCACCCCTGCCCAC	10	7	yes
GATCACAGACTTCGGCCTTG	12	13	yes
GATCACAGACTGTTGGCCCC	81	25	yes
GATCACAGACACCTGCACTG	121	60	yes
GATCACAGAAGTGAGCGGAT	91	61	yes
GATCCTTCTGCAGACACCGA	29	20	yes
GATCCTTCTGACTTGGCTTT	2	2	yes
GATCCTTCTCAGAAGAGTCT	48	16	yes
GATCACACTTCCCACAACCC	139	15	yes
GATCACAGGGAGCCTGTGTT	171	9	yes
GATCCTTTGTGAACGTGAGC	2	3	yes
GATCTTAAATGGCGTAGTAT	180	38	yes
GATCACAGCAGAGATGGCCA	74	22	yes
GATCTGTTTCCCTTCTGTTC	5	5	yes
GATCTCATTGTTCTTGGAGA	55	5	yes
GATCTCATTCTTTCATGGAT	9	10	yes
GATCTCATTCCGGATGAAGC	52	4	yes
GATCTCATTCCCGAGAGAGG	79	27	yes
GATCTCATGTTCCTTTACAC	25	4	yes
GATCTCATGTGTGGGAACCA	48	4	yes
GATCTCATGTCTCTGGAGGA	10	13	yes
GATCCCCTTGGGCCCAACTG	11	17	yes
GATCTCATGGAAAATGAAAC	1	1	yes
GATCTCATCCTCTCACCTCC	11	7	yes
GATCTCATCCATTGAATTTG	7	10	yes
GATCTCATCCAGTCTGCTGT	5	5	yes
GATCTCATCACAGGAGCATC	1	1	yes
GATCTCAGTTTGAGTGGATG	13	3	yes
GATCTCAGTTTCGCTGATGT	49	1	yes
GATCTCAGTTCTGTGTTTAC	185	62	yes
GATCTCAGTTCACGGGGTGG	87	23	yes
GATCTCAGTTCAACAGCTCC	77	26	yes
GATCTCAGTGTGGAGAGCAT	26	7	yes
GATCTCAGTGGGGGTGGGAG	136	22	yes
GATCTCAGTGCTGGGGAGGT	137	46	yes
GATCACACTGATGGAGCTGT	8	6	yes
GATCACACTGAGCAACACCC	44	5	yes
GATCACACGGCAAAACAGTA	73	6	yes
GATCACACCTTGCTGTTCCC	19	14	yes
GATCACACCTGTCCCTACAC	1079	14	yes
GATCACACCTGCCCCAGTGG	2	4	yes
GATCACACCTGCAGTTTGGG	43	30	yes
GATCACACCGTTTCTTCCTA	1	2	yes
GATCACACCGAGATTCTTTT	8	5	yes
GATCACACCGAGACCAGTGG	40	2	yes
GATCACACCATTGAGTTCCG	49	17	yes
GATCACACCAGTCCTGTGAG	104	9	yes
GATCACACCACCGTGTCAAA	2	3	yes
GATCACACCAAGCCCCAGGA	123	7	yes
GATCACACATTTGCAAGGGA	125	27	yes
GATCGCGTATCTCCAAAGTG	6	4	yes
GATCACACACTCAGTCCTTG	51	17	yes
GATCACACACGGCAACCGAC	74	11	yes
GATCACACAAGTGTGGGTTT	194	16	yes
GATCACACAAAACTGTCAGC	1996	178	yes
GATCACAATCTAGTCAATGC	43	31	yes
GATCACAATCAGGAACTCAC	37	19	yes
GATCACAAGTTTGCATTCAG	3	4	yes
GATCACAAGTTTGAGACCAG	24	25	yes
GATCACAAGTTGTTTCCTGT	2	1	yes
GATCACAAGTTAAGGTCAGC	59	5	yes
GATCACAAGTGCAGCATTCT	34	25	yes
GATCACAAGGTTTACATCTG	10	10	yes
GATCCTTCATGTTGAGCCAG	155	63	yes
GATCACAAGGGGGTAATCAA	18	9	yes
GATCACAAGGCTGAAAACAA	15	11	yes
GATCACAAGAGTTACTAGTT	1	1	yes
GATCTGTTGGTGGTATAGGC	47	8	yes
GATCCTTGACTCTCAAGCCC	26	17	yes
GATCCTTCTGTCGGCTTCCT	3	5	yes
GATCCTTCTGTCCTGGATTT	1	2	yes
GATCCACTCGAGATTTTACT	7	3	yes
GATCTGTTCAGCACACCTGA	591	258	yes
GATCTGTTACTTTGGCGAGG	938	186	yes
GATCTGTGTTGCAGACTCCT	18	13	yes
GATCTGTGTGTCATCAGATG	50	3	yes
GATCCTTCTCTGCCCTTCCC	53	8	yes
GATCTGTGTGGGACCAAGGC	51	33	yes
GATCTGTGTGGCTCCTCTGC	113	15	yes
GATCTGTGTGGATGTCCTGA	78	15	yes
GATCCTTCCTTTCCCTTGGC	13	5	yes
GATCCTTCCTTCTTCTCTTC	38	8	yes
GATCTCAGTAACTGTCGAGC	28	2	yes
GATCTCAGCTTGCATAGCAT	296	53	yes
GATCTCAGCTGACTCCTTTT	2	2	yes
GATCTCAGCTCCACTGTGAA	59	6	yes
GATCTCAGCTATTCACAGAG	6	8	yes
GATCTCAGCTAAACTTTCAA	5	5	yes
GATCTCAGCCCCTACTCCCA	16	17	yes
GATCTCAGCCATAGTCGTTG	2837	144	yes
GATCTCAGCACTGTGGCTGT	577	119	yes
GATCTCAGACAGCTCTGTGT	9	9	yes
GATCTCACTGTTTCATGCTG	48	8	yes
GATCTCACTGCCTCCCTCTC	231	19	yes
GATCTCACTCAGCAACAAGT	25	8	yes
GATCTCACGGGCCGACCGAG	17	19	yes
GATCACAAGAGGCCCGTTTG	61	3	yes
GATCACAAGAAGTTAGTTTG	9	5	yes
GATCGGGGGGATGACCAGCT	74	10	yes
GATCACAACTTCTGAAACAC	50	19	yes
GATCACAACTGTAGGGAATA	54	11	yes
GATCACAACTGAGCCTACAG	23	4	yes
GATCACAACGGCTTGCGTGT	126	4	yes
GATCACAACCCTGATGGCAG	813	33	yes
GATCACAACCCCCAAGTCAG	79	18	yes
GATCTGATGGAGATTGGGAA	23	15	yes
GATCACAAATACAGATTCTG	137	89	yes
GATCACAAAGTTTGAGAATG	2606	413	yes
GATCACAAAGGTGGAATGTT	7	5	yes
GATCACAAAGAACAAGTGTA	25	6	yes
GATCACAAACTTCTGCAAAA	33	1	yes
GATCACAAACATCACAGAAG	13	10	yes
GATCACAAAATGAGTCACTC	2	3	yes
GATCACAAAAGGCTGTTTTG	10	7	yes
GATCCTGTGCCTGGCCTTTG	28	30	yes
GATCAATGGGCAGCAGCAAT	55	14	yes
GATCCTGTCCTGTGCCTTTT	6	3	yes
GATCTCGCTCTCCTGGAGGC	10	8	yes
GATCTGTGTGAAACTGGATG	1	1	yes
GATCTGTGTATACCCCACTC	74	20	yes
GATCGAAATGTCTCCTGTTT	1	1	yes
GATCCTTACATCAACCTGGC	5	4	yes
GATCTCTAAGTGTAAGTCAA	4	4	yes
GATCTGTGGACGACGAGAAC	94	6	yes
GATCCTGTGTGTTCCCTTCT	4	4	yes
GATCCTGTGTGAGCAGATTG	15	12	yes
GATCTGTGCCATCCCATACA	325	20	yes
GATCCTGTCTCCCGTGGACA	13	8	yes
GATCTCACCGTGAGGCCCCG	13	22	yes
GATCCCCAGGTGGGACAGTG	28	15	yes
GATCTCACACAAGCTGGGGA	26	19	yes
GATCTCAACTGACTCCTCTT	450	120	yes
GATCTCAACAAGATGACCTT	21	14	yes
GATCTCAAACTCAGAGGTTT	16	3	yes
GATCTATTTTTTCTTGCGAT	10	5	yes
GATCTATTTTCCTAACCGTT	82	7	yes
GATCAATGCAATGACGTGGG	292	224	yes
GATCAATGCAAAAATCACCG	2	3	yes
GATCAATGATGAGGACAAAC	834	29	yes
GATCAATGATGACTCCAGGA	14	15	yes
GATCAAGTCCGGGAACTCTC	641	105	yes
GATCCTGGTAGGAGCACTTG	118	37	yes
GATCCTGGGTACTGCACAGT	1382	126	yes
GATCAATCCAGGAGTCTCTG	136	91	yes
GATCCTGGCGCCCATGTTTC	70	48	yes
GATCTGTGATGGGAAGATTA	4	4	yes
GATCCTGGTGAAACACATGG	53	57	yes
GATCCTGGGGTTGGACCCCA	119	67	yes
GATCCTGGGAGTGGGCCCTG	31	22	yes
GATCCTGGGAAGCCTCCTCA	69	11	yes
GATCTGTCTCACTTGACCAT	2	2	yes
GATCTGTCTCAACAGTCTGG	63	19	yes
GATCAATATCACCCAAACCT	29	48	yes
GATCAATAGGGAAACACAGG	515	241	yes
GATCCTGAGGCAATGTGAGC	3	2	yes
GATCCTGCGGGTGGGAGGAA	2	2	yes
GATCCTGCCTTGAATTCCTG	38	5	yes
GATCAAGTTTGTGGTGTGTT	6	2	yes
GATCAAGTTTGGTGTTTCCT	6	11	yes
GATCAAGTTTCAGGAAGGCT	156	3	yes
GATCAAGTTTCACATCCTTC	23	10	yes
GATCCTGCATATCTCAAAGA	29	7	yes
GATCCTGCATACCAACGGCC	21	16	yes
GATCCTGCAGGGGACCCTTC	2	4	yes
GATCCTGCAGGCCCTGGGGG	20	26	yes
GATCCTGCAGCAGGAGTGCA	36	11	yes
GATCTGTCCTGATGAAGGCT	338	22	yes
GATCCTGCAAACTTCCCTGG	107	57	yes
GATCCTGATTTAGGAAGTGT	25	2	yes
GATCTCAAGTTCAAGGATGC	3	3	yes
GATCTGTCCATCTTGGAGTT	22	6	yes
GATCTGTCAGTGTTATGGAA	24	2	yes
GATCTGTCAGCTGTGCTCTC	52	2	yes
GATCTGTCAGCTCGCCAAGG	10	10	yes
GATCCTGCTCAGACCATACC	33	14	yes
GATCCTGCCAGCCAGACCAA	41	27	yes
GATCTGTAGGCGAGGGAATC	17	19	yes
GATCCTGCAGACACTCAGAG	23	16	yes
GATCTAGTCCTGCCCCTGGT	4	6	yes
GATCCTCTCTTCCGCTGGGG	19	3	yes
GATCAAGTTGCCAGCATTTG	17	8	yes
GATCAAGTTGAAAGAGTGTG	14	21	yes
GATCAAGTTCAGTGCGCAGG	11	11	yes
GATCCTCCGGTACTTGCTCA	2	2	yes
GATCAAGTGTTTGCAGGACG	4	6	yes
GATCAAGTGTGACCCAGAAA	10	11	yes
GATCAAGTGTCGGATGGAAT	41	6	yes
GATCAAGTGTAAATGTGCTG	86	21	yes
GATCAAGTGGTCAAGGTACT	3	5	yes
GATCAAGTGGATTCGGCGGT	128	27	yes
GATCAAGTGCTTTGCCAAGT	3	3	yes
GATCAAGTGAGCTGTATCAG	24	16	yes
GATCAAGTGAGAGGACAGAG	3	3	yes
GATCAAGTCTTGTCAGTTTG	63	6	yes
GATCAAGTCGTGCTTCTGGC	2098	327	yes
GATCCTGAGTGCATTGATGC	2	1	yes
GATCAAGTCCTTTGTGAAAG	485	58	yes
GATCCTGAGGGCTGCATACC	76	50	yes
GATCCTGAGGAGTCAAATAT	38	10	yes
GATCCTGAGGAAGGCCAGGC	38	16	yes
GATCAAGGTGTTGCCTGGTG	183	53	yes
GATCAAGGTCCTAAAATTTC	63	44	yes
GATCTGGTTTTAAGTGCCTC	26	18	yes
GATCCTGAATGGGCAAGAGT	103	37	yes
GATCTGGTTTCGCCCCAGCC	14	11	yes
GATCTGGTTCCTGAGCCCAT	136	116	yes
GATCTGGTGGAACCTCCTCT	8	7	yes
GATCTGGTGCTGATAGGAAG	44	15	yes
GATCTGGTCTGCAGTCAGAC	3	4	yes
GATCTGGTCACTGGTCAGAG	11	16	yes
GATCTGGTATGAACATCGGC	288	202	yes
GATCTGGGTTGTGAGGAGGT	36	32	yes
GATCAAGGTCCACTTAGTGG	61	5	yes
GATCAAGGGTTCCCTTCCAA	22	24	yes
GATCAAGGGGTTCTCGCGCT	31	21	yes
GATCCGGGTCCTCAGAGGTT	15	4	yes
GATCAAGGCTTTCCTCGGGC	2	3	yes
GATCAAGGCTCCCGGTTTTG	1754	125	yes
GATCAAGGCCTTTCTGTCCT	411	48	yes
GATCAAGGCCACTGTGTAAC	8	6	yes
GATCAAGGCAAAAGGAGGAT	13	3	yes
GATCAAGGAGGTAGATATGG	323	225	yes
GATCAAGGAGGCTGTTGCTG	99	20	yes
GATCAAGGAGGAAGTGTTGT	21	5	yes
GATCAAGGAGAGAAGCAGGA	48	33	yes
GATCAAGCTTTTTGGAAGTT	45	7	yes
GATCCTCTGGCAGATGTTTG	165	39	yes
GATCAAGCTTCTGTGTAAAC	4	7	yes
GATCAAGCTTAGCAGTCAAG	419	76	yes
GATCAAGCGGGCTTTCCTTA	309	35	yes
GATCAAGCCTGTTAGCCCTG	33	7	yes
GATCTGGGCACCGAGGCTGG	133	95	yes
GATCTGGGCACCCACTGCCT	2	3	yes
GATCTGGGATAAGGAGAGCG	3	5	yes
GATCCCTTCTGGGACTCCCG	12	10	yes
GATCAAGCCCTTCTTCCATT	410	50	yes
GATCAAGCCATCCATCAACT	179	11	yes
GATCAAGCAGTTTCTGGAGT	69	10	yes
GATCAAGCAGTAGAGTTTTT	24	7	yes
GATCAAGCAGCGAGAGGCTG	1762	81	yes
GATCAAGCAGCAGCACGGGG	19	12	yes
GATCTTTTTTGTCTTTACCT	17	13	yes
GATCAAGCAGAACCTGGAGA	191	28	yes
GATCAAGAGTTTATTGCATT	40	26	yes
GATCCTTCTTTCCCTAGTCG	4	4	yes
GATCCTCCTCACTTAGCACC	37	2	yes
GATCAAGACTGTGACTTTTG	9	11	yes
GATCAAGACTCTCCTGGAGA	35	25	yes
GATCAAGACGCCTGTCATTT	16	2	yes
GATCAAGACCCTCCAGAGGT	25	18	yes
GATCAAGACCACCACTGCAT	63	46	yes
GATCAAGACAGCTTGTTGGT	11	4	yes
GATCAAGACAGCCAGTACAT	8	5	yes
GATCCTCCCAAAAGCCATCT	83	12	yes
GATCCTCCAGCTCCATCAGC	45	31	yes
GATCAAGAACTTCCATTACT	2	2	yes
GATCAAGAACAGAATGGGCT	11	10	yes
GATCTGGGAGCCAAAGGTTG	6	7	yes
GATCCTCACTGGCAGCAGCT	62	3	yes
GATCCTCACCCACCTGCTGG	306	12	yes
GATCTGGGAAAATGGCAGTT	14	4	yes
GATCTGGCTTTTGTTTTCCA	52	22	yes
GATCTGGCTTTACTTCTCTG	30	10	yes
GATCCTCCTGTCTGCTGCTG	2	3	yes
GATCTGGCCTGAGCCTGTCC	55	15	yes
GATCTGGCCGAATGGTAAAA	370	57	yes
GATCTGGCCCTTTTGTCCTT	87	17	yes
GATCAACTTTCAGCTGGGAA	615	423	yes
GATCAACTGTGCAGACAACA	1503	68	yes
GATCAACTGCTACGATGTGT	13	5	yes
GATCAACTGAGGTCTTTCTT	13	9	yes
GATCAACTCTTGGCTTTGAC	6	7	yes
GATCTGGCCAACACAAGAAC	16	10	yes
GATCTGGCATAAACCCTACT	82	4	yes
GATCCTCCCTGTTCTCATCT	44	10	yes
GATCTGGCAGATGTGAGGTT	86	28	yes
GATCTGGCACTACTGCCGAG	9	7	yes
GATCTGGAGGTGGAAGTGGT	3	2	yes
GATCTCCTTTGCCCATGTTT	5	5	yes
GATCAACCTGAACTTGGGAC	15	1	yes
GATCAACCTCCTGGGCTTCA	44	14	yes
GATCCCAGCATCATCTTTGC	65	13	yes
GATCAACCACTGCAAATTCG	300	85	yes
GATCAACCACTGACCTGCCT	96	20	yes
GATCAACATGAACTGAGATT	24	7	yes
GATCAACATCCTCCACCAAG	2	2	yes
GATCAACAGTGAGGCAAGCA	6	9	yes
GATCAGAGCTCCTCAGTGTG	12	5	yes
GATCAACAGTAGTTGTCTTT	7	5	yes
GATCAACAGCGTTGCCTTCC	86	61	yes
GATCATGAGTCCTGAATCAT	3	4	yes
GATCCCACTCTGCAACTACT	18	6	yes
GATCAGCTCCAACTATGGTG	13	9	yes
GATCCTGCGGGAGGCCTATG	2	4	yes
GATCAGTGCAAATGTTTTTG	2	4	yes
GATCAGTGAATAAAACCATC	5	4	yes
GATCCAGGCTATCTCCTCTG	95	15	yes
GATCAGTCCTTCCCTCGAGA	56	11	yes
GATCCAGGAGGCTCTGCACG	34	26	yes
GATCCCAGCATTTCTCAATT	7	10	yes
GATCCCAGCATCGGCAAGCG	285	11	yes
GATCCCAGCAGCTGTTACCT	77	15	yes
GATCCCAGCACACACCGTGA	167	25	yes
GATCCCAGATGGACATGGCA	18	2	yes
GATCCCAGATGATACCCACT	48	1	yes
GATCCCAGAGGAAAGGGTTT	178	21	yes
GATCCCAGAGACAATCTCAT	190	19	yes
GATCCCAGAGAAGTGGGGCC	5	6	yes
GATCCCAGACGCCTCAAATG	15	3	yes
GATCCCAGAATAATGACTCT	5	5	yes
GATCCCAGAAGCCGCACAGG	2	3	yes
GATCCCAGAAGCACACTGGC	136	18	yes
GATCCCAGAACCATTGCCTG	48	10	yes
GATCCCACTTCACCTGTTAT	87	23	yes
GATCCCACTGTTGATAAGGA	4	4	yes
GATCCCACTGCTCATTTGAC	242	20	yes
GATCCCACTAACCTGCAGTG	4	1	yes
GATCCCACGGTAGAACCTGA	163	8	yes
GATCCCACGAGCCAGAGAAC	502	42	yes
GATCCAGGAAATGCTGGAGA	2	0	yes
GATCCTAGCGGACCTCAACC	8	2	yes
GATCTGTCTGTAGCGGTCAA	5	4	yes
GATCTGTCTCCCTTTTAGCT	14	14	yes
GATCAGGTTTCTTCTTTTCC	14	10	yes
GATCTGTCCAGGGGACATTA	56	11	yes
GATCCAAGTCAGGGAGAAAG	67	21	yes
GATCATCAGCTGGACTTTGT	3	2	yes
GATCCCACCTTCACCTCCCT	18	3	yes
GATCCCACCTCACGTGTGAT	522	95	yes
GATCCCACCGCAGCTACCAG	340	22	yes
GATCCCACCCCGAGCCTGGT	7	10	yes
GATCCCACCCCAGTAGGAAG	575	78	yes
GATCCCACCATTCTCCTTGG	382	103	yes
GATCCCACCATCCTACCTAC	10	1	yes
GATCCCACATTTCCCTTGCC	40	9	yes
GATCCCACAGTGTGACTGAT	24	12	yes
GATCCCACAGGCCGGTGGAG	79	10	yes
GATCCCACAGCCAGGCTCAC	329	38	yes
GATCCCACACTTAAGACTTC	216	13	yes
GATCCCACACATAAATGCCC	4	6	yes
GATCAGGTGGATGTGCAGGA	8	8	yes
GATCAGGTCCTAAACATGGC	13	20	yes
GATCCAGCAGCCGAGACTGA	39	8	yes
GATCCCACACAGCAGACAGA	50	5	yes
GATCCCAATTGGTGGAAAGG	62	12	yes
GATCCCAATTCTGTCCCAAT	33	1	yes
GATCCCAATTCCCAGTATTA	4	7	yes
GATCCCAATTACAACCCACT	15	23	yes
GATCCCAATGCTGCCCCATC	77	14	yes
GATCCCAATGATAGATTCAA	20	3	yes
GATCCCAATGAGCCCACCTA	55	5	yes
GATCCCAATAAACCCATGAG	19	20	yes
GATCCCAAGTTCAAAGCCAG	5	5	yes
GATCCCAAGTGCTGGGAAAG	386	84	yes
GATCCCAAGTCCAACACCCA	7	10	yes
GATCCCAAGGGTCAGCACTG	2	3	yes
GATCCCAAGCCTCACCGGCT	22	22	yes
GATCCCAAGCCAAGAAACAC	31	8	yes
GATCCCAAGAGGAAGGGTAT	18	8	yes
GATCCCAAGAAAGGATGGAA	6	5	yes
GATCCCAAGAAACTACTTGA	327	60	yes
GATCCCAACTGTCAGTGCCA	28	15	yes
GATCCCAACTGTAACAGCAA	2	3	yes
GATCCCAACTCTGCAAGAGC	1	2	yes
GATCCCAACGTGACCATCAT	115	11	yes
GATCCCAACATTTGAGAGGC	59	3	yes
GATCCCAACATTGTTGGCAA	147	19	yes
GATCCCAACACCCATATCCA	9	5	yes
GATCCCAACACAGCGATATG	457	32	yes
GATCCCAAATTGGGTTGTCA	19	5	yes
GATCCCAAATCTGTGGTGTG	77	21	yes
GATCCCAAATACTCAGTGCT	11	2	yes
GATCCCAAAGCACAATGGTG	45	9	yes
GATCTCATCCAAGCAAATGG	31	24	yes
GATCAGGGCTCCAGTGGTCC	139	18	yes
GATCCAGAGCTCCTAGCACT	121	27	yes
GATCCCAAACTGTATCCTTG	4	4	yes
GATCCCAAACTGAGGCAGCA	203	55	yes
GATCCACGTGCCTTTGTCTC	7	6	yes
GATCCCAAACAACTAAGAAT	323	24	yes
GATCCCAAAATGCTGCGGAG	107	15	yes
GATCCCAAAATAGGTGTTGA	94	26	yes
GATCCCAAAAGGGACATTGT	41	14	yes
GATCCCAAAAACCGTGCAGC	3	5	yes
GATCCCAAAAAATCTGTGCC	84	12	yes
GATCCATTTTTCTGTGACAT	6	1	yes
GATCCATTTGCTTACACTGT	147	12	yes
GATCCATTTGATGCTTCCAG	19	4	yes
GATCCATTTCTTCTGCATGA	143	51	yes
GATCCATTGTTCCTCTGTTT	39	7	yes
GATCCATTGTGTGGTTTAAC	198	5	yes
GATCCATTGTATGGCTTTAT	157	110	yes
GATCCATTGGTTTCTCAGTC	84	12	yes
GATCCATTGAGACGTATGAA	4	3	yes
GATCCATTCTCCCGCCACAG	6	8	yes
GATCCATCTTTTTCTTTGGA	15	4	yes
GATCCATCTTCTGTTTCACC	25	7	yes
GATCCATCTTCAGCTGACTG	165	27	yes
GATCCATCTCTTTCCTTCTG	21	8	yes
GATCCATCTCCTCTGGCTCT	662	108	yes
GATCCAGAATGTCAGCTGGA	186	38	yes
GATCCAGAAGGGTCTCTCTC	10	10	yes
GATCAGGCCGGGGCGGCAGG	33	50	yes
GATCAGGCCCTAAAGCATTG	44	8	yes
GATCCATCGACTGTGATAGG	77	16	yes
GATCCATCCTTACTTGGTTT	8	6	yes
GATCCATCCTATCCATCCGT	55	9	yes
GATCCATCCCCGGCAAAGAG	150	9	yes
GATCCATCCCAGAGGGACTG	1548	160	yes
GATCCATCCAGCAAAGAGGA	50	19	yes
GATCCATCCACCAGCAGGAG	82	7	yes
GATCCATCCAATGGCTTACC	390	11	yes
GATCCATCAGGGCTGAGCCT	31	6	yes
GATCCATCACAGGACTATGT	30	9	yes
GATCCATCACAAGGCAAAAC	66	14	yes
GATCCATCAAGTGGGTAAGT	32	13	yes
GATCCATATCACTGGATGTA	37	24	yes
GATCCATAGCACAAAGCCAC	11	5	yes
GATCCTTGGAACCCACAATG	1	1	yes
GATCAGGAGCAGGCAACACC	903	225	yes
GATCCACTCCCTGTTCCCTT	7	0	yes
GATCCATACCCACCACTGTG	9	7	yes
GATCCATACCATAGCCAAAA	3	3	yes
GATCCATACAGCATTTTGCG	34	12	yes
GATCCATACAATTTGTGCCA	373	19	yes
GATCCATAAGTTTGCCCAGT	125	30	yes
GATCCAGTTTTGGGAAAGGA	318	20	yes
GATCCAGTTTCTGACTCGGG	25	10	yes
GATCCAGTTGTTTGAAGATT	3	4	yes
GATCCAGTTGTGCAGTAGAG	10	10	yes
GATCCAGTTGGAGAGATTTG	4	6	yes
GATCCAGTTGCTCTAAGTTT	17	6	yes
GATCCAGTTCTGCTCAACTA	108	19	yes
GATCCAGTTCTACGAGCGGC	342	39	yes
GATCCAGTTCTAAAACTTGT	140	31	yes
GATCCTTGACCAGAAGTCTC	2	3	yes
GATCCAGTTACCAGAAGATG	566	197	yes
GATCCAGTGTGTTGCTGGCA	93	16	yes
GATCCAGTGTGGACCAGCTC	148	136	yes
GATCCAGTGTGCTGGTCTTT	4	7	yes
GATCCAGTGGCAGCCTCAGC	60	48	yes
GATCCAGTGCCTCATTGTTG	33	9	yes
GATCCAGTGAGAGCCAGACA	43	16	yes
GATCCAGTGACGTCAGACGC	23	35	yes
GATCCAGTCTGTCCTAGATG	25	3	yes
GATCCAGTCCTGGAGGACAG	434	47	yes
GATCCAGTCCATTCAGCAGT	29	11	yes
GATCCAGTCAGGACATATGA	36	19	yes
GATCCAGTCAGCCCCTGGGG	349	101	yes
GATCCAGTCACAGAAGAACC	39	7	yes
GATCCAGTATCTGAAAGACC	121	95	yes
GATCCAGTATCTACAAAGAC	6	8	yes
GATCCAGTACTTGGTTTGTG	17	5	yes
GATCCAGTACTACCAGAATG	57	37	yes
GATCCAGGTTCACCACCGGG	80	2	yes
GATCCAGGTTCAATTTCCAG	116	31	yes
GATCCAGGTGTGCTGAGTGG	276	65	yes
GATCCAGGTCCGTGAACCCC	241	54	yes
GATCCAGGGTGTGCAGTGGG	1110	193	yes
GATCCAGGGTGCCCCTCCAA	419	131	yes
GATCCAGGGTCCTCTGCCTG	70	18	yes
GATCCAGGGGGGACACCTGC	69	6	yes
GATCCAGGGCTCAGGAGCAC	87	5	yes
GATCCAGGGCGATGTTGGGG	134	19	yes
GATCAAAGTATGACCACTAG	17	18	yes
GATCCAGGGCCTGTGAATCA	38	13	yes
GATCCAGGGCCTGGTGGAGG	254	65	yes
GATCCAGGGCCACTTTGTCT	14	11	yes
GATCTGGCACTGCTTTAGCC	9	6	yes
GATCCACCAGGCTGTGACCA	40	7	yes
GATCCACCAGGCTCAACAGG	6	7	yes
GATCCACCAGGATTGAAGGA	22	15	yes
GATCAGCCTGTCCTATTCCC	2	2	yes
GATCCACCACAGCAGGCAGG	3	2	yes
GATCAGCCTCTTCCTTTTGT	8	7	yes
GATCAGCCGGGGCTTTGAGG	153	18	yes
GATCCACAGTGCAAAGAAAA	3	3	yes
GATCTTTGGAAGGAGAAGAT	1	1	yes
GATCTTTGCCTCTCTGTAGA	6	6	yes
GATCAGCGTGACCACCCCCT	1	2	yes
GATCTTTGCAGTGTAATTCT	10	13	yes
GATCCTTCAGAACACTGCTG	25	4	yes
GATCCAGGCTCTGATGTTTC	23	8	yes
GATCCAGGCTCTCTATGGCA	62	11	yes
GATCCAGGCTCGGGAGCTAA	42	16	yes
GATCCAGGCTCACAGTGTGA	18	8	yes
GATCCAGGCTAACCAGACTG	6	8	yes
GATCCAGGCTAAAATCCCCG	13	14	yes
GATCCAGGCGGCCCTGCCAG	26	17	yes
GATCCAGGCGGCCAAGAACT	436	83	yes
GATCCAGGCGGAGGATGACG	30	1	yes
GATCCAGGCCTCCCTTCTTG	70	11	yes
GATCCAGGCCTACTTCGCGT	105	10	yes
GATCCAGGCAGCTGTGTACA	27	20	yes
GATCCAGGCAGAGCTCTTCA	49	12	yes
GATCCAGGAGTTCAAAGAGG	670	83	yes
GATCCAGGAGTCAGTTCTGC	2	1	yes
GATCCAGGAGGGGTTTGCTC	34	3	yes
GATCCAGGAGCAGGAGCTGC	6	6	yes
GATCCAGGAGCACGTGAAGA	81	72	yes
GATCCAGGACTTCTTCATCC	11	11	yes
GATCCAGGACCTGGAAGTAT	12	10	yes
GATCCAGGACCATCCTCTCA	7	10	yes
GATCCAGGAAGTTTTGTTGT	20	8	yes
GATCCAGGAACTACTCCACA	11	10	yes
GATCCAGGAAAGCAGCCTGT	477	49	yes
GATCCAGCTGGGCGAGGATG	113	20	yes
GATCCAGCTGGGCAAAATTC	35	28	yes
GATCCAGCTCCTAAACTGTT	17	6	yes
GATCCAGCTCAGGCGGTGTC	56	4	yes
GATCCAGCGCTCTCGGGACT	2	2	yes
GATCCAGCGAGAAAGAAGAA	52	39	yes
GATCCCACCTGCTCCTGGAC	10	9	yes
GATCCACAGCCACAGAAGAG	12	9	yes
GATCCACAAGGTGGCAGTGT	21	7	yes
GATCAGCAGTCCGCGAGCTT	11	3	yes
GATCCAGCCTGACCTGCACA	197	11	yes
GATCCAGCCCATACAGAAGA	14	11	yes
GATCCTGTATTATCAGCTAC	2	2	yes
GATCCAGCCAGTCTCTCATT	12	5	yes
GATCCAGCATTTAAATTTCT	56	15	yes
GATCCAGCAGTTAAAGCAGT	48	35	yes
GATCCAGCAGAGAGGGCAGG	59	4	yes
GATCCAGCAGAGACTCCACA	62	28	yes
GATCCAGCACCGTGTGTACC	3	3	yes
GATCCAGCAAACTTGGTTGG	86	29	yes
GATCCAGCAAAAGTATCTGA	93	12	yes
GATCCAGCAAAACTACTGCT	15	6	yes
GATCCAGATGATGGTTCTTT	211	19	yes
GATCCAGAGTGGCACAGGGT	239	28	yes
GATCCAGAGTGGAACTGTCC	35	29	yes
GATCCAGAGTGACGTGCTCA	4	1	yes
GATCCAGAGGTGCTGGGCAT	22	2	yes
GATCCAGAGCTTCTGCAAGG	27	6	yes
GATCAGTTAGGCTCTTTCTT	1	1	yes
GATCCAATTCGAGAAGTCAA	2	3	yes
GATCAGCAGATGCAAAAGAT	27	10	yes
GATCCAATCCTCCTGCCTTC	70	2	yes
GATCAGCAACTCCTGCTTCA	77	12	yes
GATCCAGAGCGTGTTAACAG	3	5	yes
GATCCAGAGAGATGGGTCAG	18	13	yes
GATCCAGAGAGACTTGGTTG	33	12	yes
GATCCAGAGAACTCAGCTGT	79	8	yes
GATCCAGAGAAAGCAAAGGC	2	3	yes
GATCAAGAGCCCACACCTAG	4	4	yes
GATCCAGACTTGCCTTATAA	178	18	yes
GATCCAGACGCCAAGGCTGC	9	7	yes
GATCCAGACGAATCTTGTCA	18	5	yes
GATCCAGACCTGCCACAGAC	18	6	yes
GATCCAGACCCGGGAAGGGA	261	71	yes
GATCCAGAATTGCTTTCCCA	119	6	yes
GATCCAGAAGTTGGGAAAAC	6	6	yes
GATCCAGAAGCAGTGGAATC	896	153	yes
GATCCAGAAGAACCTACCAC	8	12	yes
GATCCAGAACCTCTCAGCCA	7	10	yes
GATCCAGAACATTCTAGAAA	19	15	yes
GATCCAGAACAGTACAGCGT	320	37	yes
GATCCAGAACAGCGACGATG	3	5	yes
GATCCAGAACACATTAACCT	52	51	yes
GATCCAGAAATAACACAGTT	5	5	yes
GATCCAGAAAGAACGATTTG	234	34	yes
GATCACACACCCACAGTGTA	2	1	yes
GATCCAGAAAACATGGGCTC	148	35	yes
GATCCACTTGGGCTCTGTCA	242	11	yes
GATCTTGCCTCCTTAGTATT	2	3	yes
GATCCTGGGGCCTGGGTGGG	10	7	yes
GATCAAGGCTGCCCAATACC	17	6	yes
GATCCTCAGAGTCAAGGACC	8	12	yes
GATCTGGCACTCTCTTCTGG	3	3	yes
GATCGGATTCCTCAGCTACG	1	1	yes
GATCAAGTTTGCCGTCCATG	63	12	yes
GATCTGCTCCCTAGAAATCC	8	3	yes
GATCTTGCTGTTGTGGATGT	4	4	yes
GATCCCCCGCCCGGAGAGCC	9	6	yes
GATCAACACTACGGTGCCAG	2	3	yes
GATCAAATTCCCACTGCCCG	50	36	yes
GATCTTGACCTTCTCTTTGG	10	13	yes
GATCACCTTCAAGGTCAACA	1	1	yes
GATCTAACGTGAGGAAGGAT	2	2	yes
GATCTGATTTTAAGGGAAAT	79	24	yes
GATCCTCACATGGAAAGTAC	25	18	yes
GATCCTCAACGAGGATGGCA	927	212	yes
GATCCTATGTTGCTGGAGCT	96	6	yes
GATCCTAGTGGGTCTACCAG	253	29	yes
GATCCTAGTGCTGCTCTGGC	56	17	yes
GATCCTAGGTGTCTTCTGTT	2	2	yes
GATCTGAATGTGCCGTCTCT	26	5	yes
GATCCTGCACAATTTAACTC	1	1	yes
GATCCCCATGAACCTCTTCA	6	4	yes
GATCCTACCGCCTTTAACAA	100	4	yes
GATCCTACAGAAGGCCCACT	45	4	yes
GATCAAGAATTTGGTGTCGA	9	11	yes
GATCCTCAACCAAGTGGAGC	3	3	yes
GATCCTAACTAGCAAGGGTT	2	1	yes
GATCTGGAGCCTCCACGATG	10	15	yes
GATCTGGACTTGTTTTCTGG	4	4	yes
GATCTGGACTTCTGAATCTG	97	12	yes
GATCCATCATGGCGGAGAAA	55	17	yes
GATCTGGACCTCACCTCTGA	58	20	yes
GATCCACTTGTGCATGTAGT	8	7	yes
GATCTGGTTGTACTGTCCAA	125	45	yes
GATCTGGAAGTTGGCAGATG	138	15	yes
GATCAACAAATCTCCTAGGC	22341	6251	yes
GATCAACAAAACTGTACCTG	1	1	yes
GATCCTAAAGTACCCGCTAG	23	15	yes
GATCAAATTGGTCTTCACCT	29	6	yes
GATCAAATTGGTACAGAAAT	28	1	yes
GATCAAATGTGCCATAGCAC	23	24	yes
GATCCGTGTCCCTGCGTGCA	316	33	yes
GATCAAATGCTCTTATCATT	90	11	yes
GATCCGTGGGCCTGGCCTCC	173	21	yes
GATCAAATGAGAACACTGCT	109	14	yes
GATCAAATCCAAACTGAGGG	38	3	yes
GATCTGGAAGAGACTTTGGC	2069	800	yes
GATCCGTATTGAGGCCAATG	292	305	yes
GATCTGGAACAGTTTTTGGC	9	9	yes
GATCCGGGTGTTGTGCCTAA	3	3	yes
GATCTGGAAAACGCTGGAGA	48	5	yes
GATCTGCTTGCCAGGCCACT	46	32	yes
GATCAAGAATTTGGTGTGGA	3516	562	yes
GATCTGCTTCCAGGTCCTCA	104	15	yes
GATCTGCTGTCCAGAGCAAG	307	43	yes
GATCTGCTGCTGGTGCTTGC	25	1	yes
GATCCTAGAATGTTTGTAAG	5	4	yes
GATCCCCTTTCTCTATGTCT	250	213	yes
GATCCATAACCATCAGCCTT	23	4	yes
GATCAAAGTTGTTTCACTGT	15	10	yes
GATCAAAGTGAGGGAAGCGG	9	9	yes
GATCAAAGTCTCCATAGTTG	66	13	yes
GATCAAAGTCATTGCGGTTA	72	7	yes
GATCCGGGCAGCCCAGGAAA	28	41	yes
GATCAAAGTACTTGTTAGGG	122	33	yes
GATCCATCTGCACAGTCTGT	11	0	yes
GATCCGGCCCTACTGTGTGT	71	23	yes
GATCAAAGGAAAGGGGAGGG	610	32	yes
GATCAAAGCTGGCAAGGTTC	15	13	yes
GATCAAAGCTGGCAAGGTAC	1985	64	yes
GATCAAAGCCTACTTTTCTT	44	18	yes
GATCAAAGCCCGGAAAGGCA	1221	129	yes
GATCAAAGCCACGGGGTCAG	8	6	yes
GATCAAAGCCAAGTATCCTG	44	4	yes
GATCAAAGCACGCCTGCATG	10	7	yes
GATCCGCTGTACTCTCCTCC	80	17	yes
GATCCGCGCTGAGGAGCAGC	10	11	yes
GATCTGCTGCAGGACCTGGG	25	18	yes
GATCCGCGAATGCTCGGAGG	1345	147	yes
GATCTGCTGAAGGAGAAAGC	66	51	yes
GATCTGCTCTCGGGCCTCGC	204	14	yes
GATCCGCAGTGGCATGTTCT	1152	63	yes
GATCCGCAGCGCCTCTTCTT	159	30	yes
GATCCGTTGCTGACCTTGCG	82	13	yes
GATCCCAGCCCACAGGATGT	81	18	yes
GATCAAAGAGTTCAGCAAGA	163	21	yes
GATCAAAGAGGCTGCTGTCT	13	23	yes
GATCAAACTTGGCAGTGGTG	8	6	yes
GATCAAACTGAGTCTGAAGG	523	117	yes
GATCCGCAAGTTTTCTATGA	6	4	yes
GATCAAACTAATCAGGCATC	44	8	yes
GATCAAACGAGTTGTGTGTC	5	3	yes
GATCAAACCAGCCTGTTTTT	29	8	yes
GATCAAACAGTAAAGGTGTG	79	8	yes
GATCAAACAGCAGCCAAGTG	1	1	yes
GATCCGAGAAAGAGAGAGGC	29	4	yes
GATCCGACTTGCCCAGAAAG	1	1	yes
GATCCGAATGGGTCGACTGA	12	12	yes
GATCAAAATGTTTGTTGCTT	15	12	yes
GATCCCTTTCACACACCTGC	1	1	yes
GATCAAAATGTGGTGCCAGA	25	8	yes
GATCCGTGGTATCAGTGGGA	17	4	yes
GATCCCTGTGCCTAGCTGCT	42	27	yes
GATCCGTGACATCGAGGAAG	3	5	yes
GATCTGCCTGAAACCAGGGG	28	19	yes
GATCTGCCTCAGTCCACAAG	189	37	yes
GATCCGTCACAGAGAGCAGG	9	4	yes
GATCCAGCCTGGTCTACAGA	3	5	yes
GATCTGCCGAAGCGGGCTTG	8	3	yes
GATCTGCCCTGTATTGTTAA	5	5	yes
GATCTGCCCCTGACCCTCCA	88	20	yes
GATCCAGAGGCTGGGCCTCT	2	3	yes
GATCTCAGCCAAAAGACTAA	2	3	yes
GATCAAAATGCTTGGAGAAA	44	49	yes
GATCAAAATGAGGCAGAGGA	114	8	yes
GATCAAAATATGCTGCAGAC	95	74	yes
GATCCACACTGTTGAAACAT	61	13	yes
GATCCCTGGTCCTTAGGTGG	157	10	yes
GATCAAAACCTGTGACGGAG	2	3	yes
GATCTGCCAGGAACATGAGA	38	28	yes
GATCTGCCAGCCGTACATCC	74	13	yes
GATCCCTGATTGCCTCCATG	684	54	yes
GATCCCTGATGCAAAAGAGA	296	44	yes
GATCGCTCTTTTGGAGGAGG	3	0	yes
GATCCGGCTCCAGATTCAGG	3	5	yes
GATCCGATGCTCTCTTCCGG	3	3	yes
GATCCCAGGCAAAACCACAC	5	5	yes
GATCTGCAGTTCCTGGAAGG	26	18	yes
GATCTGCAGGTGCCTGGGAA	3	3	yes
GATCCTTTTTTTCAGACCTC	2	2	yes
GATCCAAGCTGTCAAGACGG	11	14	yes
GATCATAGCCAAAGAATTTG	6	6	yes
GATCCCTCTGCAAACCAAAC	51	11	yes
GATCCCTCTCCCAGCTCTTC	136	88	yes
GATCCCACAGGAAGTCAAGA	11	2	yes
GATCTGCAGGAGGATGGTAA	2	2	yes
GATCTGCAGGAGGATGCCTG	612	6	yes
GATCTGCACTCGGTACCCTC	6	6	yes
GATCCGCGCCTGTGGGGAGC	55	10	yes
GATCCGCCGCAACTCCACAG	25	17	yes
GATCCCTCAGTGTAGCATAG	228	42	yes
GATCCCTCAGCTTTCTCCAA	92	77	yes
GATCCCTATTAAAGGCCTGC	16	10	yes
GATCCCGTCAACTTCAAGCT	9416	1119	yes
GATCCCGGGGGCTCCAGGAA	49	18	yes
GATCCGCAGACGTCACTCTG	63	52	yes
GATCCCGGGGCAGTCCAGCC	52	8	yes
GATCTGATTGCCACTTTGCT	1	1	yes
GATCCGAGTTGGGGAGCCTG	84	23	yes
GATCAAATTCCCACTGCCCC	928	86	yes
GATCTGATTCCCGCAGGTTC	169	34	yes
GATCCCAGGGAGTGAGGAGG	3	2	yes
GATCGCTGCTCAGAGGAAGA	6	3	yes
GATCCTTTGGACCGGGGCTT	55	58	yes
GATCACACCTGTGGGGTCAG	35	32	yes
GATCACACCACAGGGCTATG	3	2	yes
GATCCCGGGCAATGCTTTCA	126	61	yes
GATCCCTTTCCTTTAGCAGT	9	9	yes
GATCCTGGCAGGCTACCTAG	3	3	yes
GATCTGTCCTTTGTGTGCAG	1	2	yes
GATCACGAGCTGCCTGTGGA	30	21	yes
GATCCCCTGAGAAGCTGTAT	91	13	yes
GATCCCCTCCCCCAGCTAAA	15	10	yes
GATCCCCGGCGTCTGTTTGA	5109	71	yes
GATCCCCCAGCCAGGCCAAA	94	29	yes
GATCCCCATTGGAGCAAAGC	56	19	yes
GATCTGAGCCCCCTGAGGTT	37	11	yes
GATCCCTGGAGCCACCAGCT	230	45	yes
GATCCCTGCTTTCATGGAAG	71	18	yes
GATCTGAGAAGCTGTGATGG	4	4	yes
GATCCTAACCGTGTTACAGA	5	5	yes
GATCTGAGAAACGGGGAAGC	31	7	yes
GATCCCTGATAATACCTTAG	9	7	yes
GATCTGGTTTCAGTGTGTCC	2	3	yes
GATCCCAAGGAATGGGCAGC	4	2	yes
GATCTGACTCCCTCTTCTGT	170	165	yes
GATCTGGCTCTCCTGGAGGA	47	5	yes
GATCTGACTCCACTGCCCAG	357	167	yes
GATCTGACGCCGAGGAGGTA	182	12	yes
GATCTGACCTGGGTCCTGAC	30	5	yes
GATCCCTATGGACACTGACA	248	26	yes
GATCCCTAGTGACTCGTTTA	4	4	yes
GATCCAGATGGGCTCTGTGG	2	3	yes
GATCCCTCCGCGGGGACAAG	8	5	yes
GATCCAAGAGGACATGGACT	33	3	yes
GATCCACTTGAAACCGGGAG	2	2	yes
GATCCACTTCAGAAGCAGCC	59	41	yes
GATCCACTGTTGTCCAGAGG	82	14	yes
GATCCACTGTCTTCCTAGAG	274	9	yes
GATCCACTGTAATGTATTAT	6	3	yes
GATCCACTGGGCCAAGGAGC	36	28	yes
GATCCACTGGCTGGATATAG	7	5	yes
GATCCACTGGAAGCAGCACG	1	2	yes
GATCCACTGCTGGAAGTACC	1117	95	yes
GATCCACTCTTTTCATACCC	147	12	yes
GATCCACTCGGGGGCTGTGA	126	16	yes
GATCCACTCCTGCAGAGCAC	77	3	yes
GATCCACTCCAGGCTGCGAG	296	62	yes
GATCCACTCAGACGAACAGT	13	3	yes
GATCCACTACTACCAGGGAC	20	19	yes
GATCCACTAATGCAGCTGGT	61	42	yes
GATCCACGTCTCGTCGTCAG	1325	30	yes
GATCAAAGCCCGGAAGGGCA	4	7	yes
GATCCACGGGGCACCCGCAC	89	13	yes
GATCCACGGGCTGGAATCTG	6	6	yes
GATCCACGGACACCAAGTTA	285	37	yes
GATCCACGACTACTTGGACA	34	9	yes
GATCCACGACAGAGTGGAGA	35	10	yes
GATCAAACAGAAGCGCCAGG	4	3	yes
GATCCACCTGTGGTGCTAGT	38	9	yes
GATCCAACTGCCTTTGCCTC	30	9	yes
GATCTTTCCAATGAGCCATG	2	2	yes
GATCAGAGCTACACAATGGC	132	27	yes
GATCAGAGCCGCCTGACTTC	262	4	yes
GATCCCAGCTTCAGGACACC	8	6	yes
GATCAGAGCAGGAAGTTTTC	3	3	yes
GATCAGAGCAATGCTGGAGC	36	3	yes
GATCTGCTCGTGTTCCTGTC	10	1	yes
GATCCAACATACAGCACTTT	5	3	yes
GATCCAACACCTTCTTCTGG	12	13	yes
GATCAGAGACACGGAGCTGG	12	9	yes
GATCCACCTGCTTCTCCCTT	7	9	yes
GATCCACCTGCTTCTACCTC	3	4	yes
GATCCACCTGCTGCTGCCTC	74	18	yes
GATCCACCTGCCTGTGCCTC	88	5	yes
GATCCACCTACTTTTTCAGC	1	2	yes
GATCCACCTACCTGCCTCTC	8	8	yes
GATCCACCCTGAAAGTGTCT	9	6	yes
GATCCACCCCTATCTGAGAA	12	9	yes
GATCCACCCACCCTGGGCAT	74	17	yes
GATCCACCCACCCCTGCCTC	6	8	yes
GATCCACCATCTGTAATGTC	3	3	yes
GATCCACCAGTGCTTCTGCT	804	94	yes
GATCCACCAGTCCTTGAAGC	175	16	yes
GATCCACCAGGATGTTTGAT	260	27	yes
GATCCACCACATGTGCCAAA	634	66	yes
GATCCACCAAGTCCTGGCCC	44	4	yes
GATCCACATTTGCTGGTTTG	599	38	yes
GATCCACATTGCTGTCCTAT	67	13	yes
GATCCACATGTGCTCGCAAA	2	3	yes
GATCCACATGTACCATCAAC	119	30	yes
GATCCACATGCGTGTAGCAG	843	125	yes
GATCCACATGAGGAGATACT	239	17	yes
GATCCACATCTCCCTCCCCT	100	11	yes
GATCAGACCGTGGCGGTTGG	72	8	yes
GATCAGACCGACGTATGCAG	3	3	yes
GATCTGCCTCCGGAACTTGT	2	2	yes
GATCCACAGTCCCTATGTGT	20	4	yes
GATCCACAGGGTACCTCCCT	54	11	yes
GATCCACAGGCAGTTGTGCC	44	5	yes
GATCCACAGGAGGGTTCCAA	25	6	yes
GATCCACAGCAAATTGAACA	35	27	yes
GATCCACAGATTCTGCCTGT	13	2	yes
GATCCACAGACAGCAGGAGG	50	4	yes
GATCCACAGAAGCACTGCAG	3	5	yes
GATCCACACTTCTGAAGACT	3	3	yes
GATCCACACTGCCACTAAAA	73	7	yes
GATCCACACTAATATCGCTG	117	14	yes
GATCCACACGGAAGGGGAAA	39	11	yes
GATCCACACCCTAACTCCCA	25	3	yes
GATCCACACACGACTCTCCA	338	26	yes
GATCCACAAGTCTTAGCTGT	269	4	yes
GATCCACAAGCGACTCATTG	1836	85	yes
GATCCACAACCTGATTCCCG	2333	83	yes
GATCCACAAATGCATGGATT	2	3	yes
GATCCACAAAGTTAATGAGG	55	43	yes
GATCCACAAAACCAATAAAA	3	5	yes
GATCCAATTTTGGAAGCATT	9	2	yes
GATCCAATTGTGGTGTTCTG	37	11	yes
GATCAGAAGGCTGAGCACTG	158	103	yes
GATCTGCCACTGAAGTAGAC	10	8	yes
GATCATTGCCAAGCCAGGCT	1	1	yes
GATCCAATGGTTTTGCCTCA	17	10	yes
GATCCAATGGCATCTTCTGG	28	41	yes
GATCCAATGCCATCTTCTGG	19	15	yes
GATCCAATCTTTGTCTTAGG	191	25	yes
GATCCAATCGACTGGGTTTC	591	169	yes
GATCCAATCCCTGTGCAGCA	135	6	yes
GATCCAATATTGTCTTCTGG	2	3	yes
GATCCAATACTGTCTGGAAA	5	4	yes
GATCCAAGTTGTACATGAAT	12	10	yes
GATCCAAGTTCGAAACATGG	1	1	yes
GATCCAAGTGTTTAACCATA	58	51	yes
GATCCAAGTGCCCTTCTGCT	63	24	yes
GATCCAAGTCCAGGAACCCT	579	27	yes
GATCCAAGTCATGATTTGAA	234	26	yes
GATCCAAGTCACCCCCCGAA	21	15	yes
GATCCAAGTATTGGCACCCA	2	3	yes
GATCCAAGGTCAAGGCAGAG	572	45	yes
GATCCAAGGCCTCAGGTCAC	515	38	yes
GATCCAAGGAGTGGTACCCA	19	4	yes
GATCCAAGCTTTGGATGATG	13	8	yes
GATCCAAGCTCTGGGAAGCA	1	2	yes
GATCTGCCAAACGCTATGGC	61	17	yes
GATCATTCGTAGACAAAGTT	36	4	yes
GATCATTCCCACAGCCAAAA	3	3	yes
GATCATGTGCCTACCCTGAC	18	13	yes
GATCCAAGCGTGAGCCAGTC	136	18	yes
GATCCAAGCATTTGAGGAAT	3	3	yes
GATCCAAGCAGGCTTGAATA	31	11	yes
GATCCAAGCAGGCCCCTTAT	30	9	yes
GATCCAAGAGGAGGAGCACA	76	15	yes
GATCCAAGAGACCACCTTTG	35	25	yes
GATCCAAGACCAGGGTGGCT	177	37	yes
GATCCAAGAAGTCAGTCGGC	9	7	yes
GATCCAAGAAGAAAAGCAAG	81	24	yes
GATCCAAGAAAGGAAGAAGA	36	27	yes
GATCCAACGTGTTAGCCTTG	109	38	yes
GATCCAACGTGGTCTTTAAG	56	50	yes
GATCCAACGTAATCTTTAGG	2	2	yes
GATCCAACGAGTAGGAGTGT	2	3	yes
GATCCAACCCCACCTCAAGT	263	18	yes
GATCCAACCCAATTCAGTAT	39	10	yes
GATCCAACCAACCTGAAGAA	1	1	yes
GATCGAGAAGATGCAAGAGT	2	3	yes
GATCCAACATTGTCTTCTGG	17	5	yes
GATCCAACATTGACTTTCTT	1	1	yes
GATCCAACATGGAAGGTGTA	51	48	yes
GATCCAACAAAGGTTGTGAG	648	143	yes
GATCCAACAAAACACGCAGG	2	3	yes
GATCACTTCCTTCTGGAATC	74	16	yes
GATCCACTCCAGCTCCGACC	52	17	yes
GATCACTGTCGTGTTTGGTA	52	10	yes
GATCATGGTTCGGTGGCAAT	4	7	yes
GATCACTGGCCCCGATGGTG	50	3	yes
GATCACTGGAGGCCAGAGAA	39	16	yes
GATCATGCTCTGGCTGAGTT	6	3	yes
GATCCAAATCTTCCAGGCCC	17	4	yes
GATCCAAATATTGTCATAGC	123	13	yes
GATCCAAAGTTGGCCAGCAT	67	6	yes
GATCCAAAGTGTTATGTCAA	4	7	yes
GATCCAAAGTCACACCTCCA	30	21	yes
GATCCAAAGGCAGCAAGAAG	102	8	yes
GATCCAAAGCTTTCCCATTT	51	9	yes
GATCCAAAGCTGCTTAAATC	129	18	yes
GATCCAAAGCAGTGCTCCCA	349	46	yes
GATCCAAAGAGAGAAAGAGC	64	16	yes
GATCCAAAGACTCAGGTGTT	153	35	yes
GATCCAAAGACACAGTCTGT	314	61	yes
GATCCAAAGAAGACAAAATG	35	4	yes
GATCCAAACTTAACGAGCCC	148	27	yes
GATCCAAACCCCAGTGTACC	182	20	yes
GATCCAAACCCAGAGACCAA	62	19	yes
GATCCAAACAAGAAGACTGA	40	9	yes
GATCCAAACAAAGACACAAG	28	41	yes
GATCCAAAATGTGGCATTTT	96	12	yes
GATCCAAAATGCTACTGTTA	30	7	yes
GATCCAAAAGGTTACTGAAA	297	18	yes
GATCCAAAAGGAGACTTCTA	65	5	yes
GATCACTGCAGCCCCAAACT	126	13	yes
GATCCCGCCAAAAGAATTAA	4	7	yes
GATCATGATGTGCTGCCCAG	11	14	yes
GATCTGATGCCCTCTTCGGG	200	57	yes
GATCCTGCACGCGGGCTTTA	13	4	yes
GATCTTCTTGCTGGTCTTGC	24	17	yes
GATCCAAAAGCCTGCTCGGT	14	11	yes
GATCCAAAAGCAGCGTTTGC	118	12	yes
GATCCAAAAGAGCCTGATGG	23	2	yes
GATCCAAAACAGCACGTCTT	43	7	yes
GATCCAAAACAGCAAATAGG	149	10	yes
GATCCAAAAATGGGGATGTT	25	1	yes
GATCCAAAAATGCTGGACTT	37	11	yes
GATCCAAAAATACAGCCTGC	2	1	yes
GATCATTTTTTACTGTGGGT	10	10	yes
GATCATTTTTCTGTAGCCAT	18	3	yes
GATCATTTTGTCGAGTGAGT	168	41	yes
GATCATTTTGTAAAGTACAG	45	17	yes
GATCATTTTCCCAACGTTAC	5	5	yes
GATCATTTTCAAGTTACCCA	18	7	yes
GATCCCCATGTTGAGCTCTC	14	24	yes
GATCATTTTACTGGTGACTT	29	31	yes
GATCACTCCTTGCTTTGCCA	22	12	yes
GATCATCTGCTACCCAGCAG	38	25	yes
GATCACTCAGGGTGGGCAGT	158	29	yes
GATCACTCAGGACGGTACCC	67	16	yes
GATCACTCACGAGAACATCT	85	14	yes
GATCACTGTCAGTATAGCAG	3	3	yes
GATCACTAAGTTGAGCAGTT	11	0	yes
GATCACTAAAGGGTTTCCTG	113	6	yes
GATCACGGTCACTTTCAACA	47	5	yes
GATCATTTGTCCAGGAGTGT	96	9	yes
GATCATTTGTAGGTGGCGAG	2	3	yes
GATCATTTGCGTTTGGAGGT	141	121	yes
GATCATTTGATTCCCCTCCC	8	5	yes
GATCATTTGAAGAACTGTGC	2	3	yes
GATCATTTGAAAACTGAGAA	84	9	yes
GATCATTTCTTTCTGGCCTG	107	32	yes
GATCATTTCTCGCTCAGATT	6	4	yes
GATCATTTCGGTGACTGAAG	62	45	yes
GATCATTTCAGGTGAGCAAT	6	5	yes
GATCATTTCACTGGTGGCTG	520	82	yes
GATCAAGCTTGTGGCTGCTT	34	9	yes
GATCACGGCATCGAAAGGAA	1	1	yes
GATCACTTTGCTCGCAAGCA	23	1	yes
GATCACGATGCCACACCCTG	10	11	yes
GATCACGATAAGCTCATCAG	6	4	yes
GATCACCTTCTTCATACACA	3	5	yes
GATCCTACCTGAGTGGCAGG	15	23	yes
GATCATTGTGAACACCTCGT	29	7	yes
GATCATTGGAGAGGGGTCTG	29	31	yes
GATCATTGCATTTGTTGTCT	7	1	yes
GATCATTGAGAGCAAGCGAG	19	4	yes
GATCATTGACAAACTGGAAG	16	7	yes
GATCAAAAAAGGACACATTC	4	3	yes
GATCACCGCTGCCGCCTGGG	10	13	yes
GATCACCGCCTGCACCGCAG	285	25	yes
GATCATACCCGTCCCTCTCT	2	3	yes
GATCACCCTGTCTCTTTACC	6	7	yes
GATCACCCTGGGCCTGGTCA	286	70	yes
GATCACCCTCAGCTGAAGAC	25	16	yes
GATCATACCCAAAATCTTTG	2	3	yes
GATCACCCCCAGGAAGAGTA	1	1	yes
GATCATTCTCCAAAGGCAAC	293	35	yes
GATCATTCCTAAGTTTTGAC	15	3	yes
GATCATTCAGGACAAAGGAG	257	15	yes
GATCATTCAGACAGTACATT	5	5	yes
GATCATTCACAGAACAGAGT	21	4	yes
GATCATTATGTGCTGAAAAT	2	3	yes
GATCATTAGGGGTTTGGTCT	136	23	yes
GATCATTAGCCCACATACCC	6	8	yes
GATCATTAGCATGCCAGGAA	46	40	yes
GATCGCTCGAACTTAACCAG	7	6	yes
GATCCCGGCAGCACTCGCTC	4	3	yes
GATCATTTTTCAGCCTAGCA	3	4	yes
GATCCAATTTGAACTTGCTT	5	5	yes
GATCCCTAGGGCTTGTGGCT	8	6	yes
GATCCCTTCCCTCCAAACTA	10	9	yes
GATCGGAGCCAGTGGGGTGG	2	3	yes
GATCCTTCTGAATGCCTGCT	190	14	yes
GATCAAGGCTCCCGGTTTGC	22	28	yes
GATCCACAAGAAAGAAAGTG	53	9	yes
GATCCTAACCCTGAACCCCC	6	11	yes
GATCCGTCTTGCCACCAGTG	2	3	yes
GATCCCCACTTATGTGACTG	4	7	yes
GATCCCCAATATGCTGTTGA	45	29	yes
GATCCCCAAGGCAGCTACCA	61	91	yes
GATCTGGGGGGTCCTCACCT	64	82	yes
GATCCCTTCTCTGACCTTTG	494	56	yes
GATCCCTGGCAAAGCCCTCT	3	5	yes
GATCCCAGTGGATGAGCATG	137	32	yes
GATCAGTCTTATCTGGGCAT	1	1	yes
GATCCCGTTTCTTAGCACGT	2	2	yes
GATCTGACAGGACCGCAGAG	14	10	yes
GATCTGACACTCTTCTGGAG	29	22	yes
GATCCCAGCACCGAGGGGAA	1156	86	yes
GATCTCCTTTGACCTCCCAC	6	7	yes
GATCCCGGACGCGAACCCGG	44	9	yes
GATCCACAAAAATTTAACAG	1	1	yes
GATCAGTACAAGGGAAAGCG	5	1	yes
GATCCCAGAATCCAAGAAGT	3	2	yes
GATCCCACTGCACCGCCATT	3	3	yes
GATCCCACTGCACATAGGAC	42729	3755	yes
GATCCCACGGGGTGCAGTGA	806	75	yes
GATCCCACGAAGAATTCTTC	84	10	yes
GATCCCACCTAGCAGCCACC	393	67	yes
GATCCCACCCTCATCCACAG	17	11	yes
GATCCCACCACCATGTTCAG	207	49	yes
GATCAAACGGTCCCTGCGCT	7	5	yes
GATCTGAAGGAGTCCAGGGT	25	17	yes
GATCTGAACTTTGTACAGGA	103	10	yes
GATCCCCTCCCTCATGTTAA	3	2	yes
GATCAAACAACCCAACAGGA	6893	4284	yes
GATCCCAAAGGCTGCACCTT	7	5	yes
GATCCCAAGTTTTTCCTTAA	171	26	yes
GATCCCAAGACCACCCACCT	7	10	yes
GATCTCTTTTCCTGACCCTC	582	54	yes
GATCCCAAAGCCTCGTATGC	125	21	yes
GATCCCCAGTCCAGGATGTG	2	2	yes
GATCCCCAGAACTCCACCTG	13	14	yes
GATCCCCACGTGAGTATCGG	7	5	yes
GATCCATTCTTCACCCTTGA	50	14	yes
GATCTCTCTTCATTTCACCA	21	3	yes
GATCCATTCTGACGTGTGGA	1	1	yes
GATCCATTCGCTGTAACATG	56	13	yes
GATCCATTCCAGAGGGACAT	20	16	yes
GATCCATGTTTTCCAGGTAT	1	1	yes
GATCCATGTTGGGGGTTGGG	59	44	yes
GATCCATGTTGACCAAATGC	42	5	yes
GATCCATGTGTTGGTTGAGA	186	40	yes
GATCCATGTGATTGGAAAGT	13	7	yes
GATCCATGTGATGGACTGCA	85	16	yes
GATCCATGTCCTTTGGCTCC	147	38	yes
GATCACGTACTGTGCCTTGT	15	7	yes
GATCCCCAAGAAGTCTTATT	1	2	yes
GATCCATGGTGGGGCCATTT	25	11	yes
GATCCATGGTAGTCAGATAG	29	10	yes
GATCTCTGTGAGTTCAGGGC	43	28	yes
GATCTCTGTCCGAACTGTGA	149	55	yes
GATCTCTGTCCACTGTATGC	82	56	yes
GATCCAGCAACTGGATGGGG	11	5	yes
GATCCATGGGCCTTAGGGCT	196	13	yes
GATCCATGCTCTGATGAGCG	10	9	yes
GATCCATGCCTGTAATCCAG	17	12	yes
GATCCATGAAGTTTTCAGTC	121	20	yes
GATCCATCTGCATTTGCGGC	3112	245	yes
GATCCATCTGCACATGGCTC	35	2	yes
GATCTCTGGGAAGGGCTGCG	8	6	yes
GATCACAGCTAGTGAGATTA	10	6	yes
GATCTCTGCTCCCCGCCTTT	12	10	yes
GATCTCTGCTATGAGGCTAC	166	21	yes
GATCCCAGGAAGTCCCACGA	82	8	yes
GATCTCTCTGTTCTCCTGTG	53	5	yes
GATCTCTCTCGGCAACTAGG	6	11	yes
GATCCATAGGGAAATTGTCC	6	4	yes
GATCTCTCTCCCTCTACACA	113	10	yes
GATCTCTCGCCTGGACCCCT	60	23	yes
GATCTCTCCCAGATGGTAAA	2	2	yes
GATCTCTCCATATCAAGCGG	2	4	yes
GATCTCTCCAAAGCACACGC	197	20	yes
GATCTCTCAGGCCATGGGTC	110	26	yes
GATCTCTCACGCAGACAGAA	17	4	yes
GATCCCAGAACCTGCAGCTA	47	50	yes
GATCTCGTAGCTGCCTTTTT	48	10	yes
GATCCAGTTTCCTCACAAAT	3	2	yes
GATCCAGTGTGGAAGAGGTG	22	9	yes
GATCAGACACTCAGACTACC	2	3	yes
GATCTCGGGAGATTGGCTGG	16	10	yes
GATCTCGGGAATCAGAGTTC	230	62	yes
GATCTCGGCTCTCCGGAGGG	2	3	yes
GATCTCGCTTACAAGAAACC	32	5	yes
GATCCCACCTCCCCCCAGTC	36	38	yes
GATCACCACCACAGCCCAGC	2	3	yes
GATCTCGCCTTATGTTGTCC	6	8	yes
GATCTCGCCCTGTCAAGCAT	157	31	yes
GATCTCGCAGCCTTCCCCTC	301	9	yes
GATCTCGCAAGCACAAAGCC	171	20	yes
GATCTCGACCAGTTATACCT	18	12	yes
GATCAAAGCATGCACCTGTA	39	10	yes
GATCTCGAATCAGGTCTTTT	17	11	yes
GATCCCACACCCACCTGCTC	3	2	yes
GATCCAGGGTGGGAAGGAAG	207	26	yes
GATCCAGGGGCACTGCCCCT	2	3	yes
GATCTCTGTAAGTTCATGGC	13	14	yes
GATCCAGGAGACTCGAAGAT	306	39	yes
GATCCAGCTTCCCTCCGAGA	444	59	yes
GATCCAGCGAGGGAGCTGCC	44	4	yes
GATCTCCGTTGATGTAGTGA	27	19	yes
GATCTCCGCCCGAGCCTACG	58	9	yes
GATCCAGCATGGGTGTCCCG	64	39	yes
GATCCAGCATCACCCAGACA	45	3	yes
GATCCAGCAGACCCAGCACA	102	17	yes
GATCCAGATTACTATGGGGA	15	1	yes
GATCCATTTTGTTCGTGGAC	12	4	yes
GATCTCCCCTCTTCCTGGAT	143	10	yes
GATCCAGAGTAAAGACAGCT	77	4	yes
GATCCATTGTACTACAAGTT	48	3	yes
GATCTCCCCACCACCCCAGG	77	56	yes
GATCCATGCTTTGCCCGAGA	48	8	yes
GATCTCCAGGGTGGATTTCT	20	15	yes
GATCCTGCTCACCTTGGGCT	2	3	yes
GATCTCCAGCCTCGCCGTGA	14	10	yes
GATCTCCACACAGCACACAG	522	13	yes
GATCTCCAAGTCTCTCAGTC	13	11	yes
GATCTCCAACTGTGCTTTCA	15	20	yes
GATCTCCAAAGAGTTACTCG	8	11	yes
GATCCATATCCTGCTCCACC	10	1	yes
GATCTCATTGCTGGAAGGAG	25	4	yes
GATCCTGCCATGCTTCCTGC	6	5	yes
GATCGCTTATCATGTCCTTG	1	1	yes
GATCCTGCTGCAAGATTTGT	51	13	yes
GATCGCTGCTGTGTTTTATG	3	5	yes
GATCAAGCCAAAGAACTCCA	6	2	yes
GATCACCCAGGAAGAGAAAT	151	16	yes
GATCTGAGAATTCTCCCTGG	13	10	yes
GATCACCATCCTGATTATAT	70	22	yes
GATCAGTTCCTCTTCAGAAT	2	4	yes
GATCACCAGAAGCCATGCTC	154	59	yes
GATCATTAAGACCCTGTATC	3	2	yes
GATCATGTTGATTCTGAAAT	8	11	yes
GATCATGTTCTTTCCGCAGG	2289	221	yes
GATCATGTTCGCCTGGACAC	182	12	yes
GATCATGTTCCTGGAGGTCA	65	13	yes
GATCATGTTACACTTGCCAG	82	10	yes
GATCATGTGTAAGTGTCAAA	22	20	yes
GATCATGTGGCGTTCTCTCT	6	4	yes
GATCATGTGGATTCCAGGAA	3	5	yes
GATCATGTGGATGCCTTCCC	39	27	yes
GATCAGTCCTCTTCAGTTTC	2	2	yes
GATCACATTCGTTCATCAAG	9	7	yes
GATCACATGGTGACTCTAGC	97	5	yes
GATCACATGACCCCTGAAAT	1	1	yes
GATCCTCCTGTCTCTACCTC	56	4	yes
GATCATGTGAGCATCGTGGA	124	52	yes
GATCATGTGACAAGTGAGAG	30	21	yes
GATCATGTCTTCTCCATGTT	335	1	yes
GATCATGTCTGTGAAATGAC	30	21	yes
GATCATGTCTGAAAAATCCA	15	11	yes
GATCATGTCTCAAGGTGGCA	19	13	yes
GATCATGTCTATCTCAGGGG	197	38	yes
GATCATGTCCCACAGGCATT	21	5	yes
GATCATGTCATTGCCTGTTA	73	29	yes
GATCATGTCAGATTATCACC	10	7	yes
GATCATGTCAGAGGGAGATG	19	28	yes
GATCATGTACAGAGGTCTTT	20	29	yes
GATCATGTACAAGCTGATGG	202	65	yes
GATCATGGTTCTGATGAAGC	3	5	yes
GATCATGGTCTTCGGAAAAC	4	3	yes
GATCATGGGTGTTGCTACCA	35	28	yes
GATCATGGGTGTGCCAGGGG	62	22	yes
GATCATGGGGTTCAGTCTTC	6	4	yes
GATCATGGGGATGGACGGGG	21	16	yes
GATCATGGGCTTTCTGCTTC	9	13	yes
GATCACAGTTCATGTAATGC	35	6	yes
GATCATGGCCTTTACGATGC	53	15	yes
GATCATGGCCTTCAGATATG	106	18	yes
GATCATGGCCCAGACCTGAG	56	39	yes
GATCATGGCAAAGGATGACC	114	82	yes
GATCATGCTTTCTTCTCTAT	135	13	yes
GATCATGCTCCTGCAGCTGA	159	10	yes
GATCATGCTCCTGAGTGGCA	54	9	yes
GATCATGCTCATCTTCACTG	95	11	yes
GATCATTGGGGGAGGGTAGT	24	3	yes
GATCATGCTACGTTTTGTCT	35	7	yes
GATCATGCTACCACTGCATC	19	13	yes
GATCATGCGCCTTTCTAAGC	121	31	yes
GATCATGCCTGGGGGAGCCC	2	3	yes
GATCACAGTGGCTATATCTC	34	23	yes
GATCACAGCTATGCCCTTTC	15	4	yes
GATCAGGAAAATCTCTCATT	18	5	yes
GATCGTGTGTTGCCATTTTG	22	3	yes
GATCACAGCAGCCCAAGCTC	28	19	yes
GATCTCACTCTCCCACACTA	6	7	yes
GATCCGGGGGCTGCTGGGAA	3	3	yes
GATCATGCCGTGCTACGCTC	48	38	yes
GATCATGCCCAAAACAACCA	51	36	yes
GATCATGCAGACTGTTCCTT	692	486	yes
GATCATGCAGAAGAACGGTG	66	14	yes
GATCATGCACTGTATTCACA	19	7	yes
GATCATGATTCTCCCTCAGC	17	16	yes
GATCATGAGGGAGTTCCGGT	280	97	yes
GATCATGACTCAGTATCAAC	20	4	yes
GATCATGACATTCCTCAGAT	3	5	yes
GATCAGCTGAGCGTCAGGGT	1	1	yes
GATCACAGACCATGGTCTCA	58	11	yes
GATCACAGAATGGAAACAGC	5	5	yes
GATCAGCTAAGCCTCTTGTT	3	2	yes
GATCCCAGAATCCCCCTCCT	4	7	yes
GATCATGAACATCATCCAGG	234	71	yes
GATCATCTTGTTGCGTTTCT	36	7	yes
GATCATCTTCACTCAGCCAG	2	2	yes
GATCATCTTCAATTCTATCC	9	8	yes
GATCCTTTCGGCTGAGCCTC	6	4	yes
GATCATCTGGTGCTGTGTCG	25	16	yes
GATCAAGAGAAGAACCATTT	2	3	yes
GATCATCTGCCCTTTCTATC	49	35	yes
GATCTACATGGCCGACCTGG	2	2	yes
GATCATCTCTCACCACAGGC	11	8	yes
GATCATCTCCCCCTTCAGTG	4	4	yes
GATCATCTCACAGGACAGGG	500	78	yes
GATCACACCACTCTCAACCA	28	15	yes
GATCACACATCTGGGCAGTG	38	12	yes
GATCAGCCTGGCTCCAGGGA	19	12	yes
GATCTTTCTCGTTGGATGTT	1	1	yes
GATCACACAACCCACCTCAG	12	13	yes
GATCTCTGTGAGTTCGAGGA	16	17	yes
GATCTCTGTAACAGAGCCTC	5	5	yes
GATCATCTACGACAGAAAGT	25	16	yes
GATCATCGTGTCGGGATGAT	69	25	yes
GATCATCGTCAGTGACGTTT	21	27	yes
GATCATCGGCATGGCATACG	616	104	yes
GATCATCGGACGGCCAGTTG	4	6	yes
GATCATCGAGTTGTGGATGG	119	7	yes
GATCATCCTTGTGTTGTGAA	122	20	yes
GATCATCCTTCAAAGGGGAT	17	11	yes
GATCATCCGCAAAGTTGTGA	1	1	yes
GATCATCCAGGGCTGCCCCT	33	7	yes
GATCATCCACCTGCTCACTG	788	403	yes
GATCATCCACAAACTTCCAG	40	26	yes
GATCATCCAAGTGTTTGAGC	9	4	yes
GATCATCCAAGCTGTTGTAA	10	7	yes
GATCATCATTCGTGTGCAGA	35	12	yes
GATCATCATGTGGTTAAAAG	2	3	yes
GATCATCATGCTTCCAGATG	36	26	yes
GATCTGCCATTTGCTGCTTC	3	2	yes
GATCACAAGCCAGAACTTCC	6	2	yes
GATCACAAGATGGCGTTATC	49	12	yes
GATCAGGTCATCGCCTCCTT	1649	103	yes
GATCAGGGTTAAGGAGGAGC	174	47	yes
GATCAGGGAAGCAGACATTG	241	4	yes
GATCTGTTGAAGAACTCAGC	21	22	yes
GATCAGGCGAGACATGTTCT	218	4	yes
GATCAGGAAGCAAAGAAAGA	140	53	yes
GATCAGAATTAAAAGTGGAT	32	13	yes
GATCAGGAAAAGAAAAAGCA	45	39	yes
GATCAGCTGTGGGCTCTGGG	93	11	yes
GATCATCATCCTGACTTTAG	12	13	yes
GATCATCAGTCTTTTATTGT	1	2	yes
GATCATCAGCTGAGGCAAGG	3	5	yes
GATCATCAATGACGACCTGG	4	6	yes
GATCATCAACAAGACTATCT	2	3	yes
GATCGTGAGTGGGAAGCTGC	1	2	yes
GATCATAGGATTCTGATTTT	29	10	yes
GATCATAGCTTCCTGTCCCC	26	17	yes
GATCTCTCCCAGGCTTGCTG	9	6	yes
GATCGTGTCCACTCAGCGGA	3	4	yes
GATCACAAACATAGCCAATG	144	25	yes
GATCGGCCCCAGGGCGACGT	2	1	yes
GATCAATGCCTGGACGGCTC	1535	717	yes
GATCAGCTCTGTAGCAGCAG	2	2	yes
GATCAGCGTTTGATTCCCAG	1	1	yes
GATCAGCGTGCGCCTAGCGG	497	33	yes
GATCAGCGACCTTCCAGCAG	13	11	yes
GATCAGCCTTCAATAGCCAT	60	4	yes
GATCAGCCCTGGCAAGGAAG	125	17	yes
GATCAGCCCAAAATGAGCGA	8	6	yes
GATCAGCCATAGTGCCACTC	6	4	yes
GATCCCAGCTGTTTGGGGCT	13	17	yes
GATCATAGCTGATGGCCTTC	13	9	yes
GATCATAGCTCTAGCAGAAC	7	5	yes
GATCATAGCTACTTTGTGCT	58	15	yes
GATCATAGCAAAGATGGACG	81	13	yes
GATCATAGATGACTTTGCCT	54	38	yes
GATCATAGAGGTGTGGCTTT	4	3	yes
GATCATACTGTTAGTCGGCT	31	4	yes
GATCATACGTAGTTGTGAAA	14	10	yes
GATCATACGCCCAGGGAGAG	10	11	yes
GATCATACCCTCTCTGGCTT	8	4	yes
GATCATACCAAGAGGTGAGG	606	92	yes
GATCATACAATCCCAGAAGG	12	13	yes
GATCATAACAGTTCTGTGAA	8	10	yes
GATCCTTTGGACCGGGCTTT	24	36	yes
GATCCTGGACACGAGTGTTA	2	2	yes
GATCAATCAGAGGGATTACC	259	17	yes
GATCACTAAGACTTGAATCC	8	7	yes
GATCAGCAGGTGGTTATCAA	98	24	yes
GATCAGCAGCTGCTTTTGCA	30	38	yes
GATCAGCAGATGTTGGTGGC	2	2	yes
GATCAGCACTGGGGTCAACG	51	8	yes
GATCAGCACTCTCGGTATGC	267	36	yes
GATCAGCACGCTGACTCTTT	128	12	yes
GATCAGCACCACACTGGACT	9	8	yes
GATCAGCACAGCCTCCTTAG	13	14	yes
GATCAGCAAATTCAGAGATA	6	9	yes
GATCCCAGAGGAGTCAGAAG	6	5	yes
GATCAGAGTGTCACGGTAGG	14	2	yes
GATCACAGAGGTCCGCAGTA	13	5	yes
GATCAGAGCCCTGTCGATGG	33	24	yes
GATCAGAGAAACTGGGTAGA	20	15	yes
GATCAGACTAACCCCGGAGT	85	72	yes
GATCAGACCATGGTACTGGC	100	20	yes
GATCAGTTTTTGGTGTCATT	876	152	yes
GATCAGTTTTGGTCTTGATG	31	6	yes
GATCAGTTTTGGAGTGCAGC	2	2	yes
GATCAGTTTTGACCTCTTAT	185	27	yes
GATCAGTTTGTTTTCACTGT	43	11	yes
GATCAGTTTGCCAATCATCT	6	9	yes
GATCAGTTTGATTTGTTCTG	1	1	yes
GATCAGTTTCTGTGTAGTCT	3	5	yes
GATCAGTTTCAGCCAGGAGT	6	4	yes
GATCAGTTTATGATTCAGTT	10	3	yes
GATCAGTTTATCAGTCCGTT	77	21	yes
GATCCTCCTTGGTGTCTGGT	1	1	yes
GATCAGTTGCCAAATGATTG	61	13	yes
GATCAGTTGAAACTTGGAAA	16	3	yes
GATCAGTTCTGAGCCGAGGA	29	3	yes
GATCAGTTCCTGGTATACAG	20	16	yes
GATCCTATTGAAGAAGCAGA	29	23	yes
GATCAAGTGCTGTGACAGTG	11	4	yes
GATCAAGGTGGCGGAGGACG	5	8	yes
GATCAAGGTCGGAAAGAAAT	719	89	yes
GATCAGACAGTATCAGGGCT	25	21	yes
GATCAGAAACCCGAGCTGAA	19	12	yes
GATCACTTTGACTTCATCCT	120	8	yes
GATCTGTGCAAAAGCAGTGA	1102	129	yes
GATCACTGCTGTAGGAAAGC	20	14	yes
GATCACTGCTCTGGACCTAA	3	4	yes
GATCACTGATACTTCCTGGG	15	16	yes
GATCAGTTCCATGTTACACA	13	13	yes
GATCAGTTCAGTGTGCATCG	57	24	yes
GATCAGTTCAGACAACTGTG	6	6	yes
GATCAGTTACTGCCACACCC	5	5	yes
GATCAGTGTTTCTGCGAAGG	36	24	yes
GATCCCTCTCTACCCACCGG	2	2	yes
GATCCCAACATGCTAGATAC	2	3	yes
GATCGGCGTGACTACCCCTT	33	10	yes
GATCAGTGCTGTACTTCACT	39	29	yes
GATCAGTGCTCTGCTAACGC	623	66	yes
GATCAGTGCCTTTGTTGGCA	89	58	yes
GATCAGTGAGTGTGAGTGTG	3	2	yes
GATCACTGGGTGGGGAGAAG	5	5	yes
GATCATACGGAGCATGAGAG	12	4	yes
GATCACTCAGTAACTGCTGG	48	6	yes
GATCACTCAGGATTTGTTCC	15	10	yes
GATCACTCAGCCCTTGAGCA	34	22	yes
GATCACTACTCCTTAGACGT	138	28	yes
GATCACGTTTGTGTTGTCTT	5	1	yes
GATCACGTTGAGTTCTATTT	25	4	yes
GATCACGTTCTGATTGAGCT	87	8	yes
GATCACGTTAGCCACAGGAC	2	2	yes
GATCACGTGTCCAAAGGTGA	30	51	yes
GATCACGTGTATGTGTCGTG	101	33	yes
GATCACGTGGGCTGCGTTTC	389	46	yes
GATCACGTGGCTGTTCTTGT	10	10	yes
GATCACGTGCCTGAGGTATG	14	9	yes
GATCACGTGACCACCCTTTC	44	29	yes
GATCACGGGAGCTGAGCAAC	17	3	yes
GATCACGGAGCTGGAGTTCG	578	91	yes
GATCACGGAGCCAAGGAAGA	10	10	yes
GATCACGCAGTCTTAGAAAT	120	24	yes
GATCACGACGACGCCCACGC	82	10	yes
GATCACCTGCTCTAATGTCC	167	163	yes
GATCACCTGCCAGACTGTTA	19	7	yes
GATCACCTCCCAGATTCTGA	148	25	yes
GATCACCCACCCATCAGCCA	56	50	yes
GATCACCAACTCACGTCATG	245	38	yes
GATCACCAAAAACATCCAGG	6	4	yes
GATCACATTGGCTGCGTGCT	1	1	yes
GATCCATCCCACCTGCTCTG	10	6	yes
GATCACAGTGAGATTCTCAT	56	6	yes
GATCAAGTCCTGCTACTACT	3	2	yes
GATCACAGGTCTGAGCAAAG	66	5	yes
GATCACAGGATTGGCGTCCC	11	12	yes
GATCACAGGAGCAGCCCCGG	4	4	yes
GATCACACTTGGGGAAGATG	6	5	yes
GATCACACTGGAACAGAACC	113	17	yes
GATCACACCTGTGGGGTCAA	76	53	yes
GATCACACCTGTAGACAAGA	35	30	yes
GATCACACCCAAAGCTGTCC	205	23	yes
GATCACACAGGGAGGCCTTG	305	2	yes
GATCACAAGGTGCTCCTGCA	54	36	yes
GATCACAACTGATGGCGGGT	582	122	yes
GATCACAAACACCGGTGAGA	10	8	yes
GATCAATTTCATCCACAAAC	133	26	yes
GATCAATGTCGTCATCATCC	53	35	yes
GATCAATCTATGGGAAGACT	17	28	yes
GATCAATCACCAGCGCGAAG	200	31	yes
GATCAAGATTTGGCCAATTG	58	41	yes
GATCAGGAGGTGAACAGAGA	13	11	yes
GATCCCTGTCAGCTAGCTGG	145	8	yes
GATCACAACATGGACAACAC	7	6	yes
GATCAACTCATGGAGCTGGC	88	22	yes
GATCAACTCAACAGCCACAC	3	4	yes
GATCAACCCGTGTGCATTGC	6	4	yes
GATCAACCCCTACCAGCCAG	38	25	yes
GATCAACCAGGTGGCCTTGG	51	33	yes
GATCAACACTTTTCTCTCAG	22	14	yes
GATCAAATTCCCAGGGACAT	22	16	yes
GATCCAGCTGGAATCTAAAG	7	10	yes
GATCCGAATCTGTGCCCAGC	230	5	yes
GATCCTGAAGGAAGTCCTGA	30	2	yes
GATCCCAGCATCGGCAAGCA	7	12	yes
GATCCCTCTCTCACACTCCT	10	7	yes
GATCCCACTCTGAGTCCAAA	1	1	yes
GATCCCGTGTTCCTTTCAGC	1	1	yes
GATCAAATACTCTGCACATA	94	8	yes
GATCCTCCTGGGCTTGAACT	20	30	yes
GATCGACACATGTGTGGGGA	16	11	yes
GATCCCTTTATGAACCTTGT	25	18	yes
GATCAGTTTCTCTCACTTAT	5	3	yes
GATCAGTCACAGCTTGTGCC	10	8	yes
GATCCCAGCCAGCACCACGG	4	4	yes
GATCCAGAGGCCCTAGCCAG	25	9	yes
GATCCAGAGGCAGTTCCAAG	3	2	yes
GATCCAGAGAGCTTCCTAAA	51	5	yes
GATCCAGAATGTGTGGCAAC	4	7	yes
GATCCAGAACACTTGACACT	6	6	yes
GATCCAGAAATTGGAGATAA	5	1	yes
GATCCCTCTTGGTTTGTGAC	9	4	yes
GATCAGGTCCACCCTCCAAC	10	8	yes
GATCCACTGCGTTTCCATGC	337	60	yes
GATCCACCTTGTGGCCTGGC	384	5	yes
GATCCACCTGTCTCTCCTTC	2	3	yes
GATCTCATGGCCAAAGTAAG	52	7	yes
GATCCCTCCCATGTTGGGAG	4	7	yes
GATCCACCGTACCAGGAAGC	282	32	yes
GATCCACCCCTACAGAAAGA	28	10	yes
GATCAGGCGAAGCAACTGCT	2	3	yes
GATCTCAGAGGTAGGGTGGC	11	16	yes
GATCCTGCCCCCACGCTGGG	27	1	yes
GATCCCAACAACTGCTGCAG	4	2	yes
GATCCACATAGTGCTGCTGC	23	16	yes
GATCCACAGCAGTTATGCTG	13	14	yes
GATCCACACAGGAGAGAAGC	186	18	yes
GATCCAGGACAGCCAGAGCT	91	25	yes
GATCTCACTGTGTCGCTCTG	2	2	yes
GATCCAGGACACAGCGTGGT	32	23	yes
GATCTCACTGGACTTGGTGT	278	7	yes
GATCCCGTGTAGCCTTCGTT	30	4	yes
GATCCAGGAACCGAAGAATG	84	14	yes
GATCTCACTAACCTGCCACC	36	5	yes
GATCCAGCTGCAGAAGCCAG	2	1	yes
GATCTCACGGCCTGCGGGGT	115	21	yes
GATCCAGCTCTCTTAGACAG	46	16	yes
GATCTCACGGCCAGACAGAC	135	14	yes
GATCTCACGCCTCTTGGGGA	7	5	yes
GATCTCACGCCTCTGTGCAT	25	18	yes
GATCAAGCCTAGCCAGGACC	40	8	yes
GATCCAATTTCATCGCTGCA	3	2	yes
GATCCAAGTTATTGGCACAC	8	6	yes
GATCCAAGGGCCCTGTATGT	65	4	yes
GATCCAAGGAGCTGGGGAGG	23	9	yes
GATCCAAGGACAAGACACCA	18	12	yes
GATCTCACAGTTAGTAGTCA	54	37	yes
GATCGAGTGTATCACGCAGG	18	12	yes
GATCTCAAGAACAAGAACCT	6	9	yes
GATCCAGCAAATCGGGACAG	81	15	yes
GATCTCAAAGGGAAACTGAC	9	8	yes
GATCTCAAACGGGCACTTAA	1	1	yes
GATCAAAGTAACCTCCAAAA	8	8	yes
GATCCCTTACAAGATGGTCT	11	4	yes
GATCCCTGCTCAAGCTGCTG	25	19	yes
GATCCAACTGACTGGCTAGC	408	15	yes
GATCCAACTGACAGATGAGG	8	4	yes
GATCCAACTCTGTAAAGGCT	19	3	yes
GATCCAACTCAGTTAGGCTT	10	6	yes
GATCCAACTCACCCCATCAG	235	154	yes
GATCCAACGCAGCACCGTCT	65	12	yes
GATCCAACCCCCTCTCCTGA	28	2	yes
GATCGAGCTGCTGCTGCTGA	34	8	yes
GATCGAGCCAAGAGCTGTAA	71	13	yes
GATCGAGCAGGCCCGGCTGC	31	9	yes
GATCCAAAGGCAAATAATGG	14	21	yes
GATCCAAAGACGCTAGATGT	207	144	yes
GATCTATTCTCCCACTGGAC	13	10	yes
GATCAAACCCGGCTTCCGAA	2	3	yes
GATCCAGACCCTTCCCAGAA	30	21	yes
GATCTATGTCATGGCCACGC	79	19	yes
GATCTATGGAGGACGGCAGA	18	15	yes
GATCTATGAGACAGAACTGG	79	22	yes
GATCCAGTGACTCCTGGGGA	10	7	yes
GATCCAAAAGGAAGCAAATT	33	16	yes
GATCCACTTGCGTTGTGAGC	63	19	yes
GATCTACTTGTGTGTGTGTG	70	3	yes
GATCCACTCTGAGGGAGAGG	2	2	yes
GATCTACTGTGTGACACCTG	11	9	yes
GATCTACTCCTTCAGAGCCT	21	3	yes
GATCCACGGGGTGACTTCCA	4	4	yes
GATCTACGGTTCCCACGCAT	59	39	yes
GATCTACGGCCTGGACTTCT	6	7	yes
GATCCCCAAATTCCAGCATC	1	1	yes
GATCCTCCCGATGCCCATCT	2	3	yes
GATCATTTCGGGTGACTTAA	63	41	yes
GATCTACCTGTTCTCCCTGC	23	6	yes
GATCTACCTGACCTTGTTGA	22	4	yes
GATCTACCTCCATAGAGATG	1	1	yes
GATCTACCTACCCGTGGTGT	13	6	yes
GATCTACCAGGTGGACACCC	97	12	yes
GATCTACAGGGCACAGAGGG	26	8	yes
GATCTACAGCGTGCCCTGGA	8	5	yes
GATCTACAGCACTGCCTTTC	10	7	yes
GATCTACACACTCCCTTTTT	1	2	yes
GATCCACCAGCGTGTGCATG	67	10	yes
GATCCATCTTACAGCAGGAG	2	2	yes
GATCATTCTGAAGTACATTG	31	9	yes
GATCATTCCAAGTTTCACGT	22	10	yes
GATCTACAAAACACAGGGAG	125	13	yes
GATCTAATAGGACTTCTGTT	10	7	yes
GATCCACACAATGGAGACCT	91	14	yes
GATCTAAATCTTTCCTCAGC	11	16	yes
GATCTAAACTGTGGTGTGAA	33	22	yes
GATCAGAGAAGCAGATATTT	137	215	yes
GATCCAGAGGAGAAACTAAG	2	2	yes
GATCCTTCCCATCCCACTCT	7	10	yes
GATCAAGGCGGCTGCAGCGG	1	1	yes
GATCCAATTGTGTGCTGTGC	6	4	yes
GATCGTGTGGAGTGAAAGGC	1	1	yes
GATCGTGTCCGGCATGAAGT	884	80	yes
GATCGTGGTGAGGAGGCTGG	7	3	yes
GATCCCCTTCCAGCTCCATC	35	12	yes
GATCCTCTCAGAACTTTTGT	4	4	yes
GATCGTGGTCCAGAGGAGCA	2	3	yes
GATCCAAGGCGGCGACCCGA	228	17	yes
GATCGTGGGAGTGGCAAGCG	9	11	yes
GATCGTGGGAACCATTGTCA	33	14	yes
GATCGTGGCTAGTGAGATAG	36	8	yes
GATCGTGGCAGTAGCTCCTG	13	20	yes
GATCCAAGGACTGCGGTGCA	226	25	yes
GATCCAAGAGGCTGTTTTCG	35	14	yes
GATCGTGAGGATGGAGAAGG	44	11	yes
GATCGTGAAGCCGCTGAATC	32	6	yes
GATCTTTGGAGGAATCACGG	16	14	yes
GATCGTCAAGTGGTCAGATG	34	15	yes
GATCGTATCCCCAGGCGTGG	13	6	yes
GATCGTAGTAGTTCCTGTTG	30	22	yes
GATCGTACGGCTGTAACAGG	11	12	yes
GATCCAACCATGACCAGGTG	10	7	yes
GATCGTAAGTTCTGGGACGC	23	7	yes
GATCGGTGTCGAGCACGGAC	14	9	yes
GATCTTTTGGAGAGGGCAGG	6	7	yes
GATCGTGGCGATGGTTGAGC	3	5	yes
GATCCCACAAGCCATATTCT	36	4	yes
GATCAGTCTTTTCAGTATTT	33	6	yes
GATCAGTCTCGTCTACAGAG	9	4	yes
GATCAGTCTATGAGTCAATA	11	8	yes
GATCAGTCGTAAAGGACTCA	23	8	yes
GATCAGTCCTCTAGCATTTC	245	139	yes
GATCAGTCCTACAAAGTTCC	121	28	yes
GATCAGTCCCTTCCCCCAAC	62	8	yes
GATCAGTCCAGTTTTGGCTG	40	34	yes
GATCAGTCATTGTCTTGATA	10	7	yes
GATCAGTCATCAAAGAACAC	17	15	yes
GATCGGCTGCTTTTGTCTCT	42	17	yes
GATCGCTTTAGCTTGCCTAC	5	3	yes
GATCAGTAGGAAGCACAGGT	3948	432	yes
GATCAGTACTGCAGTTCCTG	31	6	yes
GATCAGTACTACTGTGGTGT	18	11	yes
GATCAGTAAGGATTCCTGTA	58	9	yes
GATCAGGTTTGGACTCCTTC	21	3	yes
GATCAGGTGTTTGGATGGCA	23	16	yes
GATCAGGTGTTCAAAGTCAC	3	5	yes
GATCAGGTGTCAGTTTTCTA	108	76	yes
GATCTGCGATGAACTGGGAG	795	97	yes
GATCAGGTCAGAGATGCGGT	545	90	yes
GATCAGGTAGAGAGAGCTTG	7	10	yes
GATCAGGGTGTGTGCCCACG	2	3	yes
GATCAGGGTCCTCCTTCCCT	9	6	yes
GATCAGGGGGAAGGGGTCAG	8	8	yes
GATCAGGGCGTGGTAGAGAA	40	27	yes
GATCAGGGCCGTGTGGATGC	64	2	yes
GATCAGGGCCGAGTGATGAG	42	0	yes
GATCAGGGCCAGGGGAGGTC	416	117	yes
GATCAGGGCAGAGATGGAAG	8	9	yes
GATCAGGGCAAGGGCTAGCC	41	27	yes
GATCAGGGCAAGAGGATTGT	79	32	yes
GATCAGGGCAAAGTGGCTTT	12	9	yes
GATCAGGGACTCTTCGGTGT	5	8	yes
GATCAGGGAAGTTCATTGTG	70	56	yes
GATCAGGCTTGGCACATGAC	10	11	yes
GATCAGGCTGAGCTGAATGT	49	5	yes
GATCAGGCTACTACAAAGTT	945	10	yes
GATCAGGCGACAGTGAAGAT	12	7	yes
GATCAGGCCTGGAGCCCCAG	2	4	yes
GATCAGGCCTGAACCCGTCC	147	28	yes
GATCAGGCCCACAGCCGAGT	59	11	yes
GATCAGGCCATCAAGTCACA	25	17	yes
GATCAGGCCAAACACTTGGG	1022	930	yes
GATCAGGCACTTGAGTTTCA	3	4	yes
GATCAGGAGTTTAAGTGGTT	6	4	yes
GATCAGGAGTTCCAGGACAG	46	16	yes
GATCAGGAGTTACTATCCAG	9	15	yes
GATCAGGAGTCCTTTGAGTG	3	5	yes
GATCCTGATGACGTTCGGAT	19	6	yes
GATCAGGAGGGTCTATTTCC	23	16	yes
GATCAGGAGGGTCAGCTGTG	290	107	yes
GATCAGGAGGCAGTGTGTGG	20	14	yes
GATCAGGAGGAGAAAGTGAG	23	2	yes
GATCTTTCTCAAGAGCAGTG	7	5	yes
GATCAGGAGCACCTGTGGCT	185	38	yes
GATCAGGACTTGGTGGAAGC	21	7	yes
GATCAGGACTCCTGTGACTC	39	14	yes
GATCAGGACCTCATTTCACG	67	30	yes
GATCAGGACAGCAAAGACAG	1	1	yes
GATCAGGAATGTGTGCAGCA	33	28	yes
GATCAGGAATCCAGGCCAGG	44	38	yes
GATCTTACCTGGAGGCAGCT	44	21	yes
GATCAGGAAGATGACTGGCA	2	4	yes
GATCAGGAAGATGAACACTT	30	6	yes
GATCAGGAACTCCAGTTCAT	17	4	yes
GATCCGTATGGGCACTGACA	4	7	yes
GATCAGCGGTGGGAATGACA	934	133	yes
GATCAGCGCTATTTCCTGAG	43	21	yes
GATCAGCGCCTCCAGTTCCT	47121	4310	yes
GATCAGCCTTTTCTGTCTTG	26	11	yes
GATCAGCCTTCAGTTCATTT	2	3	yes
GATCAGCCTGGGCCACCTTG	44	37	yes
GATCAGCCTGCTCCTGGGGC	21	14	yes
GATCAGCCGTTCCTCTGGTG	152	15	yes
GATCAGCCGCTCAAGATTCT	664	19	yes
GATCAGCCCGACTGTCTGCT	12	12	yes
GATCAGCCCATCGCAGCTTG	2	3	yes
GATCAGCCCATCCACTCTTT	7	5	yes
GATCAGCCCAGCCCATGTGA	294	24	yes
GATCAGCCCACTCAGCCTAA	10	9	yes
GATCAGCCATTTCTTGGGGT	33	4	yes
GATCAGCCAGTATCTTGAGT	4	7	yes
GATCAGCCACTTAGAATTCA	20	14	yes
GATCTCTGTCTTCGTGTGCG	13	3	yes
GATCCCTCCCCTCTGTCCTT	1	2	yes
GATCCACCCGTCACCGTAGC	8	6	yes
GATCAGCCACAAGATTTCAT	54	13	yes
GATCAGCCAAGGGTTCAGAG	8	6	yes
GATCAGCATGGTTGTTCTTC	40	51	yes
GATCAGCAGTGTCGGCCATT	207	36	yes
GATCAGCAGTGCCTTGTGTT	143	5	yes
GATCAGCAGGGATTATTCCA	34	26	yes
GATCAGCAGCCTACGACCTT	21	14	yes
GATCAGCAGAGTGGTTATGG	90	4	yes
GATCAGCACTCTGCCTCCAA	50	11	yes
GATCAGCACTCAACCATTCT	29	3	yes
GATCAGCACTAAGACTGCTA	97	67	yes
GATCAGCACCTTGAAGAAGT	10	7	yes
GATCAGCACCTCTCCAAGAA	9	13	yes
GATCAGCACAGGGTCAACTA	55	38	yes
GATCAGCAAGTGACATTGAT	29	4	yes
GATCAGCAAGTCAGGAGTCA	31	27	yes
GATCAGCAAGCAGGAGTGCG	1080	414	yes
GATCTCACTGCCTGTCTAGC	28	19	yes
GATCATCCCGCGGGACCTCT	299	42	yes
GATCAGATTTGTCCACAAGG	61	18	yes
GATCAGATTTGGTCTATCGG	10	1	yes
GATCAGATTGTCTCTGTTCT	10	9	yes
GATCAGATGTTTTGGGAAGT	1	1	yes
GATCAGATGATAAACCAGTG	1	1	yes
GATCAAACCCCGCTACACGT	18	14	yes
GATCCCACGCCCAGGGCCAC	18	15	yes
GATCAGAGTGTGTCCTGCTT	6	4	yes
GATCAGAGTATTCCTGCCAG	10	8	yes
GATCGTGCCCGCCACCTTGC	10	8	yes
GATCGTCGATTGGCAGCTTG	18	7	yes
GATCAGAGTATGTCTTGTGT	8	7	yes
GATCAGAGGTTCAGAATATC	8	11	yes
GATCTCCACTCTTCATGACT	33	2	yes
GATCCCTATGAGTTCAAGGC	2	3	yes
GATCCCCAGAGACAGAACTT	40	10	yes
GATCAGAGGCTCCCAACTGG	65	48	yes
GATCAGAGCTCCAGGCTTGG	36	24	yes
GATCAGAGCCGAACCTACTT	17	11	yes
GATCAGAGCCAAGAAACGCC	123	26	yes
GATCAGAGACAAGTTCATTA	35	6	yes
GATCCTTCTCAATTCACAAG	7	5	yes
GATCCAGACTCCAGTCCCAG	2	2	yes
GATCAGACTGGTGAGAAAGC	59	5	yes
GATCAGACCTGTGGCTGAGT	59	10	yes
GATCAGACCTGGGCGTGAAA	10	18	yes
GATCAGACCGTTGGGTGGAC	11	12	yes
GATCAGACCCAAAGAAAAGT	41	4	yes
GATCAGACCATTGAAACCAC	9	9	yes
GATCAGACACTTCAAAATCT	1	1	yes
GATCAGACACTGACTGGTGA	40	5	yes
GATCAGACACTCCCTCACCA	42	28	yes
GATCAGAATGTTCTCAACTT	10	7	yes
GATCAGAATGAACTTGCCAA	12	11	yes
GATCCTGAGGCAAAAACCTC	8	2	yes
GATCAGCTCCTCTCGTCTGA	21	5	yes
GATCACAGGCTACCTGTTAA	6	6	yes
GATCTCTCCCTCATATAACT	36	24	yes
GATCCTAATTGCTTAGGTTT	22	1	yes
GATCCCGCCAAAAGGATTAC	13	4	yes
GATCCGTCGCCACTGGGGAG	3494	119	yes
GATCAGTAGGAAGCACAGGG	1	1	yes
GATCTTGTCAACTTCACCAA	25	17	yes
GATCCCTTCCCCACCTAGCT	13	14	yes
GATCCCACTCCAGTAGGAAG	25	2	yes
GATCCCAAACTGGGTACAGA	92	21	yes
GATCCTACTGACAGCCATTG	2	3	yes
GATCCTTTCAGCAGCAGAGG	3	5	yes
GATCAGGACTTCCCAGCTCA	6	2	yes
GATCCATTGGGCAGCTCCTT	6	5	yes
GATCCAGTTCCCTCTGCTAG	2	3	yes
GATCCAGGACAAACCTGTGA	7	10	yes
GATCTGCAGCACGTAGACAG	23	16	yes
GATCCCCAACAATGTCAAGA	22	8	yes
GATCCAGGTGAGAGTAACAA	22	7	yes
GATCCAGGAGTTCCAAGAAG	20	29	yes
GATCCAGACCTCTGGCTTGC	14	2	yes
GATCCACATCAAGTGGGGGG	10	1	yes
GATCCACGCTCGCTCCACCC	2	2	yes
GATCGTAAACTACTTGAGCT	2	4	yes
GATCCAGGCTTTATCATGGG	14	2	yes
GATCGGCGCCTCCGGAGTAC	61	42	yes
GATCACAGTGGCCTGAAGCG	1	1	yes
GATCACTCCCTGGTGCCACA	10	1	yes
GATCATTCTGGTTTCAGAAC	31	6	yes
GATCTATCGAATCATCCGAG	10	7	yes
GATCCTTGAGAGGCAAGACG	358	58	yes
GATCAGGTGGAGTTGAAGGA	18	9	yes
GATCCTGGGTAGCATTTTAG	94	68	yes
GATCACTCATTGTTCAGGTG	29	13	yes
GATCCCTGCCTTACAATTGG	6	4	yes
GATCGGGTCAGTCACCTTTG	130	22	yes
GATCGGGCTGCCTGGCGTGG	61	46	yes
GATCGGGAACAGAAAGGGCG	66	56	yes
GATCGGCGTGTGGGCCAGGC	65	10	yes
GATCGGCGCTTTCAGACTAA	58	12	yes
GATCCCAGAAGGGCAAATTG	1	1	yes
GATCCTGAGAAACCTTTGAC	31	9	yes
GATCGCTTGTCTCCTGATGG	13	8	yes
GATCGCTGTGGCCGAAACTT	97	11	yes
GATCGCTGGGGAGTCGGGTC	1	2	yes
GATCCAAACTAAAGGCAGAG	34	13	yes
GATCACAGTGTACCCCACAC	32	6	yes
GATCACAGTCTGCATCCTAG	26	7	yes
GATCGCTCTCATTGCCCTTT	18	9	yes
GATCATTGGGACTGAGTGAA	16	3	yes
GATCGCTACCAAGCAGTTCT	325	42	yes
GATCCTCCCCGTATGATGAA	5	5	yes
GATCGCGCTCTACCATAGGC	29	31	yes
GATCGCCTTCTCCACCAATT	165	67	yes
GATCCTCAGGGCCTGAGCCT	81	41	yes
GATCGCCTGCGCACATTACC	2	2	yes
GATCGCCTCCTCCCTCTCTT	136	17	yes
GATCGCCTCACCGTGGGGGT	2	1	yes
GATCATGTGCCTTCCACTTC	9	7	yes
GATCTGGTGCTGCGCGGATG	34	24	yes
GATCCCTTCTCAGCCTCCAT	4	4	yes
GATCCCTTCCAGGTCAGCTC	6	4	yes
GATCGCCCTGTCCAACAAGC	9	7	yes
GATCATGTCTTCCCCTCTTT	52	6	yes
GATCGCCATCGGCAGGACTG	150	44	yes
GATCATCTTTCTGAGGGCTG	436	29	yes
GATCATTTGGTTCCTCTATA	42	9	yes
GATCATCTGCTTCAGCATAT	5	4	yes
GATCGCATTGCCAAGGAGGT	10	18	yes
GATCGCATGCGCCCCATCTG	121	43	yes
GATCGCATGAAGAAACCATG	350	33	yes
GATCGCAGTAGCCAGCGCAG	186	25	yes
GATCGCAGAGTCCGCCAACT	62	9	yes
GATCGCAGAGACATCAAGCG	7	3	yes
GATCGACGAGAACTGGTATG	102	10	yes
GATCCTTTTGCAGTCCAGAA	3	2	yes
GATCAATAGAGGTCTTGTGA	8	6	yes
GATCCTGAGAGAGTCCCTGA	17	12	yes
GATCACGGACGTGCAGCTCG	135	114	yes
GATCCGCCACCGTAGCTCCG	9	6	yes
GATCCTTTTCTGGGTGATAA	2	2	yes
GATCCTTTTCCACTCCCAGG	25	6	yes
GATCCTTTGCTCCTAGTGGA	96	10	yes
GATCCTTTCCTTGGACTCAC	11	8	yes
GATCCTTTCCATGCAAACTG	34	11	yes
GATCCTTTCATTTTCCAAGT	106	28	yes
GATCCTTGTTGTGCCTCTTC	19	3	yes
GATCCTTGTTCAATGCACGT	6	4	yes
GATCCTTGTGGCTGTGAAAA	38	10	yes
GATCCTTGTCCACCCCTCCC	196	21	yes
GATCCTTGTAAGAGCCAACT	1	1	yes
GATCCTTGATAGTGCCATGT	14	4	yes
GATCCTTGAGGTCACGTTGC	77	25	yes
GATCCTTCTCTGCTAGTTTA	13	7	yes
GATCAGCTCAGTTTGCAGAG	2	2	yes
GATCTGCTGCCAGGCTTGGG	2	3	yes
GATCCTGTGATGGTAGGAGT	2	3	yes
GATCCAGGTGGTGCTGGTGG	2	3	yes
GATCCCAGATGACAGCCAGA	6	4	yes
GATCCTTCTACCCACATACT	44	66	yes
GATCCTTCCTGCGGGCGGTG	90	6	yes
GATCCTTCAGTCCTCTTAGT	23	0	yes
GATCAGTTTGTCTGAAAAAA	6	9	yes
GATCCTTCAGAATCTCTGTT	45	6	yes
GATCAGTTTGCCTTCATTCA	143	16	yes
GATCCTTACCCTGTCCCTGT	126	31	yes
GATCCTTACCAGTGAGGCTG	4	2	yes
GATCAGTGTGTCTGTCTATG	91	12	yes
GATCCTGTTCCGAGCAAGCT	93	71	yes
GATCCTGTTAGTGAGCAGGG	17	12	yes
GATCAGTGCCTGGCGCCAGA	278	4	yes
GATCTGCAAAAACGGTCCAA	38	27	yes
GATCCTGTGTGGGAGGCTTC	166	18	yes
GATCCTGTGGGACCATCTAG	237	19	yes
GATCCTGTGGAAAGGATGCA	17	11	yes
GATCAGTCAGCCGCTGCCCG	38	10	yes
GATCCTGTCCCAGGGGCTAG	284	10	yes
GATCAGGTCTCTCCAACTCA	61	15	yes
GATCCTGTCACTGGGGAGGC	274	10	yes
GATCCTGTAGCTCAGCAGAC	111	34	yes
GATCCTGGTTGGGGGCAAGG	56	18	yes
GATCCTGGTGTTTCCACATG	2	2	yes
GATCCTGGTGGTTCACCTCA	29	22	yes
GATCCTGGTGAATGAACCAT	189	25	yes
GATCCTGGTCCCCAGCACCT	186	23	yes
GATCCTGGTAGCTCACCAAG	116	7	yes
GATCCTGGTAATGCACTTTG	1288	906	yes
GATCCTGGGTGGGCTGGGAG	10	5	yes
GATCCTGGGTCCCTCGTAAG	121	33	yes
GATCCTGGGTACTAAGGTCA	233	140	yes
GATCCTGGGGACCCAGAATG	126	11	yes
GATCCTGGGCTTCTTGCTAG	16	5	yes
GATCCTGGGAGCGAGGAAAC	1	1	yes
GATCCTGGGAAGTTGGATTA	56	25	yes
GATCGCTGCAGAGCAGAGCA	3	3	yes
GATCCCTGAGCGGCGGAAGG	2	4	yes
GATCGCTATGTGCAATACTG	4	4	yes
GATCCAGAGCAATGTGGAAG	2	3	yes
GATCCTGGCTGCCCACTTGG	24	1	yes
GATCCTGGCGCTGGCTGTCC	71	17	yes
GATCCTGGCGCGGGTAGCCA	50	75	yes
GATCCTGGCAGTGGACCGCC	149	12	yes
GATCCTGGCAACAGCTGTTT	19	3	yes
GATCAGCTGATGTGGGTGCT	15	13	yes
GATCCTGGAGTTTTCTACAG	86	10	yes
GATCCTGGAGGAACCTTCGC	150	16	yes
GATCAGCTGAAACACGTGTG	37	6	yes
GATCAGCTCTGCCGTCTCTA	40	20	yes
GATCCTGGAGAAGCATGTTC	6	4	yes
GATCCTGGAGAACACTGGTT	15	2	yes
GATCCTGGACGAGGCCACCA	169	12	yes
GATCCTGGACCGCCACAATT	41	29	yes
GATCCTGGAATTGGCTGGTA	20	21	yes
GATCCAGAAGACGAAAGAAG	43	37	yes
GATCCTGGAACGTGCACTAG	7	8	yes
GATCCTGGAAATGGACAAAG	29	4	yes
GATCCTGCTGACACGGTGCG	236	41	yes
GATCCTGCTCCAGGAGATTG	116	34	yes
GATCCTGCTAAGCACTGAGG	524	83	yes
GATCCTGCCCTGGGGTGAGG	5	5	yes
GATCCTGCAGCGGTTCCTAC	10	8	yes
GATCCCAGGGGATGGCATCG	3	4	yes
GATCACTTTGGGAACTGGTA	6	4	yes
GATCCATTCGCAACTTGGCT	142	10	yes
GATCCCAACAATGCAGCCAT	417	49	yes
GATCATGTCTTTATCGAGGA	8	11	yes
GATCACCATTTCCGACTCTG	12	18	yes
GATCTCTCCCCAGGGAAGGA	76	9	yes
GATCAAGGTGGGAGGGAAGA	60	41	yes
GATCTCTCAGACACTGACCT	8	8	yes
GATCAGAAGTTCAGGGTTAT	13	5	yes
GATCAGAAGTTCAAGGCCAG	33	2	yes
GATCAGAAGTGCCTCCTTGT	6	11	yes
GATCAGAAGTAGCCAAGTAG	17	13	yes
GATCAGAAGTACCAGAAACA	105	89	yes
GATCAGAAGGAGATACTCTG	39	16	yes
GATCAGAAGGAAGAGAAACA	51	43	yes
GATCAGAACTGGACAGCTCC	230	111	yes
GATCAGAACCCAGCCGAGTG	68	12	yes
GATCAGAACCAAAGGCAGGG	60	9	yes
GATCAGAACAGGTGTCCCTT	51	2	yes
GATCAGAACAGCCTGTCAAT	27	3	yes
GATCAGAACAACAGACAGTG	58	5	yes
GATCAGAAATGAGGTGTAAC	59	11	yes
GATCAGAAAGGAAGGGATGG	31	3	yes
GATCAGAAACTGTCCTCTGA	19	18	yes
GATCAGAAACAACTGTGTCT	14	24	yes
GATCAGAAAAGTCTCGACTA	19	11	yes
GATCACTTTTTTCTGACTCT	21	3	yes
GATCACTTTGAGGAAGCCAT	201	170	yes
GATCACTTTCTAGGTTCCTA	49	36	yes
GATCACTTTATTGCTGAACA	43	64	yes
GATCACTTGTTTGTGGTGAG	1121	94	yes
GATCACTTGTCAGTGTTCAG	198	132	yes
GATCACTTGGGATGAGACTG	1	1	yes
GATCACTTGGCTTTTCTGGG	123	84	yes
GATCACTTGGCGGTGACTTT	118	22	yes
GATCACTTGCTGAAATGAAT	5	3	yes
GATCACTTGATTTCTTGTGC	51	9	yes
GATCACTTCTCTGGTCTCCA	29	21	yes
GATCACTTCGGCCTGTACAC	382	39	yes
GATCACTTCGCCCTTTTTTG	539	107	yes
GATCACTTCCGTGCCTCCCT	32	3	yes
GATCACTTAGTGGGGGGTTT	44	30	yes
GATCACTTACTGCCTAATGC	79	17	yes
GATCACTGTGTTGGACACTC	877	47	yes
GATCACTGTGTACACATTGG	69	10	yes
GATCACTGTCTCAGGCCTTT	10	7	yes
GATCACTGTCCCCCTGGGAA	137	8	yes
GATCGACCACATCCTGGATG	73	7	yes
GATCGGCTCAACCAGGTCAT	2	3	yes
GATCACTGTACTCTTCTTTT	61	7	yes
GATCACTGGTGTTTCCCATT	10	7	yes
GATCACTGGTGTGTGCCAGT	33	17	yes
GATCACTGGTCTGTGACCTA	10	9	yes
GATCACTGGGTGTGTTTCAG	154	100	yes
GATCACTGGGAACAAACGGC	593	12	yes
GATCACTGGCTGCCGCTGGA	7	8	yes
GATCACTGGAAACGATTGCT	9	15	yes
GATCACTGCTCAAGCCTGGG	7	8	yes
GATCACTGCTAAGTTTCAGC	13	3	yes
GATCACTGCGTTAATCTTGG	41	6	yes
GATCACTGCGAAGTTTCGTT	19	4	yes
GATCACTGCCTTTCCCCCTC	59	9	yes
GATCACTGCCGAGAAAATCA	1	2	yes
GATCACTGCAGGGGGTGCCA	82	10	yes
GATCACTGCAGGCGCAGCGG	463	48	yes
GATCACTGCAACCTTGTGCT	65	15	yes
GATCACTGATGGCCAGAATG	23	19	yes
GATCACTGACCTTGGAGCTT	93	34	yes
GATCACTGAATATTGCCCCT	4	4	yes
GATCACTCTGTGTGTGGTAG	37	4	yes
GATCACTCTGGCCGCTCTTC	6173	370	yes
GATCACTCTGGCCAAGTAAG	40	13	yes
GATCACTCTGGAGTTCAGCG	18100	1235	yes
GATCACTCTCATACGATACG	6	5	yes
GATCACTCGGAAATTCAGGC	29	19	yes
GATCACTCCTTTTGAGGAAA	984	75	yes
GATCACTCCGTGCACCTGCT	48	8	yes
GATCACTCCCTGCCTGAGCC	239	11	yes
GATCACTCCAGCCCAGGCCC	11	12	yes
GATCACTCCAAGTTGACATT	166	38	yes
GATCACTCAGTGAACAATCC	10	7	yes
GATCACTCAGCAGCCAGGAC	159	7	yes
GATCACTATGTCCAGGCTTC	30	23	yes
GATCACTAGTGACTGTTGGG	45	13	yes
GATCACTAGGGGCTTTCAGC	21	13	yes
GATCACTAGCTTCGAGGAGG	76	29	yes
GATCACTACTTCAGAATATT	21	14	yes
GATCTGTTGGAACCAGGGCC	1	1	yes
GATCACTACCATGAAAACGC	11	10	yes
GATCACTACACAGGTGGCAT	10	9	yes
GATCACTACAAACCAAAGCA	3	4	yes
GATCACTAACATTCCCCGTA	71	18	yes
GATCACTAACAGTTTGCATA	50	11	yes
GATCACTAAAGTTCCATCTG	14	10	yes
GATCACGGTTTTCTCTGTAA	683	41	yes
GATCACGGTTCAGGTTTTGC	17	5	yes
GATCACGGTTCAGATTCGTT	27	9	yes
GATCACGGTGAACCCCCAGT	132	14	yes
GATCACGGTCCCGTGACCGC	60	16	yes
GATCACGGTATTTGACCGTG	50	11	yes
GATCACGGGAGAAGTACAAG	19	12	yes
GATCACGGCTTCTCAGCCGA	38	6	yes
GATCACGGCAGTGGATTGGG	134	31	yes
GATCACGCGTCCAGATGTGC	73	11	yes
GATCACGCATACCGGCCAGG	12	8	yes
GATCCAAGCCAGAGACATCG	6	5	yes
GATCACAGGCGACTACTATG	6	2	yes
GATCACGAGAGAAGCCAAAA	17	12	yes
GATCACGACCGATACAGTGA	6	6	yes
GATCACGAAGATGTTGGGCG	71	9	yes
GATCACCTTTGTCTGATAGC	76	12	yes
GATCACCTTTGCATAGAAAA	1	1	yes
GATCACCTTGCTGGCATCAG	31	22	yes
GATCACCTTGAGCCTCTTCT	2	3	yes
GATCACCTTCCTGTCTCATC	24	11	yes
GATCACCTGTTTCGCTGTGG	1459	192	yes
GATCACCTGTGCCAAAGACA	2	3	yes
GATCACCTGTAAATGGCCAC	14	15	yes
GATCACCTGGGACTCTAAGC	9	13	yes
GATCACCTGCTCTTTTCCTC	33	13	yes
GATCACCTCTTAGGGATGGT	95	29	yes
GATCACCTCTTAAGATTTTC	3	3	yes
GATCACCTCATTCCTCGACT	42	11	yes
GATCATCTGAACTCTGGTGT	2	2	yes
GATCACCTCAACGTGGGTGT	493	28	yes
GATCCCAGTCCCATCCTGAG	1	1	yes
GATCCGAGAAAACATGGCCA	1796	709	yes
GATCGTCTGATGACGCCCAC	2	3	yes
GATCTGTGAGAAGATGTCAG	4	3	yes
GATCACCTAAGGGGTCTGGG	153	98	yes
GATCACCGTTTCAAGGCCCA	39	5	yes
GATCACCGTGTTTTCGTGGT	21	8	yes
GATCACCGGGGATGAATTCT	11	9	yes
GATCACCGGGAGGGAGACAG	42	15	yes
GATCACCGCTCACCTTTCCA	39	0	yes
GATCACCGACTCCCTTACTA	60	20	yes
GATCACCGACCGCATCGAGA	1571	145	yes
GATCACCCTCAGGTGCAGGT	1069	240	yes
GATCACCCCTCTGCCTTTGT	13	10	yes
GATCACCCCCTTCCCTCTGT	148	27	yes
GATCACCCCCAATTGTATGG	2129	472	yes
GATCACCCCCAAGTCATGGC	4	4	yes
GATCACCCCACAGTGAGGCG	91	10	yes
GATCACCCATCATTCTGAGG	689	63	yes
GATCACCCAGAAGTGGCTCT	519	52	yes
GATCACCCACATTGGGTGAG	32	24	yes
GATCACCATTTCCGACTGTG	5695	484	yes
GATCACCATTCCGGTTACTT	793	36	yes
GATCAGCTGCTCTTCCGAAT	9	6	yes
GATCACCATGAGTTTGAGTC	34	28	yes
GATCACCATCTAGTGAGTCG	1083	277	yes
GATCTCCATCTTTGGCTCGG	25	33	yes
GATCAGTAACCAAATTGGAG	13	8	yes
GATCAGCCAGGCAACCTGAT	5	4	yes
GATCAGACACCGGACACTGT	7	1	yes
GATCCGTACTGCAGCAGTGG	2	3	yes
GATCCAGTGCCCTCTTTCAG	3	5	yes
GATCACCATAGTGTATCTGA	71	27	yes
GATCACCAGTTGGTGCTGTT	8	8	yes
GATCACCAGGAACTTCTATG	63	21	yes
GATCACCAGCCTGAAGCTGA	4	6	yes
GATCACCAGCAAACAGCTTT	397	86	yes
GATCACCAGAGGAGATAGGA	102	80	yes
GATCACCACCCCTGTTAAGC	147	7	yes
GATCACCACCAGGACGCTGA	174	50	yes
GATCACCAATGTTGTTTTTG	12	5	yes
GATCACCAAGGTTGATGCAC	1543	433	yes
GATCACGTGGAGCAGGGAAC	4	3	yes
GATCTGGTCTGCTCAAGGCA	6	9	yes
GATCCGGGCTCTAGACAGCG	10	15	yes
GATCACCAACCTGCTATCAT	30	18	yes
GATCACATTTTCGCAGTGGG	1	1	yes
GATCACATTTGCTTTGTGTT	17	2	yes
GATCACATTCTGGGCTTCCA	25	3	yes
GATCACATGTAGTGGGGAGG	59	4	yes
GATCACATGAAGTTTGATTT	23	10	yes
GATCACATGAACGTCTCCTG	2	3	yes
GATCACATCTTGGAAATATC	38	7	yes
GATCACATCTATGAGAAGTT	17	7	yes
GATCACATCGAGGTGTCGGA	13	11	yes
GATCACATCCTGTGGGGGTA	5	3	yes
GATCACATCCAAAAAGTCAT	27	26	yes
GATCCTACCCGCCACCTGCA	11	12	yes
GATCGCTTGTTGGCAATCGG	75	26	yes
GATCACATCAAAGGATGATG	197	25	yes
GATCACATATTCCAAAAGTT	2	3	yes
GATCACATACGCAGGAGTGG	33	9	yes
GATCACAGTTGCTACTGCCT	7	10	yes
GATCACAGTTCCAGGAACAG	474	9	yes
GATCACAGTGCGTGCCTGGC	148	14	yes
GATCACAGTCCTTCCTCTGG	833	58	yes
GATCACAGTATTGTCTCAGA	45	14	yes
GATCACAGTACAATAGCTCA	19	16	yes
GATCACAGGTGTGCATACCA	27	19	yes
GATCAAACCCCTGGAAACTT	59	11	yes
GATCACAGGGATGCGGCGTC	56	38	yes
GATCACAGGCAGTCCAGGGG	99	4	yes
GATCACAGGACTCTTTCCCT	2	2	yes
GATCACAGGACAGCTGAACC	58	40	yes
GATCACAGCCTGGATTTTTC	65	12	yes
GATCACAGCTCAGTTCCTAT	96	12	yes
GATCACAGCGTTCGTGCCCA	50	8	yes
GATCACAGCGGAGTTAGCTT	28	8	yes
GATCAAAGTGGGTCTGTGGC	95	13	yes
GATCAAACCAGACCAGTGGA	8	6	yes
GATCTGGAAGTGTGGGAACG	118	73	yes
GATCCCGTTGAAACTGCTGC	128	14	yes
GATCCTGCCAAGTTCAAGAT	10	5	yes
GATCGTCGCATGGCTCTCCC	26	17	yes
GATCTAACCATGAGCCTGTG	1	1	yes
GATCCCCTTCTACCTACTCC	1951	13	yes
GATCAAGTGCTGTCCTGGTT	2	3	yes
GATCTCTCTGACTCTGCCTC	44	8	yes
GATCCTCAACCTGCTGCGGG	27	13	yes
GATCAGCTCAGTGCTGTCTG	2	3	yes
GATCAGCTCAGTCTTCCCGG	13	10	yes
GATCCTTGCTGGGGGTAATT	3	5	yes
GATCCATCTGTGTAGTTTCT	378	18	yes
GATCCTCTGGAGAATTGTGT	2	3	yes
GATCCTGGCTGTGGGCCTCA	3	4	yes
GATCTCCCCACCTGCTTTCT	3	5	yes
GATCCCGTCTCTCCTATGTT	86	17	yes
GATCCTGGCATGCCACCTCT	2	4	yes
GATCCTGGGCAAGGACCACA	10	10	yes
GATCCTCACTACTGCCAGCC	1	2	yes
GATCTCACCATGTAGCCCTA	7	6	yes
GATCCAGTCTCATCTCAGCT	148	11	yes
GATCGGTTCTGCCACGTGCT	3	5	yes
GATCAGTCCTGGCAAGGAAG	1	1	yes
GATCCAGTGTTGGAATTCTT	28	1	yes
GATCCTGCAACCCATTTCCA	12	4	yes
GATCCTGATTGTCAAAAAAA	2	3	yes
GATCCTGATGCAAGGCTGGC	17	11	yes
GATCCTGAGTGAGTGTGAGG	80	19	yes
GATCAGCAACTACAACTTTT	29	8	yes
GATCCTGAGGAGGGGTTTGA	26	13	yes
GATCCTGAGGACAGGAGAGG	18	3	yes
GATCCTGAGATGGCTCTGAG	8	6	yes
GATCCTGAGAGTGTCACTGT	12	4	yes
GATCCTGAGACACAAAAGGT	24	29	yes
GATCCTGAGAAAATCAGGGC	10	8	yes
GATCCTGACTTCTAGCTGTG	43	14	yes
GATCCTGACCTGTACACAGC	2	2	yes
GATCCTGACCGAGCGTGGCT	160	19	yes
GATCGTTTCCCTTGCATGCC	73	50	yes
GATCTTTCCACCAAGCCATA	24	5	yes
GATCCAGGCTCGGGAGTGCC	23	9	yes
GATCCTGACCATCACTATAC	156	22	yes
GATCCTGACCAGGGGGAGTC	190	7	yes
GATCCTGAATTGCTGGAGAG	122	31	yes
GATCCTGAAGTCTGCAGACC	156	20	yes
GATCCCGGGGCTGTAACTGT	117	18	yes
GATCCTGAAGCCCCTCGCTT	9	9	yes
GATCCTGAAGATGTGGACAC	25	7	yes
GATCCTGAACCCACCCCCGT	111	82	yes
GATCCTGAACACTCCTGGGG	19	20	yes
GATCCTGAAACGACAGTGGT	66	14	yes
GATCCTGAAAACGCCACCCC	12	8	yes
GATCCTCTTGTCTGCTTCGC	558	141	yes
GATCCAGGACCTGGTAGCAA	808	64	yes
GATCCAGGAAGTTGGTGAAC	163	32	yes
GATCCTCTTCTCCGCGTGCC	283	25	yes
GATCCTCTTCCACGAGACAC	11414	1387	yes
GATCATCCAGAACACACCCT	21	19	yes
GATCGGCCTGCGGAAGAAGG	19	1	yes
GATCCTCTGCAGTATCCAGG	20	30	yes
GATCCTCTGCAGAGGAGTAT	9	6	yes
GATCACTTTCCTCCCACGTG	13	9	yes
GATCCTCTGACATCAGAAGC	18	16	yes
GATCCTCTGAAAAACCAAGA	104	9	yes
GATCCTCTCCAAGGAGGAGC	304	71	yes
GATCCTCGTTCCTTGTCCTA	93	40	yes
GATCACTGGGGAGAAGTTAT	43	16	yes
GATCCTCGGGGTGCCAGCCA	9	13	yes
GATCACTGCGGACATGCTGG	63	14	yes
GATCACTGAGGATGGCTGAC	121	10	yes
GATCCCAAACATTTGTCGGA	9	6	yes
GATCCTTCCTAGAGTCACTC	32	7	yes
GATCAGGACTTCTTCCGCCG	18	12	yes
GATCCAGCAGCGCAGGCAGG	384	107	yes
GATCACGTTCTGCTTGGAAG	94	13	yes
GATCACGTGACCACAGCCCC	114	2	yes
GATCCTCCTCCAAGTCTGAC	20	11	yes
GATCCTCCTACCTGTTTCTA	14	10	yes
GATCCTCCCTCAGGACTACG	7	8	yes
GATCCTCCCGTATGCCAACC	112	21	yes
GATCCTCCCCTGGCCTCAGT	84	25	yes
GATCCTCCCCTGCCCTACAC	155	56	yes
GATCCTCCCCGCTCGCTCAC	151	26	yes
GATCCTCCCCCTCTGTCTTT	161	32	yes
GATCCTCCCAGACCCTCTGA	126	53	yes
GATCCTCCAGTCTGGTAGTG	8	8	yes
GATCACCGACACAAACTTGT	16	17	yes
GATCACCCGACGCAAGTGGG	36	6	yes
GATCCTCCAGCAGCCTTTTG	27	40	yes
GATCCTCCACTCTTCTGGAA	83	24	yes
GATCCTCATCATCGCGGGTA	243	25	yes
GATCCTCATCAGTGTGGCCA	228	137	yes
GATCCTCAGGGACACCACCT	3	5	yes
GATCCTCAGGAGTCAGTATT	13	5	yes
GATCCTCAGCCTCCCAGAGC	103	11	yes
GATCCTCACTGAGAAGGAAC	12	13	yes
GATCCTCACTGACAGATGGG	18	3	yes
GATCACATTACAGAACAATC	26	17	yes
GATCCTCACCCCGCCTGCTG	82	72	yes
GATCACAGTTCCTTATTGTG	118	34	yes
GATCCTCAAGTCGGTGGTGG	3	3	yes
GATCCTGCCCTTCACCTCGG	9	9	yes
GATCCTATCTCGCCCAGTGA	109	14	yes
GATCCTAGTGCAGGAGGGGG	30	5	yes
GATCCTAGTCCTTGCCCCGT	91	8	yes
GATCACACTTACCAGTCAGC	331	48	yes
GATCCTAGTCCACCTCCTTC	17	11	yes
GATCACACTGTCTTGGAATT	33	8	yes
GATCCTAGTCATTATCTCCT	4	3	yes
GATCCTAGCCAGATTACTAG	48	7	yes
GATCCTAGCAGCGGCGGTGG	13	3	yes
GATCCTAGAGCACTTGAGGA	21	13	yes
GATCCTAGAGACAGGCCATC	79	20	yes
GATCCTAGACTCTCCTTGTT	131	12	yes
GATCCTAGAATAGCGTCTCA	2	2	yes
GATCCTAGAAGTGGTCCTTG	7	8	yes
GATCCTAGAACCGCCAGGGT	14	5	yes
GATCCTAGCAGAAAGGAAAG	2	2	yes
GATCAGCGGTTTTTATCCTC	7	6	yes
GATCCTACTTTCAGCTGCTC	21	15	yes
GATCCTACTCGAACAGGAAG	167	4	yes
GATCCTACTATTAGTCCACA	4	4	yes
GATCCTACGCAGGGGGGACT	351	64	yes
GATCCTACCTGCTCATCTGG	236	28	yes
GATCCTACCACTAAGGAAAG	3	5	yes
GATCCTACAGTCTGGAATCC	45	6	yes
GATCAATTTGCCACCGTGGT	209	3	yes
GATCCTACAGACACAGTAGC	1	1	yes
GATCAATTGGAACCGGCTTT	36	24	yes
GATCAATTCCCATTCCACTT	49	33	yes
GATCCTAAGTACTGATTTGT	56	14	yes
GATCCTAAGGAAGACAAGGC	8	2	yes
GATCCTAAGCAAATGCCTTC	12	6	yes
GATCCTAAGCAAAGGGACTC	166	19	yes
GATCCTAACTTGGAAACTGT	116	8	yes
GATCCTAACACTTCTACAGA	6	8	yes
GATCCTAAATGTGTGGAAGA	31	8	yes
GATCATGTGTGTAGCCAGAA	35	26	yes
GATCCTAAAGACTTCCAACT	41	6	yes
GATCCTAAAGACTCCCCAGG	13	8	yes
GATCCGTTTCTCTCTGCCTT	95	35	yes
GATCAAGTTTCCATCCACAG	2	3	yes
GATCCGTGTGAGGTGTGCTG	239	12	yes
GATCAAGTCTTGTCATAGCT	25	8	yes
GATCCGTGTCATTCACACAC	16	3	yes
GATCCGTGCCCTGTAAAGTG	62	3	yes
GATCAAGAAACGACAGAGAG	26	17	yes
GATCCGTCGTTACCAGAAAT	1	1	yes
GATCGGGCGGGCTGTGTGGG	2	1	yes
GATCCGTCGGTGCCTGCTGG	330	65	yes
GATCCGTCGCCACTGAGGAG	12	20	yes
GATCCGTCCATGTCTGCCAC	7	7	yes
GATCCGGTCCCAGCCCCCGA	48	33	yes
GATCAGAGCGGAGTACCGGC	57	6	yes
GATCAACTGGTCTAATCATG	2	2	yes
GATCCGGTCAGCGAAAACCT	4	7	yes
GATCCGGGATGTCGAAGAAC	8	5	yes
GATCCGGCTTCCCAAGAGTA	13	9	yes
GATCAACCTGGAGTTGTATG	98	18	yes
GATCCAACTGTTGGGGATAT	1	1	yes
GATCCGCTGGGAGCTCACAC	36	25	yes
GATCGCACTTTGCACATCGA	2	3	yes
GATCCGCGGGGCTCAGTGTG	169	14	yes
GATCCGCGGGCGTAAACGCT	2	3	yes
GATCCGCGAGTACACGGCAG	56	10	yes
GATCCGCGAGTACACGGACA	3	5	yes
GATCCGCGAGCCTTTGGCGA	31	21	yes
GATCCGCCTCTTCCTGGTCA	313	52	yes
GATCCGCCTCTCACCAGCCA	11	7	yes
GATCCGCCGTTCTCTGGAAC	24	8	yes
GATCCGCCAGGACCGAGAAC	17	5	yes
GATCCGCAGTGTCTTGGATG	32	7	yes
GATCCGCAGGGAAGTGAGGA	2	3	yes
GATCCGCAGGCGCAAGGCCC	1235	949	yes
GATCCGCAGCCGCCTAACTG	53	17	yes
GATCCCCGCGCAGAAGTAGG	211	31	yes
GATCAGCCGTTGCCGCCGTC	10	1	yes
GATCTTCCAGAGCCTCAGTG	7	8	yes
GATCACCTTTCTCCCTGCCA	8	6	yes
GATCAGACGGACGTGTTAGT	2	2	yes
GATCCTTTCAAGCATTTTGT	2	3	yes
GATCTGGGCTTCCTGGGTGA	5	5	yes
GATCTGGGCTGTCACTACGA	29	7	yes
GATCTGGCTTCCTGCTGCTG	1	1	yes
GATCGAGAGGAACGGGCAGA	21	7	yes
GATCGAAAAGCAAATGTTGA	13	9	yes
GATCCTTGTTGCGCTGGCTC	29	21	yes
GATCCGTGCCTATGAGATGA	2	1	yes
GATCAGACAGAGGTCAGAGG	49	8	yes
GATCTCTCCATTCCTGGTTC	10	1	yes
GATCTGCTGAGCTGCCTGGA	59	42	yes
GATCTCTCAGGCTTCTCTCA	6	4	yes
GATCTCGGATTTCGCTCGAC	15	20	yes
GATCTCCTTTGACCCTGAGA	14	15	yes
GATCTCCAGGGAGACTCCAT	7	6	yes
GATCTCATCAATCGTCAGAC	17	4	yes
GATCTACACAGAGAAACCCT	2	3	yes
GATCCAGCGCAGTCAGCTGG	2	2	yes
GATCGTCTCCAACTTGGAGA	16	17	yes
GATCGATGATGATGTTGCTG	2	3	yes
GATCGACCGCATGGTCAGCC	129	49	yes
GATCGACATGTTCCTCCACA	167	64	yes
GATCGGAAGAGGGAAGACTG	6	4	yes
GATCCTTGCATTCCTTTTTT	29	10	yes
GATCCTTCTTGCTCATAAGC	13	9	yes
GATCCTGTCCCACAAAGGAA	21	5	yes
GATCCTGGCCACTGTTTTTG	4	4	yes
GATCCTGACACCTACACTCA	6	8	yes
GATCCTCTCCACACTTAGGA	1	2	yes
GATCGAGCTGCAGCAGGAGA	5	3	yes
GATCCTCCCCACGTAACCCA	39	12	yes
GATCTTGACATACCAGCTGT	3	3	yes
GATCCTGATGCTGCCAAAGC	424	58	yes
GATCCCGAAGTCTGTGACGC	111	9	yes
GATCCCGAACTGTTCAAACA	29	14	yes
GATCCCCTCCCAGAGAAGTG	83	18	yes
GATCCTGGAGAAGCTGCTGA	18	7	yes
GATCCCATCCACCATTCTGC	13	1	yes
GATCCCAGCCATCTCAGCCC	16	10	yes
GATCCCAACGAACCCACATA	115	27	yes
GATCCCAAATTCAGGGAGTG	18	10	yes
GATCCATTTTTCCCTCTCTG	2	3	yes
GATCTTAAACTGGAACGTAC	6	7	yes
GATCTCACTCTTCTTGATGC	89	8	yes
GATCCAGGTGTCAGAGCGAG	4	7	yes
GATCCATCCAGACAACCGTA	1	2	yes
GATCCAGTGTGGAGAGAAAT	3	4	yes
GATCCAGGCCTTGGGGACAA	23	6	yes
GATCCAGGCAGGCCTGACAC	11	17	yes
GATCCAGCCAGAAGGCACAA	16	10	yes
GATCCAGAGTGGAGAGTGTT	46	22	yes
GATCCACTAATGCTGAGCAC	49	22	yes
GATCCACAGCCCGTTTTGTA	34	18	yes
GATCCTTTTCTTCTCTCCAT	3	3	yes
GATCGGCCGGAGCCCTTCCC	117	78	yes
GATCCAAGTTCAATTCCCAG	10	7	yes
GATCCAAGCACTGACACTGG	103	22	yes
GATCCAACACCATCTTCTGG	10	13	yes
GATCCCGATGACCATAGGCA	36	9	yes
GATCCCCGGTTCTGCAGCCC	2	2	yes
GATCATATCCACCCTCCCAC	14	6	yes
GATCATAGGCAAACGTGGCA	658	109	yes
GATCCCCTATTTCACTACCT	2	2	yes
GATCAGCTGCTCACGCTGAT	165	12	yes
GATCCAAAGCTCTATTGTAC	4	7	yes
GATCCTGTTCAGAGAACCCG	2	3	yes
GATCCTGCACTCACCATGAC	25	7	yes
GATCTCATTTCAGAAGAACG	48	3	yes
GATCTATGGCAGAAGTCCAG	14	15	yes
GATCGACAAATTGTATTTGA	7	12	yes
GATCCAGAGTTTTCGGAAGG	3	3	yes
GATCCAGGGTCTGGGTATAT	19	14	yes
GATCTACTGGACGGATGCTT	1	1	yes
GATCACTACAACCATGTTAG	43	7	yes
GATCCACTCCCTGTACCGCC	322	31	yes
GATCCCAAGTACTGCCTGAA	2404	135	yes
GATCCACGGGTTTGAAAGAG	7	5	yes
GATCCCAACTACAAGCAGCA	6	8	yes
GATCAGCACTTTCATCGACA	18	7	yes
GATCCACACGCTCTTCGCCA	1	2	yes
GATCAATGCTACCGCCAAGG	89	58	yes
GATCCATGCTAGAAGCCCAG	2	2	yes
GATCAAGAAAGATGAACAGG	6	9	yes
GATCAAGAAAGAGATGGGAG	90	15	yes
GATCCTTCTCAAGGACTCTC	28	8	yes
GATCCGGTCCCAAGACCGAT	10	15	yes
GATCAACAACAGGGCATCGG	105	68	yes
GATCCCAACTGGGCCAACTT	7	6	yes
GATCCACCACCACATCCCAG	23	4	yes
GATCCCTGTGGATGGAGGTC	29	6	yes
GATCCACACGTGTGTGAACA	126	37	yes
GATCCCTCCAATCCGGAAGT	6	3	yes
GATCCCGGGGAAGGCCAGCC	9	8	yes
GATCAGCTATGCTAACCTTT	17	19	yes
GATCCCTGCTGGAAGAAGTC	22	1	yes
GATCCAGGCCCTAGGAACCT	9	13	yes
GATCCGCAATCCACGTGGGC	25	6	yes
GATCCGCAAGCTCCCCTTTC	3	3	yes
GATCCGCAAATACGGGCTGA	23	9	yes
GATCCGATGCTCTCCCACAA	3	3	yes
GATCACAGAATTGTACATAA	13	8	yes
GATCCGAGGCACCAGCTACC	18	10	yes
GATCCGAGCCCCAGCGGGAA	82	54	yes
GATCCGAGCAATTGGCAAGA	16	3	yes
GATCCGAGATATACGCAGGA	128	35	yes
GATCAATTGTGAACCTGTGG	52	34	yes
GATCCGAGAGACCAGCCAGA	313	33	yes
GATCCGAGACCTGGCAGAGC	168	34	yes
GATCCGAGAATTCCAGGACT	32	2	yes
GATCCGACTTCAAAAGGCAG	9	11	yes
GATCCGACTGTGCCCGGATG	67	54	yes
GATCCGACTCCAGTGCGGAC	6	5	yes
GATCCGACGCACCAGCATCG	35	27	yes
GATCCCTAACACTACAAAAA	32	22	yes
GATCCCAGCAAATAAACCAG	3	5	yes
GATCAGTACCTGGGAAGTAC	45	30	yes
GATCCAGCCGGAACCTGTGG	2	3	yes
GATCCAGCAGTTTGATGATG	1	2	yes
GATCCGAATGAAGTTGCCTC	4	5	yes
GATCCGAAGGGCGGCCGCTG	27	18	yes
GATCAACCACCCAGACCACA	96	5	yes
GATCCGAAGAGTCATTCGTT	2	3	yes
GATCCGAAGAAACTGGCTGC	18	12	yes
GATCCGAACCACTGCCAGAG	19	12	yes
GATCCCTTTTGAATCCGACC	4	3	yes
GATCCCTTCTGGTGCACACT	41	4	yes
GATCCCTTCTGGGACTCCCC	13	11	yes
GATCCCTTCTAAGTGCCAGT	21	10	yes
GATCCCTTCCCTTCCTTGTG	386	23	yes
GATCCCTTCCCTGATGTTGG	83	13	yes
GATCCCTGTTGCAGGGATTA	10	7	yes
GATCTTTGGTGGATTGTGTC	22	14	yes
GATCCCTGTGGACAACAAGG	200	33	yes
GATCCCTGTATATGTCTCTT	1	1	yes
GATCCCTGGTTGCTCCCTCT	90	24	yes
GATCCCTGGTGCTGCAGTGG	19	14	yes
GATCCCTGGGCCCCCGGGTC	36	23	yes
GATCCCTGGGACCCTCATGG	107	21	yes
GATCCCTGGACACTTACATT	1	1	yes
GATCCCAGAAGCAACCCTAG	8	8	yes
GATCCAATGAGGCCCCACAA	13	9	yes
GATCCCTGCTTTTCAGAGGC	42	7	yes
GATCCCTGCTTCCAGCTTCG	257	39	yes
GATCCCTGCTGGGTACTTGA	967	112	yes
GATCCCTGCTCTGGCCCACT	156	54	yes
GATCCCTGCTCAGAAACCTC	3	5	yes
GATCCCTGAGCTCCGAGCAG	25	19	yes
GATCCCTGAGAAAATAAGCT	16	15	yes
GATCCCTGAATGCCAACCTG	6	1	yes
GATCCCTCTCCCTGCCTCAA	18	13	yes
GATCCCTCTCCACAGGGTCT	20	8	yes
GATCCCTCTCACAGGCTTCG	8	5	yes
GATCCCTCAACTACAAATGT	17	21	yes
GATCCCTCAACACTGAGTCC	96	11	yes
GATCCCTACTCCAAGGTGAA	155	16	yes
GATCCCTACCGATTCAAGAA	39	5	yes
GATCCCTACACTAAGCTGAC	48	13	yes
GATCCCTAACCCTGGGCTGG	210	92	yes
GATCCCGTGTATGTTATGAC	43	13	yes
GATCCATCTGCCCATGTCAG	2	4	yes
GATCCAGTTTGGAAAAGGTC	2	2	yes
GATCCATGGAAGAGACCAGG	3	2	yes
GATCCAGCTCAGATAGACTG	67	9	yes
GATCCAAGCTGTTACCTGTT	10	3	yes
GATCCCGTGCCTGTCAAAGA	39	10	yes
GATCCCGTCCAGGCAACTGC	6	2	yes
GATCATTGCTCAGGGAGATT	236	38	yes
GATCCCGGTGTATCATGGCA	121	17	yes
GATCCCGGCTCCTTCCTCCA	6	7	yes
GATCCCGGCAAGAAGAGCAC	25	4	yes
GATCCCGCTATAGTTTCATC	6	4	yes
GATCCCGCAGTGGCAAGGTC	189	21	yes
GATCCCGACACGGACTCTGA	66	13	yes
GATCCCGACACCACGGAGAT	15	20	yes
GATCCCGAATTTTCCTAAGG	28	0	yes
GATCCCGAAACCCACCAAAG	29	43	yes
GATCCCCTTGATTGCCCTGA	137	27	yes
GATCCCCTTACAGCTGGCAT	61	4	yes
GATCCCCTGTTCTTCATCCT	1	2	yes
GATCCCCTCCTTAGTCTTAG	38	26	yes
GATCCCCTCCCCTGGTGAAC	222	21	yes
GATCCACCCTCTTCTGCTGG	3	5	yes
GATCACAGCTTCTGAACATG	2	2	yes
GATCCCCTCCCATAGGTAGC	378	163	yes