Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 4350

1.
Value/Rank Plot

Cd8a - T-cell factor 1-deficient thymic lymphoma

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1451673_at (ID_REF), GDS4867, 12525 (Gene ID), M12825
DataSet type:
Expression profiling by array, transformed count, 17 samples
2.
Value/Rank Plot

Cd8a - T-cell factor 1-deficient thymic lymphoma

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1425335_at (ID_REF), GDS4867, 12525 (Gene ID), M12825
DataSet type:
Expression profiling by array, transformed count, 17 samples
3.
Value/Rank Plot

Cd8a - Tuberous sclerosis complex 1 deficient naïve CD4 and CD8 T cells

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL11180, 1425335_PM_at (ID_REF), GDS4572, M12825
DataSet type:
Expression profiling by array, transformed count, 10 samples
4.
Value/Rank Plot

Cd8a - Activated diabetogenic CD8+ G9C8 clone cells and transgenic NOD/LtJ CD8 T cells

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1451673_at (ID_REF), GDS4398, 12525 (Gene ID), M12825
DataSet type:
Expression profiling by array, count, 5 samples
5.
Value/Rank Plot

Cd8a - Notch1 overexpression model of T-cell acute lymphoblastic leukemia: double positive CD4+/8+ cells

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1451673_at (ID_REF), GDS4303, 12525 (Gene ID), M12825
DataSet type:
Expression profiling by array, count, 4 samples
6.
Value/Rank Plot

Cd8a - Notch1 overexpression model of T-cell acute lymphoblastic leukemia: double positive CD4+/8+ cells

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1444078_at (ID_REF), GDS4303, 12525 (Gene ID), BB154331
DataSet type:
Expression profiling by array, count, 4 samples
7.
Value/Rank Plot

Cd8a - Notch1 overexpression model of T-cell acute lymphoblastic leukemia: double positive CD4+/8+ cells

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1425335_at (ID_REF), GDS4303, 12525 (Gene ID), M12825
DataSet type:
Expression profiling by array, count, 4 samples
8.
Value/Rank Plot

Cd8a - Notch1 promoter deletion effect on Ikaros-deficient model of T-cell acute lymphoblastic leukemia: thymic lymphoma

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1444078_at (ID_REF), GDS4174, 12525 (Gene ID), BB154331
DataSet type:
Expression profiling by array, count, 6 samples
9.
Value/Rank Plot

Cd8a - Lung response to chronic and acute exposure to ingested arsenic

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1440811_x_at (ID_REF), GDS3801, 12525 (Gene ID), BB030365
DataSet type:
Expression profiling by array, transformed count, 55 samples
10.
Value/Rank Plot

Cd8a - Mutant transcription factor ThPOK effect on memory P14 T cells

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1444078_at (ID_REF), GDS3566, 12525 (Gene ID), BB154331
DataSet type:
Expression profiling by array, count, 4 samples
11.
Value/Rank Plot

Cd8a - Thymocytes of the NOD background response to activation by a mimotope peptide

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL81, 102975_at (ID_REF), GDS2028, 12525 (Gene ID), U34881
DataSet type:
Expression profiling by array, count, 16 samples
12.
Value/Rank Plot

Cd8a - Positively selected H-2b T cell receptor transgenic thymocytes (MG-U74A)

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL81, 102975_at (ID_REF), GDS1933, 12525 (Gene ID), U34881
DataSet type:
Expression profiling by array, transformed count, 4 samples
13.
Value/Rank Plot

Cd8a - Ikaros mutant thymic tumors

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL81, 102975_at (ID_REF), GDS1638, 12525 (Gene ID), U34881
DataSet type:
Expression profiling by array, count, 10 samples
14.
Value/Rank Plot

Cd8a - Thymocyte response to anti-T cell receptor antibody stimulation

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL81, 102975_at (ID_REF), GDS1565, 12525 (Gene ID), U34881
DataSet type:
Expression profiling by array, count, 8 samples
15.
Value/Rank Plot

Cd8a - MPSS transcriptome analysis project

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1010, GATCTGCTCAGCTCTGGCTG (ID_REF), GDS868, BC030679
DataSet type:
Expression profiling by MPSS, count, 87 samples
16.
Value/Rank Plot

Cd8a - T-cell factor 1-deficient thymic lymphoma

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1444078_at (ID_REF), GDS4867, 12525 (Gene ID), BB154331
DataSet type:
Expression profiling by array, transformed count, 17 samples
17.
Value/Rank Plot

Cd8a - Tuberous sclerosis complex 1 deficient naïve CD4 and CD8 T cells

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL11180, 1451673_PM_at (ID_REF), GDS4572, M12825
DataSet type:
Expression profiling by array, transformed count, 10 samples
18.
Value/Rank Plot

Cd8a - Tuberous sclerosis complex 1 deficient naïve CD4 and CD8 T cells

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL11180, 1444078_PM_at (ID_REF), GDS4572, BB154331
DataSet type:
Expression profiling by array, transformed count, 10 samples
19.
Value/Rank Plot

Cd8a - Mutant transcription factor ThPOK effect on memory P14 T cells

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL1261, 1425335_at (ID_REF), GDS3566, 12525 (Gene ID), M12825
DataSet type:
Expression profiling by array, count, 4 samples
20.
Value/Rank Plot

Cd8a - pRb p107 double deficient skin

Annotation:
Cd8a, CD8 antigen, alpha chain
Organism:
Mus musculus
Reporter:
GPL339, 1451673_at (ID_REF), GDS3176, 12525 (Gene ID), M12825
DataSet type:
Expression profiling by array, transformed count, 8 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center