GEO Profile Links for Gene (Select 233005) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 227

<< First< Prev

Page of 12

Next >Last >>

Select item 1223220001.

Cyp2a22 - Industrial pollution effect on liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 44700 (ID_REF), GDS5331, XM_896600, A_52_P95517 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122322000

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1029369322.

Cyp2a22 - Liver response to a high fat diet: time course

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL6246, 10561162 (ID_REF), GDS4783, NM_001101467, XM_006539859, BC151116, BC158034, chr7:26932351-26939359 (SPOT ID)

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 102936932

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1054997323.

Cyp2a22 - Streptozotocin induced type 1 diabetes: liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL6246, 10561162 (ID_REF), GDS4845, NM_001101467, XM_006539859, BC151116, BC158034, chr7:26932351-26939359 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 105499732

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 640714544.

Cyp2a22 - SIRT1 deficiency effect on the liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P95517 (ID_REF), GDS3666, NM_001101467, A_52_P95517 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64071454

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1092546005.

Cyp2a22 - Diabetic db/db heart response to rosiglitazone

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL4134, 44700 (ID_REF), GDS4990, XM_896600, A_52_P95517 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109254600

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 969798326.

Cyp2a22 - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL6246, 10561162 (ID_REF), GDS4490, NM_001101467, XM_006539859, BC151116, BC158034, chr7:26932351-26939359 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96979832

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 715607547.

Cyp2a22 - Interstrain differences in the liver effects of trichloroethylene

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P95517 (ID_REF), GDS3890, NM_001101467, A_52_P95517 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71560754

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 552170008.

Cyp2a22 - Iron enriched and deficient diets effect on the liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL4134, 44700 (ID_REF), GDS3373, XM_896600, A_52_P95517 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55217000

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1153424009.

Cyp2a22 - Glucocorticoid effect on the female liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL4134, 44700 (ID_REF), GDS5036, XM_896600, A_52_P95517 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115342400

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11529580010.

Cyp2a22 - Glucocorticoid effect on the male liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL4134, 44700 (ID_REF), GDS5035, XM_896600, A_52_P95517 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115295800

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12234713211.

Cyp2a22 - Death receptor knockout effect on NEMO-deficient model of chronic liver disease

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL6246, 10561162 (ID_REF), GDS5332, NM_001101467, XM_006539859, BC151116, BC158034, chr7:26932351-26939359 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 122347132

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8122703212.

Cyp2a22 - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL6246, 10561162 (ID_REF), GDS4162, NM_001101467, XM_006539859, BC151116, BC158034, chr7:26932351-26939359 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 81227032

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6443465813.

Cyp2a22 - Hypertension model: liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL9734, 100108987_TGI_at (ID_REF), GDS3674, AK149509

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64434658

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3189605814.

Cyp2a22 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL2872, 21658 (ID_REF), GDS2413, XM_896600, A_52_P95517 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31896058

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747669915.

Cyp2a22 - MPSS transcriptome analysis project

Annotation:: Cyp2a22, Cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAGAGGGAGGGAGAGC (ID_REF), GDS868, CR521972

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7476699

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 11321867816.

Cyp2a22 - Fasting effect on vanin-1 depleted liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL11533, 10561162 (ID_REF), GDS4872, NM_001101467, BC151116, chr7:27717370-27724378 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 113218678

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11942495417.

Cyp2a22 - Chronic, low level drug exposure effect on obese liver

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P95517 (ID_REF), GDS5258, NM_001101467, A_52_P95517 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119424954

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10420363218.

Cyp2a22 - SIRT3 deficient liver response to a high fat diet

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL6246, 10561162 (ID_REF), GDS4817, NM_001101467, XM_006539859, BC151116, BC158034, chr7:26932351-26939359 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 104203632

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11335697819.

Cyp2a22 - c-Jun N-terminal kinase-1 deletion effect on bile duct ligation model of liver fibrosis: time course

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL11533, 10561162 (ID_REF), GDS4878, NM_001101467, BC151116, chr7:27717370-27724378 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 113356978

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10681543220.

Cyp2a22 - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: Cyp2a22, cytochrome P450, family 2, subfamily a, polypeptide 22

Organism:: Mus musculus

Reporter:: GPL6246, 10561162 (ID_REF), GDS4899, NM_001101467, XM_006539859, BC151116, BC158034, chr7:26932351-26939359 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106815432

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 12

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 233005) (227)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 227

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity