GEO Profile Links for Gene (Select 23939) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1648

<< First< Prev

Page of 83

Next >Last >>

Select item 279800911.

Mapk7 - Spinal cord and dorsal root ganglion

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL1261, 1418060_a_at (ID_REF), GDS2209, 23939 (Gene ID), NM_011841

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 27980091

Select item 1066771912.

Mapk7 - SIRT1 deficiency effect on the brain

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL8321, 1418060_a_at (ID_REF), GDS4895, 23939 (Gene ID), NM_011841

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 106677191

Select item 156102773.

Mapk7 - Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: Mapk7, Mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL2727, 25103 (ID_REF), GDS1527, AV140545, 2810404L15 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15610277

Select item 395846824.

Mapk7 - Wilms' tumor protein Wt1 deficiency effect on the urogenital ridge

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL1524, 12882 (ID_REF), GDS2747, NM_011841

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 39584682

Select item 143140395.

Mapk7 - Type 2 diabetes susceptibility: role of hepatic lipogenic capacity

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL81, 99000_at (ID_REF), GDS1443, 23939 (Gene ID), AB019373

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 14314039

Select item 922789916.

Mapk7 - Rough attenuated Brucella suis strain infection effect on macrophage cell line: time course

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL1261, 1418060_a_at (ID_REF), GDS4432, 23939 (Gene ID), NM_011841

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 92278991

Select item 156147067.

Mapk7 - Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: Mapk7, Mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL2727, 30061 (ID_REF), GDS1527, W75015, IMAGE:391129 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15614706

Select item 765893918.

Mapk7 - Time course of diabetes-induced, anti-Interferon-γ injected NOD.Scid mice: pancreatic islets

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL1261, 1418060_a_at (ID_REF), GDS4034, 23939 (Gene ID), NM_011841

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 76589391

Select item 1270478899.

Mapk7 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL4134, 14689 (ID_REF), GDS5461, NM_011841, A_51_P359018 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127047889

Select item 13038342710.

Mapk7 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL4134, 38427 (ID_REF), GDS5664, NM_011841, A_51_P359017 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130383427

Select item 5476749111.

Mapk7 - FHL2 deficiency effect on spontaneously immortalized embryonic fibroblasts

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL1261, 1418060_a_at (ID_REF), GDS3344, 23939 (Gene ID), NM_011841

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54767491

Select item 4558483912.

Mapk7 - Ultrafine particles effect on ovalbumin-sensitized lungs

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL4636, 2739 (ID_REF), GDS2976, NM_011841

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 45584839

Select item 3881099113.

Mapk7 - Pubertal mammary gland development

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL339, 1418060_a_at (ID_REF), GDS2721, 23939 (Gene ID), NM_011841

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38810991

Select item 12913177414.

Mapk7 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P359018 (ID_REF), GDS5629, NM_011841, A_51_P359018 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129131774

Select item 12707162715.

Mapk7 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL4134, 38427 (ID_REF), GDS5461, NM_011841, A_51_P359017 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127071627

Select item 5693969116.

Mapk7 - Vancomycin effect on the kidney: dose response

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL1261, 1418060_a_at (ID_REF), GDS3435, 23939 (Gene ID), NM_011841

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56939691

Select item 750160117.

Mapk7 - MPSS transcriptome analysis project

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAAAGGGCTGCACCCT (ID_REF), GDS868, BC013745

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7501601

Select item 450776118.

Mapk7 - Glomerulonephropathy

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL254, 17620 (ID_REF), GDS580, AF126161

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 4507761

Select item 1451084319.

Mapk7 - Obesity and type 2 diabetes: role of adipogenic gene expression (Mu11K-B)

Annotation:: Mapk7, Mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL76, Msa.16051.0_s_at (ID_REF), GDS1456, W75015

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 14510843

Select item 1302007220.

Mapk7 - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Mapk7, mitogen-activated protein kinase 7

Organism:: Mus musculus

Reporter:: GPL891, 12872 (ID_REF), GDS1360, NM_011841, A_51_P359018 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13020072

<< First< Prev

Page of 83

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 23939) (1648)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to: