Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 287

1.
Value/Rank Plot

Retnlg - Age effect on adipocytes of the bone marrow and epididymis

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6246, 10436100 (ID_REF), GDS5226, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 18 samples
2.
Value/Rank Plot

Retnlg - Lung response to highly virulent or low virulent influenza A H3N2 virus infection: time course

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6103, ILMN_2656504 (ID_REF), GDS5159, NM_181596
DataSet type:
Expression profiling by array, transformed count, 18 samples
3.
Value/Rank Plot

Retnlg - Diabetic db/db heart response to rosiglitazone

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL4134, 11670 (ID_REF), GDS4990, NM_181596, A_52_P425839 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 15 samples
4.
Value/Rank Plot

Retnlg - Claudin 18 deficiency effect on the lung

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_2656504 (ID_REF), GDS4961, NM_181596
DataSet type:
Expression profiling by array, transformed count, 7 samples
5.
Value/Rank Plot

Retnlg - Hematopoietic cell response to Xist deficiency in females: time course

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6246, 10436100 (ID_REF), GDS4755, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 20 samples
6.
Value/Rank Plot

Retnlg - Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: time course

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6246, 10436100 (ID_REF), GDS4556, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 26 samples
7.
Value/Rank Plot

Retnlg - IKKbeta deletion effect on neutrophils

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_2656504 (ID_REF), GDS3776, NM_181596
DataSet type:
Expression profiling by array, count, 4 samples
8.
Value/Rank Plot

Retnlg - Intratracheal lipopolysaccharide (IT LPS)-induced lung injury effect on Rag-1 null, lymphocyte-deficient mutants

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL4865, scl0245195.2_0-S (ID_REF), GDS3749, NM_181596
DataSet type:
Expression profiling by array, transformed count, 24 samples
9.
Value/Rank Plot

Retnlg - Normal liver developmental stages: embryonic and postnatal

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P425839 (ID_REF), GDS5818, NM_181596, A_52_P425839 (SPOT ID)
DataSet type:
Expression profiling by array, log2 ratio, 11 samples
10.
Value/Rank Plot

Retnlg - Spleen response to infection by Plasmodium yoelii strains N67 and N67C

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_2656504 (ID_REF), GDS5225, NM_181596
DataSet type:
Expression profiling by array, transformed count, 18 samples
11.
Value/Rank Plot

Retnlg - Pristane-induced arthritis effect on AIRmax and AIRmin acute inflammation model: footpad

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6246, 10436100 (ID_REF), GDS5052, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
12.
Value/Rank Plot

Retnlg - Pristane-induced arthritis effect on AIRmin low acute inflammation model: footpad

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6246, 10436100 (ID_REF), GDS5051, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
13.
Value/Rank Plot

Retnlg - Leukemia inhibitory factor neutralization effect on E. coli pneumonia lung

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL11078, 245195_at (ID_REF), GDS4583, NM_181596
DataSet type:
Expression profiling by array, transformed count, 9 samples
14.
Value/Rank Plot

Retnlg - MPSS transcriptome analysis project

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL1010, GATCTTGGGATATCCGGGAT (ID_REF), GDS868, NM_181596
DataSet type:
Expression profiling by MPSS, count, 87 samples
15.
Value/Rank Plot

Retnlg - Lung from cigarette smoke-related chronic obstructive pulmonary disease model: time course

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_2656504 (ID_REF), GDS5438, NM_181596
DataSet type:
Expression profiling by array, count, 12 samples
16.
Value/Rank Plot

Retnlg - MyD88 and TRIF deficient spleen response to septic peritonitis

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6246, 10436100 (ID_REF), GDS4433, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 12 samples
17.
Value/Rank Plot

Retnlg - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_2656504 (ID_REF), GDS5436, NM_181596, RETNLG (ORF)
DataSet type:
Expression profiling by array, count, 14 samples
18.
Value/Rank Plot

Retnlg - Transcription factor E2-2 haplodeficiency effect on systemic lupus erythematosus model: splenocytes

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6246, 10436100 (ID_REF), GDS5421, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)
DataSet type:
Expression profiling by array, count, 8 samples
19.
Value/Rank Plot

Retnlg - Synergist ablation effect on young adult plantaris muscle: time course

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6246, 10436100 (ID_REF), GDS4932, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)
DataSet type:
Expression profiling by array, count, 14 samples
20.
Value/Rank Plot

Retnlg - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:
Retnlg, resistin like gamma
Organism:
Mus musculus
Reporter:
GPL6246, 10436100 (ID_REF), GDS4371, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 36 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center