Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 1275

1.
Value/Rank Plot

Ms4a8a - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL6246, 10466130 (ID_REF), GDS4578, NM_022430, AF237906, AY039038, BC042719, AB026044, AK172700, chr19:11067471-11081089 (SPOT ID)
DataSet type:
Expression profiling by array, count, 12 samples
2.
Value/Rank Plot

Ms4a8a - Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: time course

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL6246, 10466130 (ID_REF), GDS4556, NM_022430, AF237906, AY039038, BC042719, AB026044, AK172700, chr19:11067471-11081089 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 26 samples
3.
Value/Rank Plot

Ms4a8a - Azoxymethane/dextran sulfate sodium-induced ulcerative colitis-associated colorectal cancer model: time course

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1261, 1418797_at (ID_REF), GDS4367, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, count, 18 samples
4.
Value/Rank Plot

Ms4a8a - CD4CD45Rbhi T-cell transfer colitis model: time course

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1261, 1418797_at (ID_REF), GDS4363, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, count, 16 samples
5.
Value/Rank Plot

Ms4a8a - Intestinal microbiota depletion effect on colon epithelial cells

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_1256614 (ID_REF), GDS3921, NM_022430, MS4A8A (ORF)
DataSet type:
Expression profiling by array, count, 11 samples
6.
Value/Rank Plot

Ms4a8a - Dextran sodium sulfate-induced colitis model: time course

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1261, 1418797_at (ID_REF), GDS3859, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, count, 23 samples
7.
Value/Rank Plot

Ms4a8a - Na+/H+ exchanger 3 deficiency effect on the colon

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1261, 1418797_at (ID_REF), GDS3323, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, count, 6 samples
8.
Value/Rank Plot

Ms4a8a - MPSS transcriptome analysis project

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1010, GATCTCTCTCAGTGGCGGCA (ID_REF), GDS868, BC042719
DataSet type:
Expression profiling by MPSS, count, 87 samples
9.
Value/Rank Plot

Ms4a8a - Intestinal tract gene expression (MG-U74B)

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL82, 111416_at (ID_REF), GDS522, 64381 (Gene ID)
DataSet type:
Expression profiling by array, count, 12 samples
10.
Value/Rank Plot

Ms4a8a - Dietary saturated fat effect on small intestine

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1261, 1418797_at (ID_REF), GDS4339, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, count, 9 samples
11.
Value/Rank Plot

Ms4a8a - Supplementary dietary calcium effect on small-intestinal mucosal cells

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1261, 1418797_at (ID_REF), GDS3831, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, count, 6 samples
12.
Value/Rank Plot

Ms4a8a - Transcription factor GATA4 deficiency effect on the jejunum

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1261, 1418797_at (ID_REF), GDS3486, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, count, 9 samples
13.
Value/Rank Plot

Ms4a8a - High dietary fat effect on small intestine: time course

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1261, 1418797_at (ID_REF), GDS3357, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, count, 18 samples
14.
Value/Rank Plot

Ms4a8a - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P501453 (ID_REF), GDS5629, NM_022430, A_51_P501453 (SPOT ID)
DataSet type:
Expression profiling by array, count, 4 samples
15.
Value/Rank Plot

Ms4a8a - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_1256614 (ID_REF), GDS5436, NM_022430, MS4A8A (ORF)
DataSet type:
Expression profiling by array, count, 14 samples
16.
Value/Rank Plot

Ms4a8a - Linezolid and vancomycin effect on whole blood of methicillin-resistant Staphylococcus aureus (MRSA) sepsis model: time course

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1261, 1418797_at (ID_REF), GDS5315, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, transformed count, 35 samples
17.
Value/Rank Plot

Ms4a8a - Zymosan-induced inflammation effect on peritoneal monocyte and macrophage populations: time course

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL1261, 1418797_at (ID_REF), GDS5060, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, count, 21 samples
18.
Value/Rank Plot

Ms4a8a - Diabetic db/db heart response to rosiglitazone

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL4134, 20602 (ID_REF), GDS4990, NM_022430, A_51_P501453 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 15 samples
19.
Value/Rank Plot

Ms4a8a - Atherosclerosis susceptibility model: macrophages

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL9734, 100088977_TGI_at (ID_REF), GDS4527, NM_022430
DataSet type:
Expression profiling by array, count, 20 samples
20.
Value/Rank Plot

Ms4a8a - Quercetin effect on hepatic cytochrome P-450 oxidoreductase null mutants

Annotation:
Ms4a8a, membrane-spanning 4-domains, subfamily A, member 8A
Organism:
Mus musculus
Reporter:
GPL339, 1418797_at (ID_REF), GDS1678, 64381 (Gene ID), NM_022430
DataSet type:
Expression profiling by array, transformed count, 48 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center