Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 2941

1.
Value/Rank Plot

Enho - Chronic, low level drug exposure effect on obese liver

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P497090 (ID_REF), GDS5258, NM_027147, A_51_P497090 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 24 samples
2.
Value/Rank Plot

Enho - Wild type, postnatal day 7 motor neuron populations

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL1261, 1428739_at (ID_REF), GDS5114, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, count, 9 samples
3.
Value/Rank Plot

Enho - MPSS transcriptome analysis project

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL1010, GATCCAAGAAGTCAGTCGGC (ID_REF), GDS868, BC021944
DataSet type:
Expression profiling by MPSS, count, 87 samples
4.
Value/Rank Plot

Enho - Time course of diabetes-induced, anti-Interferon-γ injected NOD.Scid mice: pancreatic islets

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL1261, 1428739_at (ID_REF), GDS4034, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, transformed count, 8 samples
5.
Value/Rank Plot

Enho - von Hippel-Lindau (VHL) tumor suppressor protein deficiency effect on pancreatic islet cells

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL1261, 1428739_at (ID_REF), GDS3800, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, count, 6 samples
6.
Value/Rank Plot

Enho - Uniparental duplication of chromosome 7 regions effect on embryo and newborn brain (MG-430B)

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL340, 1428739_at (ID_REF), GDS2281, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, count, 4 samples
7.
Value/Rank Plot

Enho - Inbred Long Sleep and Inbred Short Sleep model of ethanol sensitivity: cerebellum (MG-430B)

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL340, 1452893_s_at (ID_REF), GDS1610, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, count, 4 samples
8.
Value/Rank Plot

Enho - Transcription factor Tcf1 knockout effect on pancreatic islets (MG-U74B)

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL82, 111345_at (ID_REF), GDS1474, 69638 (Gene ID), AI835992
DataSet type:
Expression profiling by array, count, 4 samples
9.
Value/Rank Plot

Enho - Glucocorticoid effect on the female liver

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL4134, 42588 (ID_REF), GDS5036, BC021944, A_51_P497090 (SPOT ID)
DataSet type:
Expression profiling by array, count, 6 samples
10.
Value/Rank Plot

Enho - Interstrain differences in the liver effects of trichloroethylene

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P497090 (ID_REF), GDS3890, NM_027147, A_51_P497090 (SPOT ID)
DataSet type:
Expression profiling by array, log2 ratio, 94 samples
11.
Value/Rank Plot

Enho - Liver response to carcinogens that test positive in two-year rodent bioassays

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL1261, 1428739_at (ID_REF), GDS2497, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, transformed count, 18 samples
12.
Value/Rank Plot

Enho - Mammary epithelial stem cells (MG-430B)

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL340, 1433382_at (ID_REF), GDS2254, 69638 (Gene ID), AK004381
DataSet type:
Expression profiling by array, count, 9 samples
13.
Value/Rank Plot

Enho - Developing mammary gland: terminal end buds and ducts

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL2660, 13766 (ID_REF), GDS2115, AK009710
DataSet type:
Expression profiling by array, log2 ratio, 12 samples
14.
Value/Rank Plot

Enho - Adenovirus vector effect on complement system deficient mutant livers

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL3222, M200007480 (ID_REF), GDS1826, AK009710
DataSet type:
Expression profiling by array, log2 ratio, 29 samples
15.
Value/Rank Plot

Enho - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL1261, 1452893_s_at (ID_REF), GDS3596, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, transformed count, 9 samples
16.
Value/Rank Plot

Enho - Uniparental duplication of chromosome 7 regions effect on embryo and newborn brain (MG-430B)

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL340, 1452893_s_at (ID_REF), GDS2281, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, count, 4 samples
17.
Value/Rank Plot

Enho - Articular cartilage zones: 1-week old normal proximal tibia

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL1261, 1428739_at (ID_REF), GDS5433, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, transformed count, 14 samples
18.
Value/Rank Plot

Enho - Fezf2 overexpresson effect on cortical neural progenitors in vivo: time course

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL1261, 1428739_at (ID_REF), GDS5297, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, transformed count, 14 samples
19.
Value/Rank Plot

Enho - Glucose effect on young and aged pancreatic islets: dose response

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL1261, 1428739_at (ID_REF), GDS4939, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, count, 20 samples
20.
Value/Rank Plot

Enho - IQGAP2 knockout model of hepatocellular carcinoma: time course

Annotation:
Enho, energy homeostasis associated
Organism:
Mus musculus
Reporter:
GPL1261, 1428739_at (ID_REF), GDS4874, 69638 (Gene ID), BB772205
DataSet type:
Expression profiling by array, transformed count, 12 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center