Format
Items per page
Sort by

Send to:

Choose Destination

Links from GEO Profiles

Items: 1 to 20 of 200

1.
Value/Rank Plot

Slc34a1 - Adult and juvenile streptozocin-induced diabetic littermates: kidney cortex

Annotation:
Slc34a1, solute carrier family 34 member 1
Organism:
Rattus norvegicus
Reporter:
GPL1355, 1368680_a_at (ID_REF), GDS4038, 25548 (Gene ID), AB013455
DataSet type:
Expression profiling by array, count, 12 samples
2.
Value/Rank Plot

Slc34a1 - Model for Wilms tumor of the kidney: time course

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_2598639 (ID_REF), GDS5415, NM_011392
DataSet type:
Expression profiling by array, count, 8 samples
3.
Value/Rank Plot

Slc34a1 - Colistin effect on the kidney

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_2598639 (ID_REF), GDS4834, NM_011392, SLC34A1 (ORF)
DataSet type:
Expression profiling by array, count, 12 samples
4.
Value/Rank Plot

Slc34a1 - Pan-peroxisome proliferator-activated receptor agonist effect on various tissues: dose response

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL1261, 1423279_at (ID_REF), GDS4806, 20505 (Gene ID)
DataSet type:
Expression profiling by array, transformed count, 36 samples
5.
Value/Rank Plot

Slc34a1 - Lupus nephritis model response to sirolimus-induced mTOR inhibition (Mu11KsubA)

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL75, l33878_s_at (ID_REF), GDS4186, 20505 (Gene ID), L33878
DataSet type:
Expression profiling by array, count, 16 samples
6.
Value/Rank Plot

Slc34a1 - HIV-associated nephropathy model: kidney

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL1261, 1423279_at (ID_REF), GDS4220, 20505 (Gene ID)
DataSet type:
Expression profiling by array, count, 4 samples
7.
Value/Rank Plot

Slc34a1 - Heart, kidney and lung during juvenile growth

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL1261, 1423279_at (ID_REF), GDS4316, 20505 (Gene ID)
DataSet type:
Expression profiling by array, count, 40 samples
8.
Value/Rank Plot

SLC34A1 - Compendium of normal tissues

Annotation:
SLC34A1, solute carrier family 34 (type II sodium/phosphate cotransporter), member 1
Organism:
Canis lupus familiaris
Reporter:
GPL3738, Cfa.13784.1.S1_at (ID_REF), GDS4164, 479275 (Gene ID), CO681299
DataSet type:
Expression profiling by array, transformed count, 39 samples
9.
Value/Rank Plot

Slc34a1 - Uninephrectomy effect on OVE26 diabetic kidney

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL1261, 1423279_at (ID_REF), GDS3990, 20505 (Gene ID)
DataSet type:
Expression profiling by array, count, 4 samples
10.
Value/Rank Plot

Slc34a1 - Fasting effect on multiple tissues: time course

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL11012, 9731 (ID_REF), GDS3893, NM_011392
DataSet type:
Expression profiling by array, log2 ratio, 122 samples
11.
Value/Rank Plot

Slc34a1 - X chromosome dosage model

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL6105, ILMN_2598639 (ID_REF), GDS3728, NM_011392
DataSet type:
Expression profiling by array, transformed count, 36 samples
12.
Value/Rank Plot

Slc34a1 - Claudin16 deficiency effect on kidneys

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_2598639 (ID_REF), GDS3612, NM_011392, SLC34A1 (ORF)
DataSet type:
Expression profiling by array, count, 11 samples
13.
Value/Rank Plot

Slc34a1 - Dent disease model: renal proximal tubules

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL1261, 1423279_at (ID_REF), GDS3397, 20505 (Gene ID)
DataSet type:
Expression profiling by array, count, 6 samples
14.
Value/Rank Plot

Slc34a1 - Aquaporin-11 deficiency effect on the kidney

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL1261, 1423279_at (ID_REF), GDS3395, 20505 (Gene ID)
DataSet type:
Expression profiling by array, count, 16 samples
15.
Value/Rank Plot

Slc34a1 - Hereditary pulmonary arterial hypertension model: lung

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL339, 1423279_at (ID_REF), GDS2248, 20505 (Gene ID)
DataSet type:
Expression profiling by array, count, 5 samples
16.
Value/Rank Plot

Slc34a1 - Hoxa11/Hoxd11 null mutation effect on embryonic kidney development (MG-430A)

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL339, 1423279_at (ID_REF), GDS2030, 20505 (Gene ID)
DataSet type:
Expression profiling by array, count, 14 samples
17.
Value/Rank Plot

Slc34a1 - Homeobox Lim1 mutant nephron-deficient kidneys

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL1261, 1423279_at (ID_REF), GDS1748, 20505 (Gene ID)
DataSet type:
Expression profiling by array, count, 8 samples
18.
Value/Rank Plot

Slc34a1 - X-linked hypophosphatemia and low phosphate diet

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL81, 101552_at (ID_REF), GDS879, 20505 (Gene ID), L33878
DataSet type:
Expression profiling by array, count, 20 samples
19.
Value/Rank Plot

Slc34a1 - MPSS transcriptome analysis project

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCAGCATTGAGCGGGCCT (ID_REF), GDS868, BC020529
DataSet type:
Expression profiling by MPSS, count, 87 samples
20.
Value/Rank Plot

Slc34a1 - Sex specific transcription in somatic and reproductive tissues

Annotation:
Slc34a1, solute carrier family 34 (sodium phosphate), member 1
Organism:
Mus musculus
Reporter:
GPL339, 1423279_at (ID_REF), GDS565, 20505 (Gene ID)
DataSet type:
Expression profiling by array, count, 48 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center