Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 1032

1.
Value/Rank Plot

Typical and atypical antipsychotic drugs effect on brain

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL891, 18280 (ID_REF), GDS775, BC005705, A_51_P136858 (SPOT ID)
DataSet type:
Expression profiling by array, log ratio, 4 samples
2.
Value/Rank Plot

Pubertal mammary gland development

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL339, 1425909_at (ID_REF), GDS2721, BC005705
DataSet type:
Expression profiling by array, transformed count, 14 samples
3.
Value/Rank Plot

Serum response factor deficient B cells

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL339, 1425909_at (ID_REF), GDS2805, BC005705
DataSet type:
Expression profiling by array, count, 4 samples
4.
Value/Rank Plot

Neuralized embryoid bodies response to Hedgehog agonist

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1261, 1425909_at (ID_REF), GDS2707, BC005705
DataSet type:
Expression profiling by array, count, 8 samples
5.
Value/Rank Plot

Spatial and temporal development of mammalian salivary glands

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P136858 (ID_REF), GDS3922, BC005705, A_51_P136858 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 84 samples
ID:
72819864
6.
Value/Rank Plot

RPE65 null mutant model of Leber's congenital amaurosis

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1261, 1425909_at (ID_REF), GDS1647, BC005705
DataSet type:
Expression profiling by array, transformed count, 18 samples
7.
Value/Rank Plot

Murine model of primary mitochondrial dysfunction

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1261, 1425909_at (ID_REF), GDS3454, BC005705
DataSet type:
Expression profiling by array, transformed count, 6 samples
8.
Value/Rank Plot

Estradiol effect on the uterus: time course

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL891, 18280 (ID_REF), GDS2208, BC005705, A_51_P136858 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 10 samples
9.
Value/Rank Plot

Embryonic lung side population CD45+ and CD45- cell comparison

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL339, 1425909_at (ID_REF), GDS1037, BC005705
DataSet type:
Expression profiling by array, count, 14 samples
10.
Value/Rank Plot

4T1 breast cancer model: metastatic sub-populations

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P136858 (ID_REF), GDS5666, BC005705, A_51_P136858 (SPOT ID)
DataSet type:
Expression profiling by array, count, 15 samples
11.
Value/Rank Plot

Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1073, gnf1m15404_at (ID_REF), GDS2327, BC005705
DataSet type:
Expression profiling by array, count, 6 samples
12.
Value/Rank Plot

Rough attenuated Brucella suis strain infection effect on macrophage cell line: time course

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1261, 1425909_at (ID_REF), GDS4432, BC005705
DataSet type:
Expression profiling by array, count, 42 samples
13.
Value/Rank Plot

Leptin deficiency effect on lungs

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL339, 1425909_at (ID_REF), GDS3316, BC005705
DataSet type:
Expression profiling by array, count, 6 samples
14.
Value/Rank Plot

Caloric restriction effect on aged cochlea

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1261, 1425909_at (ID_REF), GDS2681, BC005705
DataSet type:
Expression profiling by array, count, 9 samples
15.
Value/Rank Plot

Age effect on hematopoietic stem cells

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1261, 1425909_at (ID_REF), GDS1803, BC005705
DataSet type:
Expression profiling by array, count, 8 samples
16.
Value/Rank Plot

All-trans retinoic acid effect on retinoic acid receptor α-deficient F9 teratocarcinoma cells

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1261, 1425909_at (ID_REF), GDS4294, BC005705
DataSet type:
Expression profiling by array, transformed count, 12 samples
17.
Value/Rank Plot

Homeobox Lim1 mutant nephron-deficient kidneys

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1261, 1425909_at (ID_REF), GDS1748, BC005705
DataSet type:
Expression profiling by array, count, 8 samples
18.
Value/Rank Plot

Mammary epithelial stem cells (MG-430A)

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL339, 1425909_at (ID_REF), GDS2253, BC005705
DataSet type:
Expression profiling by array, count, 9 samples
19.
Value/Rank Plot

Embryonic gonad development

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1261, 1425909_at (ID_REF), GDS2719, BC005705
DataSet type:
Expression profiling by array, count, 20 samples
20.
Value/Rank Plot

MPSS transcriptome analysis project

Annotation:
Mus musculus cDNA sequence BC005705, mRNA (cDNA clone MGC:11898 IMAGE:3598523), complete cds
Organism:
Mus musculus
Reporter:
GPL1010, GATCTCTGTAAGTTCAAGGT (ID_REF), GDS868, BC005705
DataSet type:
Expression profiling by MPSS, count, 87 samples
ID:
7473655
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center