Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 970

1.
Value/Rank Plot

Pmm1 - An in vitro primordial germ cell specification system: time course

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS4870, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 23 samples
2.
Value/Rank Plot

Pmm1 - Aged, lupus-prone MRL/Faslpr model: splenic CD4 T cells

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS4190, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, transformed count, 12 samples
3.
Value/Rank Plot

Pmm1 - UTX deficiency effect on embryonic stem cells

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS5465, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 4 samples
4.
Value/Rank Plot

Pmm1 - Polycomb repressive complex 1 protein Bmi1 transduced CCE embryonic stem cells and differentiated embryoid body samples

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS4211, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, transformed count, 8 samples
5.
Value/Rank Plot

Pmm1 - Dicer deficiency effect on embryonic stem cells

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS3404, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 6 samples
6.
Value/Rank Plot

Pmm1 - Chromatin remodeling component BAF250a deficiency effect on embryonic stem cells in vitro

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS3387, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 4 samples
7.
Value/Rank Plot

Pmm1 - Rb null mutant embryonic fibroblast response to cisplatin

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL339, 1424167_a_at (ID_REF), GDS3099, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 12 samples
8.
Value/Rank Plot

Pmm1 - MPSS transcriptome analysis project

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCTATGCGGACCCCCGGA (ID_REF), GDS868, BC006809
DataSet type:
Expression profiling by MPSS, count, 87 samples
9.
Value/Rank Plot

Pmm1 - Small molecule GW8510 effect on pancreatic alpha cell

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL8321, 1424167_a_at (ID_REF), GDS5502, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 6 samples
10.
Value/Rank Plot

Pmm1 - Telomere-associated protein Rif1 depletion effect on stem cell lines

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS4943, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 8 samples
11.
Value/Rank Plot

Pmm1 - Embryonic stem cell cardiopoiesis

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS3729, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 12 samples
12.
Value/Rank Plot

Pmm1 - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS3596, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, transformed count, 9 samples
13.
Value/Rank Plot

Pmm1 - Trans-10, cis-12 conjugated linoleic acid and metformin effect on 3T3-L1 adipocytes

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS3808, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, transformed count, 12 samples
14.
Value/Rank Plot

Pmm1 - Calreticulin deficiency effect on embryonic stem cell line

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS3680, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 7 samples
15.
Value/Rank Plot

Pmm1 - Dicer deficiency effect on preadipocytes

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS5234, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 8 samples
16.
Value/Rank Plot

Pmm1 - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL6246, 10430794 (ID_REF), GDS4973, NM_001282040, NM_013872, AF007267, AK013805, BC006809, NM_001282041, chr15:81951108-81960869 (SPOT ID)
DataSet type:
Expression profiling by array, count, 4 samples
17.
Value/Rank Plot

Pmm1 - Stearoyl-CoA desaturase-1 deficiency effect on the skin

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS4910, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 6 samples
18.
Value/Rank Plot

Pmm1 - bHLH transcription factor Mesogenin1 ectopic expression effect on embryoid bodies: time course

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS4442, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 18 samples
19.
Value/Rank Plot

Pmm1 - Dicer deficient embryonic stem cell response to miR-290 transfection

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS3430, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 6 samples
20.
Value/Rank Plot

Pmm1 - Calcium-signaling effects on blastocyts

Annotation:
Pmm1, phosphomannomutase 1
Organism:
Mus musculus
Reporter:
GPL1261, 1424167_a_at (ID_REF), GDS3293, 29858 (Gene ID), BC006809
DataSet type:
Expression profiling by array, count, 12 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center