Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 357

1.
Value/Rank Plot

Csad - Normal liver developmental stages: embryonic and postnatal

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P268529 (ID_REF), GDS5818, NM_144942, A_51_P268529 (SPOT ID)
DataSet type:
Expression profiling by array, log2 ratio, 11 samples
2.
Value/Rank Plot

Csad - Hypertension model: liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL9734, 100092279_TGI_at (ID_REF), GDS3674, NM_144942
DataSet type:
Expression profiling by array, count, 15 samples
3.
Value/Rank Plot

Csad - SIRT1 deficiency effect on the liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P325776 (ID_REF), GDS3666, NM_144942, A_51_P325776 (SPOT ID)
DataSet type:
Expression profiling by array, count, 6 samples
4.
Value/Rank Plot

Csad - Glucocorticoid effect on the male liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL4134, 26942 (ID_REF), GDS5035, NM_144942, A_51_P325776 (SPOT ID)
DataSet type:
Expression profiling by array, count, 6 samples
5.
Value/Rank Plot

Csad - SIRT1 deficiency effect on the liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P268529 (ID_REF), GDS3666, NM_144942, A_51_P268529 (SPOT ID)
DataSet type:
Expression profiling by array, count, 6 samples
6.
Value/Rank Plot

Csad - Normal liver developmental stages: embryonic and postnatal

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P325776 (ID_REF), GDS5818, NM_144942, A_51_P325776 (SPOT ID)
DataSet type:
Expression profiling by array, log2 ratio, 11 samples
7.
Value/Rank Plot

Csad - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL6246, 10432939 (ID_REF), GDS3748, NM_144942, AY033912, chr15:102176998-102189415 (SPOT ID)
DataSet type:
Expression profiling by array, count, 15 samples
8.
Value/Rank Plot

Csad - Hypertension model: kidney

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL9734, 100092279_TGI_at (ID_REF), GDS3675, NM_144942
DataSet type:
Expression profiling by array, count, 14 samples
9.
Value/Rank Plot

Csad - Iron enriched and deficient diets effect on the liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL4134, 26942 (ID_REF), GDS3373, NM_144942, A_51_P325776 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 30 samples
10.
Value/Rank Plot

Csad - Nephronophthisis model

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL2897, 155025 (ID_REF), GDS2817, NM_144942
DataSet type:
Expression profiling by array, count, 6 samples
11.
Value/Rank Plot

Csad - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL2897, 155025 (ID_REF), GDS1729, NM_144942
DataSet type:
Expression profiling by array, count, 10 samples
12.
Value/Rank Plot

Csad - Diet-induced obesity model: liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_2810624 (ID_REF), GDS6248, NM_144942, CSAD (ORF)
DataSet type:
Expression profiling by array, transformed count, 51 samples
13.
Value/Rank Plot

Csad - Diet-induced obesity model: white adipose tissue

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_2777059 (ID_REF), GDS6247, NM_144942, CSAD (ORF)
DataSet type:
Expression profiling by array, transformed count, 40 samples
14.
Value/Rank Plot

Csad - Liver response to a high fat diet: time course

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL6246, 10432939 (ID_REF), GDS4783, NM_144942, AY033912, chr15:102176998-102189415 (SPOT ID)
DataSet type:
Expression profiling by array, count, 36 samples
15.
Value/Rank Plot

Csad - Claudin16 deficiency effect on kidneys

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_2777059 (ID_REF), GDS3612, NM_144942, CSAD (ORF)
DataSet type:
Expression profiling by array, count, 11 samples
16.
Value/Rank Plot

Csad - Diet-induced obesity model: liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_2777059 (ID_REF), GDS6248, NM_144942, CSAD (ORF)
DataSet type:
Expression profiling by array, transformed count, 51 samples
17.
Value/Rank Plot

Csad - Lipopolysaccharide effect on transmembrane protease, serine 6 deficient liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_2810624 (ID_REF), GDS5271, NM_144942, CSAD (ORF)
DataSet type:
Expression profiling by array, count, 12 samples
18.
Value/Rank Plot

Csad - Lipopolysaccharide effect on transmembrane protease, serine 6 deficient liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_2777059 (ID_REF), GDS5271, NM_144942, CSAD (ORF)
DataSet type:
Expression profiling by array, count, 12 samples
19.
Value/Rank Plot

Csad - Streptozotocin induced type 1 diabetes: liver

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL6246, 10432939 (ID_REF), GDS4845, NM_144942, AY033912, chr15:102176998-102189415 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 13 samples
20.
Value/Rank Plot

Csad - MPSS transcriptome analysis project

Annotation:
Csad, cysteine sulfinic acid decarboxylase
Organism:
Mus musculus
Reporter:
GPL1010, GATCCCAGGCCAGCTACCTC (ID_REF), GDS868, NM_144942
DataSet type:
Expression profiling by MPSS, count, 87 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center