GEO Profiles Links for Nucleotide (Select 19527377) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 301

<< First< Prev

Page of 16

Next >Last >>

Select item 1299519001.

Tmem109 - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2685275 (ID_REF), GDS5651, NM_134142, TMEM109 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129951900

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 481939462.

Tmem109 - Iron overload effect on cardiac and skeletal muscles

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL4234, 2360577 (ID_REF), GDS3086, NM_134142

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48193946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 296659153.

Tmem109 - Atherogenic diet effect on the liver: time course

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL1292, AGmmB061323 (ID_REF), GDS2292, NM_134142

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 29665915

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303703434.

Tmem109 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL4134, 25343 (ID_REF), GDS5664, NM_134142, A_51_P114049 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130370343

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1273110075.

Tmem109 - Left ventricle myocardium from MerCreMer model of transient cardiomyopathy: time course

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2685275 (ID_REF), GDS5469, NM_134142

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 127311007

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1270585436.

Tmem109 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL4134, 25343 (ID_REF), GDS5461, NM_134142, A_51_P114049 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127058543

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1263404077.

Tmem109 - Lung from cigarette smoke-related chronic obstructive pulmonary disease model: time course

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2685275 (ID_REF), GDS5438, NM_134142

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 126340407

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 596613628.

Tmem109 - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2685275 (ID_REF), GDS3522, NM_134142

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59661362

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1310727079.

Tmem109 - Radioactive iodine effect on normal thyroid: dose response

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2685275 (ID_REF), GDS5803, NM_134142

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 131072707

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12626370010.

Tmem109 - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2685275 (ID_REF), GDS5436, NM_134142, TMEM109 (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126263700

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12141220711.

Tmem109 - Negative elongation factor B subunit deficiency effect on the heart

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2685275 (ID_REF), GDS5302, NM_134142

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 121412207

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752874812.

Tmem109 - MPSS transcriptome analysis project

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGTTCTGCAGGGCTAG (ID_REF), GDS868, NM_134142

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7528748

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12912061813.

Tmem109 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P114049 (ID_REF), GDS5629, NM_134142, A_51_P114049 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129120618

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12572750714.

Tmem109 - Receptor activator of NF-κB ligand effect on bone marrow-derived macrophage cells: time course

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2685275 (ID_REF), GDS5422, NM_134142

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125727507

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10329700015.

Tmem109 - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2685275 (ID_REF), GDS4795, NM_134142, TMEM109 (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103297000

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6230060016.

Tmem109 - Claudin16 deficiency effect on kidneys

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2685275 (ID_REF), GDS3612, NM_134142, TMEM109 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 62300600

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12774760017.

Tmem109 - Rosiglitazone effect on adipose progenitor cells

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2685275 (ID_REF), GDS5520, NM_134142, TMEM109 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 127747600

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12372820718.

Tmem109 - Ethanol effect on myoblast differentiation in vitro

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2685275 (ID_REF), GDS5370, NM_134142

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 123728207

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12112320019.

Tmem109 - Kelch-like family member 40 deficiency effect on the skeletal muscle

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2685275 (ID_REF), GDS5295, NM_134142, TMEM109 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 121123200

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7464650020.

Tmem109 - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Tmem109, transmembrane protein 109

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2685275 (ID_REF), GDS3974, NM_134142, TMEM109 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74646500

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 19527377) (301)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 301

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity