GEO Profiles Links for Nucleotide (Select 225007618) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 285

<< First< Prev

Page of 15

Next >Last >>

Select item 1181554911.

Retnlg - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6246, 10436100 (ID_REF), GDS5226, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118155491

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1160289502.

Retnlg - Lung response to highly virulent or low virulent influenza A H3N2 virus infection: time course

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2656504 (ID_REF), GDS5159, NM_181596

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 116028950

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1092215703.

Retnlg - Diabetic db/db heart response to rosiglitazone

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL4134, 11670 (ID_REF), GDS4990, NM_181596, A_52_P425839 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109221570

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1083016564.

Retnlg - Claudin 18 deficiency effect on the lung

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2656504 (ID_REF), GDS4961, NM_181596

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 108301656

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1017517915.

Retnlg - Hematopoietic cell response to Xist deficiency in females: time course

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6246, 10436100 (ID_REF), GDS4755, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 20 samples

ID:: 101751791

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 990390916.

Retnlg - Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: time course

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6246, 10436100 (ID_REF), GDS4556, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 26 samples

ID:: 99039091

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 677200567.

Retnlg - IKKbeta deletion effect on neutrophils

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2656504 (ID_REF), GDS3776, NM_181596

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 67720056

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 666823628.

Retnlg - Intratracheal lipopolysaccharide (IT LPS)-induced lung injury effect on Rag-1 null, lymphocyte-deficient mutants

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL4865, scl0245195.2_0-S (ID_REF), GDS3749, NM_181596

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 66682362

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1316519589.

Retnlg - Normal liver developmental stages: embryonic and postnatal

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P425839 (ID_REF), GDS5818, NM_181596, A_52_P425839 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131651958

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11812895610.

Retnlg - Spleen response to infection by Plasmodium yoelii strains N67 and N67C

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2656504 (ID_REF), GDS5225, NM_181596

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118128956

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11084889111.

Retnlg - Pristane-induced arthritis effect on AIRmax and AIRmin acute inflammation model: footpad

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6246, 10436100 (ID_REF), GDS5052, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110848891

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11081219112.

Retnlg - Pristane-induced arthritis effect on AIRmin low acute inflammation model: footpad

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6246, 10436100 (ID_REF), GDS5051, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110812191

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9988121113.

Retnlg - Leukemia inhibitory factor neutralization effect on E. coli pneumonia lung

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL11078, 245195_at (ID_REF), GDS4583, NM_181596

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 99881211

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752584614.

Retnlg - MPSS transcriptome analysis project

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTGGGATATCCGGGAT (ID_REF), GDS868, NM_181596

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7525846

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12632825615.

Retnlg - Lung from cigarette smoke-related chronic obstructive pulmonary disease model: time course

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2656504 (ID_REF), GDS5438, NM_181596

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 126328256

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9233279116.

Retnlg - MyD88 and TRIF deficient spleen response to septic peritonitis

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6246, 10436100 (ID_REF), GDS4433, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 92332791

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12624225117.

Retnlg - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2656504 (ID_REF), GDS5436, NM_181596, RETNLG (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126242251

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12567869118.

Retnlg - Transcription factor E2-2 haplodeficiency effect on systemic lupus erythematosus model: splenocytes

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6246, 10436100 (ID_REF), GDS5421, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125678691

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11404129119.

Retnlg - Synergist ablation effect on young adult plantaris muscle: time course

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6246, 10436100 (ID_REF), GDS4932, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 114041291

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8471549120.

Retnlg - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: Retnlg, resistin like gamma

Organism:: Mus musculus

Reporter:: GPL6246, 10436100 (ID_REF), GDS4371, NM_181596, AB086819, AJ514933, BC117106, chr16:48872645-48874498 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84715491

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 225007618) (285)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 285

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity